<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/32730?offset=680</link>
	<atom:link href="https://bioinformaticsonline.com/related/32730?offset=680" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42419/biojupies-automatically-generates-rna-seq-data-analysis-notebooks</guid>
	<pubDate>Sun, 20 Dec 2020 11:43:45 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42419/biojupies-automatically-generates-rna-seq-data-analysis-notebooks</link>
	<title><![CDATA[BioJupies: Automatically Generates RNA-seq Data Analysis Notebooks]]></title>
	<description><![CDATA[<p>With BioJupies you can produce in seconds a customized, reusable, and interactive report from your own raw or processed RNA-seq data through a simple user interface</p>
<p>BioJupies now supports user accounts! Sign in from the top right corner of the page for access to unlimited private notebooks, RNA-seq datasets and alignment jobs.</p><p>Address of the bookmark: <a href="https://amp.pharm.mssm.edu/biojupies/" rel="nofollow">https://amp.pharm.mssm.edu/biojupies/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/28879/projects-opening-at-nbagr</guid>
  <pubDate>Wed, 24 Aug 2016 04:13:13 -0500</pubDate>
  <link></link>
  <title><![CDATA[Projects opening at NBAGR]]></title>
  <description><![CDATA[
<p>ICAR - NATIONAL BUREAU OF ANIMAL GENETIC RESOURCES</p>

<p>Karnal -132001 (Haryana)</p>

<p>A walk-in-Interview is proposed to be held at National Bureau of Animal Genetic Resources, Karnal (Haryana)-132001 at 10:30 AM on 05.09.2016 for the selection of Three Research Associate &amp; One Young Professional - II as per details given below:</p>

<p>Name of the Scheme / Project: Center for Agricultural Bioinformatics. The post duration is Upto 31.032017 or earlier &amp; Co-terminus with the project.</p>

<p>Research Associate (Three posts)</p>

<p>Date &amp; Time of Interview: 10.30 A.M. on 05.09.2016</p>

<p>Essential Qualifications: PhD degree in any one of discipline/Subject Biotechnology/ Animal Genetics and Breeding/ Biochemistry/ Bioinformatics/Molecular Genetics OR Master’s degree in any one of above mentioned discipline/Subject with 4 years/5 years of Bachelor’s degree having 1st division or 60% marks or equivalent overall grade point average, with at least two years of research experience as evidenced from Fellowship/Associateship</p>

<p>Desirable Qualifications: Experience in Database/Next Generation Sequencing Data analysis for 02 RA posts or working experience in molecular biology, gene expression data analysis, SNP genotyping and sequence data analysis, functional gene characterization for 01 RA post.</p>

<p>Young Professionals II One position</p>

<p>Date &amp; Time of Interview: 10.30 A.M. on 05.09.2016</p>

<p>Essential: B. Tech or M.Tech. in Bioinformatics / Computer Science / Computer Application.</p>

<p>Desirable: Experience in Linux, MySQL, Java, C++/ PHP/ PERL R based data analysis and application development in Bioinformatics.</p>

<p>More Info : http://14.139.252.116/ADvertisementforCabinScheme.pdf</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/27945/srf-project-assistant-bioinformatics-at-nirrh</guid>
  <pubDate>Sun, 19 Jun 2016 09:11:13 -0500</pubDate>
  <link></link>
  <title><![CDATA[SRF/ Project Assistant Bioinformatics at NIRRH]]></title>
  <description><![CDATA[
<p>SRF/ Project Assistant Bioinformatics recruitment in National Institute for Research in Reproductive Health (NIRRH)</p>

<p>Title of Project : 1. “Analysis Of The Structures Of Known Antimicrobial Peptides Using Machine Learning Algoitms And Molecular Dynamics Simulations”</p>

<p>Senior Research Fellow /1 Post</p>

<p>Qualification: First class M.Sc. in Bioinformatics/ Biological Sciences from recognized university with 2 years research experience and CSIR/UGC/ICMR net qualified OR First class M.Sc. in Bioinformatics/ Biological Sciences from recognized university with 2 years research experience Research experience in bioinformatics and wetlab methods. </p>

<p>Age: Not exceeding 35 Years</p>

<p>Pay Scale : Rs.18,000/- + 30% HRA Rs.14,000/- + 30% HRA </p>

<p>Project Assistant (Level-II) /1 Post</p>

<p>Qualification:  First class M.Sc. in Bioinformatics/ Biological Sciences/Computer Sciences Training experience in bioinformatics and wetlab methods .</p>

<p>Age: Not exceeding 28 Years </p>

<p>Pay Scale : Rs.8,000<br />How to apply<br />Candidates must bring along with them all the relevant documents in original and one set of attested photocopies of the same and one passport size recent colour photograph. </p>

<p>Walk-in-Interview on 28.06.2016 between 09:00 hrs. to 12:00 hrs.</p>

<p>More at http://www.nirrh.res.in/links/job_oppotunities.htm</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</guid>
	<pubDate>Fri, 13 Dec 2024 11:41:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</link>
	<title><![CDATA[Step-by-Step Guide to Detect piRNAs Using Bioinformatics]]></title>
	<description><![CDATA[<p>Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNAs that play crucial roles in silencing transposable elements and regulating gene expression, particularly in germline cells. Detecting piRNAs involves identifying their unique characteristics, such as size, sequence motifs, and association with Piwi proteins, from high-throughput RNA sequencing data.</p><p>This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.</p><h4><strong>Step 1: Prepare Your Data</strong></h4><ol>
<li>
<p><strong>Obtain RNA Sequencing Data</strong><br />Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like <strong>NCBI SRA</strong>, <strong>EMBL-EBI</strong>, or specific small RNA sequencing projects.</p>
</li>
<li>
<p><strong>Quality Control (QC)</strong><br />Use <strong>FastQC</strong> to assess the quality of raw reads:</p>
<div>
<div dir="ltr"><code>fastqc reads.fastq </code></div>
</div>
<p>Evaluate the per-base quality, adapter content, and overrepresented sequences.</p>
</li>
<li>
<p><strong>Trimming and Adapter Removal</strong><br />Use tools like <strong>Cutadapt</strong> or <strong>Trim Galore!</strong> to remove adapters and low-quality bases:</p>
<div>
<div dir="ltr"><code>cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq </code></div>
</div>
<p>Ensure the remaining reads are of high quality for downstream analysis.</p>
</li>
</ol><h4><strong>Step 2: Map Reads to the Genome</strong></h4><p>Mapping reads to the reference genome is crucial for identifying piRNA loci.</p><ol>
<li>
<p><strong>Reference Genome Preparation</strong><br />Download the genome assembly of your organism from databases like <strong>Ensembl</strong>, <strong>UCSC Genome Browser</strong>, or <strong>NCBI</strong>.</p>
</li>
<li>
<p><strong>Align Reads</strong><br />Use <strong>Bowtie</strong> or <strong>STAR</strong> for small RNA alignment:</p>
<div>
<div dir="ltr"><code>bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam </code></div>
</div>
<ul>
<li><code>-v 1</code>: Allows one mismatch.</li>
<li><code>-k 1</code>: Reports the best alignment.</li>
</ul>
</li>
<li>
<p><strong>Convert SAM to BAM</strong><br />Convert and sort alignments using <strong>SAMtools</strong>:</p>
<div>
<div dir="ltr"><code>samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam </code></div>
</div>
</li>
</ol><h4><strong>Step 3: Identify Small RNAs</strong></h4><p>piRNAs are characterized by their size (24&ndash;32 nt) and strand bias.</p><ol>
<li>
<p><strong>Extract Reads by Size</strong><br />Use tools like <strong>BEDtools</strong> or custom scripts to filter reads between 24 and 32 nt:</p>
<div>
<div dir="ltr"><code>bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq &gt; piRNA_size_reads.fastq </code></div>
</div>
</li>
<li>
<p><strong>Check for Sequence Bias</strong><br />piRNAs often have a strong bias for a uridine at the 5&rsquo; end (1U bias). Use tools like <strong>WebLogo</strong> to visualize sequence motifs.</p>
</li>
</ol><h4><strong>Step 4: Detect Ping-Pong Signature</strong></h4><p>The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.</p><ol>
<li>
<p><strong>Generate Overlap Statistics</strong><br />Use the <strong>piPipes</strong> tool or custom scripts to calculate overlap:</p>
<div>
<div dir="ltr"><code>python ping_pong_overlap.py sorted_reads.bam </code></div>
</div>
</li>
<li>
<p><strong>Visualize Overlap Distribution</strong><br />Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.</p>
</li>
</ol><h4><strong>Step 5: Annotate piRNA Clusters</strong></h4><p>piRNAs are often generated from genomic clusters.</p><ol>
<li>
<p><strong>Cluster Identification</strong><br />Use tools like <strong>proTRAC</strong> or <strong>PIRANHA</strong> to identify piRNA-producing clusters:</p>
<div>
<div dir="ltr"><code>proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters </code></div>
</div>
</li>
<li>
<p><strong>Annotate Genomic Regions</strong><br />Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like <strong>BEDtools intersect</strong> can help associate piRNA clusters with genes or transposable elements:</p>
<div>
<div dir="ltr"><code>bedtools intersect -a clusters.bed -b genome_annotation.gtf &gt; annotated_clusters.bed </code></div>
</div>
</li>
</ol><h4><strong>Step 6: Functional Analysis</strong></h4><p>Functional analysis of piRNAs can uncover their targets and regulatory roles.</p><ol>
<li>
<p><strong>Predict piRNA Targets</strong><br />Use tools like <strong>IntaRNA</strong> or <strong>RNAhybrid</strong> to predict interactions between piRNAs and potential target mRNAs:</p>
<div>
<div dir="ltr"><code>RNAhybrid -t target_transcripts.fa -q piRNAs.fa &gt; piRNA_targets.txt </code></div>
</div>
</li>
<li>
<p><strong>Enrichment Analysis</strong><br />Perform GO or KEGG enrichment analysis of target genes using tools like <strong>g:Profiler</strong> or <strong>DAVID</strong>.</p>
</li>
</ol><h4><strong>Step 7: Validation and Visualization</strong></h4><ol>
<li>
<p><strong>Validate piRNA Candidates</strong><br />Cross-check the identified piRNAs against known piRNA databases, such as <strong>piRBase</strong> or <strong>piRNAdb</strong>.</p>
</li>
<li>
<p><strong>Visualize Results</strong></p>
<ul>
<li>Use <strong>IGV</strong> (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.</li>
<li>Generate heatmaps or circos plots to present piRNA distributions.</li>
</ul>
</li>
</ol><h4><strong>Step 8: Share and Publish Findings</strong></h4><ol>
<li>
<p><strong>Archive Data</strong><br />Submit sequencing data to public repositories like <strong>SRA</strong> or <strong>GEO</strong> with metadata specifying piRNA-related experiments.</p>
</li>
<li>
<p><strong>Publish Results</strong><br />Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.</p>
</li>
</ol><h4><strong>Conclusion</strong></h4><p>Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.</p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/27971/samtools-primer</guid>
	<pubDate>Thu, 23 Jun 2016 07:18:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/27971/samtools-primer</link>
	<title><![CDATA[Samtools Primer !!]]></title>
	<description><![CDATA[<p>SAMtools: Primer / Tutorial by Ethan Cerami, Ph.D.<br><br>keywords: samtools, next-gen, next-generation, sequencing, bowtie, sam, bam, primer, tutorial, how-to, introduction<br>Revisions<br><br>&nbsp;&nbsp;&nbsp; 1.0: May 30, 2013: First public release on biobits.org.<br>&nbsp;&nbsp;&nbsp; 1.1: July 24, 2013: Updated with Disqus Comments / Feedback section.<br>&nbsp;&nbsp;&nbsp; 1.2: December 19, 2014: Multiple updates, including:<br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Updated to use samtools 1.1 and bcftools 1.2.<br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Updated usage for bcftools.<br><br>About<br><br>SAMtools is a popular open-source tool used in next-generation sequence analysis. This primer provides an introduction to SAMtools, and is geared towards those new to next-generation sequence analysis. The primer is also designed to be self-contained and hands-on, meaning that you only need to install SAMtools, and no other tools, and sample data sets are provided. Terms in bold are also explained in the glossary at the end of the document.</p><p>Address of the bookmark: <a href="http://biobits.org/samtools_primer.html" rel="nofollow">http://biobits.org/samtools_primer.html</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34221/alignment-free-sequence-comparison-tools-available-for-next-generation-sequencing-data-analysis</guid>
	<pubDate>Tue, 07 Nov 2017 05:33:33 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34221/alignment-free-sequence-comparison-tools-available-for-next-generation-sequencing-data-analysis</link>
	<title><![CDATA[Alignment-free sequence comparison tools available for next-generation sequencing data analysis]]></title>
	<description><![CDATA[<div><p><span>kallisto</span></p></div><div><p>Transcript abundance quantification from RNA-seq data (uses pseudoalignment for rapid determination of read compatibility with targets)</p><p>Software (C++)</p><p><a href="https://pachterlab.github.io/kallisto/">https://pachterlab.github.io/kallisto/</a></p><p>Sailfish</p><p>Estimation of isoform abundances from reference sequences and RNA-seq data (<em>k</em>-mer based)</p><p>Software (C++)</p><p><a href="http://www.cs.cmu.edu/~ckingsf/software/sailfish/">http://www.cs.cmu.edu/~ckingsf/software/sailfish/</a></p><p>Salmon</p><p>Quantification of the expression of transcripts using RNA-seq data (uses&nbsp;<em>k</em>-mers)</p><p><a href="https://combine-lab.github.io/salmon/">https://combine-lab.github.io/salmon/</a></p><p>RNA-Skim</p><p>RNA-seq quantification at transcript-level (partitions the transcriptome into disjoint transcript clusters; uses&nbsp;<em>sig</em>-mers, a special type of&nbsp;<em>k</em>-mers)</p><p>Software (C++)</p><p><a href="http://www.csbio.unc.edu/rs/">http://www.csbio.unc.edu/rs/</a></p><p>Variant calling</p><p>ChimeRScope</p><p>Fusion transcript prediction using gene&nbsp;<em>k</em>-mers profiles of the RNA-seq paired-end reads</p><p>Software (Java)</p><p><a href="https://github.com/ChimeRScope/ChimeRScope/wiki">https://github.com/ChimeRScope/ChimeRScope/wiki</a></p><p>FastGT</p><p>Genotyping of known SNV/SNP variants directly from raw NGS sequence reads by counting unique&nbsp;<em>k</em>-mers</p><p>Software (C)</p><p><a href="https://github.com/bioinfo-ut/GenomeTester4/">https://github.com/bioinfo-ut/GenomeTester4/</a></p><p>Phy-Mer</p><p>Reference-independent mitochondrial haplogroup classifier from NGS data (<em>k</em>-mer based)</p><p>Software (Python)</p><p><a href="https://github.com/danielnavarrogomez/phy-mer">https://github.com/danielnavarrogomez/phy-mer</a></p><p>LAVA</p><p>Genotyping of known SNPs (dbSNP and Affymetrix's Genome-Wide Human SNP Array) from raw NGS reads (<em>k</em>-mer based)</p><p>Software (C)</p><p><a href="http://lava.csail.mit.edu/">http://lava.csail.mit.edu/</a></p><p>MICADo</p><p>Detection of mutations in targeted third-generation NGS data (can distinguish patients&rsquo; specific mutations; algorithm uses&nbsp;<em>k</em>-mers and is based on colored de Bruijn graphs)</p><p>Software (Python)</p><p><a href="http://github.com/cbib/MICADo">http://github.com/cbib/MICADo</a></p><p>General mapper</p><p>Minimap</p><p>Lightweight and fast read mapper and read overlap detector (uses the concept of &ldquo;minimazers&rdquo;, a special type of&nbsp;<em>k</em>-mers)</p><p>Software (C)</p><p><a href="https://github.com/lh3/minimap">https://github.com/lh3/minimap</a></p><p>Assembly</p><p>De novo genome assembly</p><p>MHAP</p><p>Produces highly continuous assembly (fully resolved chromosome arms) from third-generation long and noisy reads (10 kbp) using a dimensionality reduction technique MinHash</p><p>Software (Java)</p><p><a href="https://github.com/marbl/MHAP">https://github.com/marbl/MHAP</a></p><p>Miniasm</p><p>Assembler of long noisy reads (SMRT, ONT) using the Overlap-Layout Consensus (OLC) approach without the necessity of an error correction stage (uses minimap)</p><p>Software (C)</p><p><a href="https://github.com/lh3/miniasm">https://github.com/lh3/miniasm</a></p><p>LINKS</p><p>Scaffolding genome assembly with error-containing long sequence (e.g., ONT or PacBio reads, draft genomes)</p><p>Software (Perl)</p><p><a href="https://github.com/warrenlr/LINKS/">https://github.com/warrenlr/LINKS/</a></p><p>Read clustering</p><p>afcluster</p><p>Clustering of reads from different genes and different species based on&nbsp;<em>k</em>-mer counts</p><p>Software (C++)</p><p><a href="https://github.com/luscinius/afcluster">https://github.com/luscinius/afcluster</a></p><p>QCluster</p><p>Clustering of reads with alignment-free measures (<em>k</em>-mer based) and quality values</p><p>Software (C++)</p><p><a href="http://www.dei.unipd.it/~ciompin/main/qcluster.html">http://www.dei.unipd.it/~ciompin/main/qcluster.html</a></p><p>Reads error correction</p><p>Lighter</p><p>Correction of sequencing errors in raw, whole genome sequencing reads (<em>k</em>-mer based)</p><p>Software (C++)</p><p><a href="https://github.com/mourisl/Lighter">https://github.com/mourisl/Lighter</a></p><p>QuorUM</p><p>Error corrector for Illumina reads using k-mers</p><p>Software (C++)</p><p><a href="https://github.com/gmarcais/Quorum">https://github.com/gmarcais/Quorum</a></p><p>Trowel</p><p>Software (C++)</p><p><a href="https://sourceforge.net/projects/trowel-ec/">https://sourceforge.net/projects/trowel-ec/</a></p><p>Metagenomics</p><p>Assembly-free phylogenomics</p><p>AAF</p><p>Phylogeny reconstruction directly from unassembled raw sequence data from whole genome sequencing projects; provides bootstrap support to assess uncertainty in the tree topology (<em>k</em>-mer based)</p><p>Software (Python)</p><p><a href="https://github.com/fanhuan/AAF">https://github.com/fanhuan/AAF</a></p><p>kSNP v3</p><p>Reference-free SNP identification and estimation of phylogenetic trees using SNPs (based on&nbsp;<em>k</em>-mer analysis)</p><p>Software (C)</p><p><a href="https://sourceforge.net/projects/ksnp/files/">https://sourceforge.net/projects/ksnp/files/</a></p><p>NGS-MC</p><p>Phylogeny of species based on NGS reads using alignment-free sequence dissimilarity measures d2* and d2&nbsp;S&nbsp;under different Markov chain models (using&nbsp;<em>k</em>-words)</p><p>R package</p><p><a href="http://www-rcf.usc.edu/~fsun/Programs/NGS-MC/NGS-MC.html">http://www-rcf.usc.edu/~fsun/Programs/NGS-MC/NGS-MC.html</a></p><p>Species identification/taxonomic profiling</p><p>CLARK</p><p>Taxonomic classification of metagenomic reads to known bacterial genomes using&nbsp;<em>k</em>-mer search and LCA assignment</p><p>Software (C++)</p><p><a href="http://clark.cs.ucr.edu/">http://clark.cs.ucr.edu/</a></p><p>FOCUS</p><p>Reports organisms present in metagenomic samples and profiles their abundances (uses composition-based approach and non-negative least squares for prediction)</p><p>Web service Software (Python)</p><p><a href="http://edwards.sdsu.edu/FOCUS/">http://edwards.sdsu.edu/FOCUS/</a></p><p>GSM</p><p>Estimation of abundances of microbial genomes in metagenomic samples (<em>k</em>-mer based)</p><p>Software (Go)</p><p><a href="https://github.com/pdtrang/GSM">https://github.com/pdtrang/GSM</a></p><p>Mash</p><p>Species identification using assembled or unassembled Illumina, PacBio, and ONT data (based on MinHash dimensionality-reduction technique)</p><p>Software (C++)</p><p><a href="https://github.com/marbl/mash">https://github.com/marbl/mash</a></p><p>Kraken</p><p>Taxonomic assignment in metagenome analysis by exact&nbsp;<em>k</em>-mer search; LCA assignment of short reads based on a comprehensive sequence database</p><p>Software (C++)</p><p><a href="https://ccb.jhu.edu/software/kraken/">https://ccb.jhu.edu/software/kraken/</a></p><p>LMAT</p><p>Assignment of taxonomic labels to reads by&nbsp;<em>k</em>-mers searches in precomputed database</p><p>Software (C++/Python)</p><p><a href="https://sourceforge.net/projects/lmat/">https://sourceforge.net/projects/lmat/</a></p><p>stringMLST</p><p><em>k</em>-mer-based tool for MLST directly from the genome sequencing reads</p><p>Software (Python)</p><p><a href="http://jordan.biology.gatech.edu/page/software/stringMLST">http://jordan.biology.gatech.edu/page/software/stringMLST</a></p><p>Taxonomer</p><p><em>k</em>-mer-based ultrafast metagenomics tool for assigning taxonomy to sequencing reads from clinical and environmental samples</p><p>Web service</p><p><a href="http://taxonomer.iobio.io/">http://taxonomer.iobio.io/</a></p><p>Other</p><p>d2-tools</p><p>Word-based (<em>k</em>-tuple) comparison (pairwise dissimilarity matrix using d2S measure) of metatranscriptomic samples from NGS reads</p><p>Software (Python/R)</p><p><a href="https://code.google.com/p/d2-tools/">https://code.google.com/p/d2-tools/</a></p><p>VirHostMatcher</p><p>Prediction of hosts from metagenomic viral sequences based on ONF using various distance measures (e.g., d2)</p><p>Software (C++)</p><p><a href="https://github.com/jessieren/VirHostMatcher">https://github.com/jessieren/VirHostMatcher</a></p><p>MetaFast</p><p>Statistics calculation of metagenome sequences and the distances between them based on assembly using de Bruijn graphs and Bray&ndash;Curtis dissimilarity measure</p><p>Software (Java)</p><p><a href="https://github.com/ctlab/metafast">https://github.com/ctlab/metafast</a></p></div>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/28119/kraken-ultrafast-metagenomic-sequence-classification-using-exact-alignments</guid>
	<pubDate>Mon, 27 Jun 2016 11:01:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/28119/kraken-ultrafast-metagenomic-sequence-classification-using-exact-alignments</link>
	<title><![CDATA[Kraken: ultrafast metagenomic sequence classification using exact alignments]]></title>
	<description><![CDATA[<p>Kraken is an ultrafast and highly accurate program for assigning taxonomic labels to metagenomic DNA sequences. Previous programs designed for this task have been relatively slow and computationally expensive, forcing researchers to use faster abundance estimation programs, which only classify small subsets of metagenomic data. Using exact alignment of <em>k</em>-mers, Kraken achieves classification accuracy comparable to the fastest BLAST program. In its fastest mode, Kraken classifies 100 base pair reads at a rate of over 4.1 million reads per minute, 909 times faster than Megablast and 11 times faster than the abundance estimation program MetaPhlAn. Kraken is available at <a href="http://ccb.jhu.edu/software/kraken/" target="pmc_ext">http://ccb.jhu.edu/software/kraken/</a>.</p>
<p>Krona</p>
<p>https://sourceforge.net/p/krona/home/krona/</p><p>Address of the bookmark: <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4053813/" rel="nofollow">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4053813/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/28286/nipgr-hires-research-associate-jrf-laboratory-assistant</guid>
  <pubDate>Mon, 04 Jul 2016 20:12:14 -0500</pubDate>
  <link></link>
  <title><![CDATA[NIPGR Hires Research Associate, JRF, Laboratory Assistant]]></title>
  <description><![CDATA[
<p>National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg - Delhi, Delhi <br />₹15,000 a month<br />National Institute of Plant Genome Research (NIPGR) invites applications to recruit on vacant posts of Research Associate (RA), Junior Research Fellow (JRF) and Laboratory Assistant. Applications against these Sarkari Naukri can be submitted on or before 16 July 2016. <br />NIPGR Vacancy 2016 Details <br />1. Research Associate (RA) <br />Qualification: Ph.D. degree (awarded) in Molecular Biology/Biotechnolgy/Biochemistry/Plant Science/ Life Sciences/Bioinformatics or related field with 03 years post-doctoral research experience or 02 research papers in the journals of International repute are eligible to apply. Experience in the area of functional genomics, proteomics, metabolomics, multiomics and system biology will be preferred. <br />Age Limit: As Per Rules <br />2. Junior Research Fellow (JRF) <br />Qualification: M.Sc. degree or equivalent in Biotechnolgy/Biochemistry/Plant Science or Botany/ Life Sciences/Bioinformatics/ Molecular Biology or any other related field. Experience in advanced multiomics, big data analysis, molecular and system biology techniques will be given preference. <br />Age Limit: As Per Rules <br />3. Laboratory Assistant <br />Qualification: B.Sc. degree with 05 years working experience in government R&amp;D Laboratory assisting in the field of molecular biology and genomis. <br />Pay Scale: Rs.15000/- Per Month <br />Age Limit: As Per Rules <br />How to Apply : Duly filled-in applications in prescribed application format along with copies of required documents should be reach to: Dr. Subhra Chakraborty, Staff Scientist-VII, National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg, P.O. Box NO. 10531, New Delhi – 110067 . The Last Date to submit application is 16 July 2016</p>

<p>Source: http://www.nipgr.res.in/careers/vacancies_latest.php#<br />Form at http://www.nipgr.res.in/files/careers/format_RA_JRF_LA.doc</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/28546/ra-bioinformatics-at-national-bureau-of-fish-genetic-resources</guid>
  <pubDate>Mon, 25 Jul 2016 03:14:06 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA Bioinformatics at  National Bureau of Fish Genetic Resources]]></title>
  <description><![CDATA[
<p>F.No. 1(16)/2016-Admn. (DBT-BBSRC Project)<br />Research Associate /JRF Biotechnology Job vacancies in National Bureau of Fish Genetic Resources on contract basis</p>

<p>Research Associate /01 Post</p>

<p>Essential: Ph.D. in Bioinformatics or 03 years research experience after Post Graduation in Bioinformatics with at least one research paper in Science Citation Indexed (SCI) journals.</p>

<p>Desirable:  The candidate should have at least 1st Division during Graduation and Post Graduation.  Experience in assembly/ analysis/ annotation of genomic/transcriptomic data generated on next generation sequencing platforms and working knowledge on different genomic softwares.  Publications in Relevant Field.</p>

<p>Pay Scale : Rs. 36,000/- +20% HRA </p>

<p>Age: 40 years for male and 45 years for female candidates, as on the date of interview</p>

<p>Junior Research Fellow/ 01 </p>

<p>Essential: Master Degree in Biotechnology/Life Science with Specialization in Molecular Biology with NET qualification. </p>

<p>Desirable:  Research Experience in Molecular Biology. 1st Division during Graduation as well as Post Graduation. Publications in Relevant Field.</p>

<p>Pay Scale: Rs. 25,000/-+ 20% HRA for 1st and 2nd year and Rs. 28,000/-+ 20% HRA for 3rd year</p>

<p>Age: 35 years for male and 40 years for female candidates, as on the date of interview.<br />How to apply<br />A walk-in-interview will be held on 26.07.2016 at 10:00 hrs. at ICAR-National Bureau of Fish Genetic Resources, Lucknow.</p>

<p>More at http://www.nbfgr.res.in/Recruitments.aspx</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35920/mesquite-a-modular-system-for-evolutionary-analysis</guid>
	<pubDate>Tue, 13 Mar 2018 06:54:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35920/mesquite-a-modular-system-for-evolutionary-analysis</link>
	<title><![CDATA[Mesquite: A modular system for evolutionary analysis]]></title>
	<description><![CDATA[<p><span>Mesquite is modular, extendible software for evolutionary biology, designed to help biologists organize and analyze comparative data about organisms. Its emphasis is on phylogenetic analysis, but some of its modules concern population genetics, while others do non-phylogenetic multivariate analysis. Because it is modular, the analyses available depend on the modules installed.</span></p>
<p><span>https://github.com/MesquiteProject/MesquiteCore</span></p><p>Address of the bookmark: <a href="http://mesquiteproject.org/" rel="nofollow">http://mesquiteproject.org/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

</channel>
</rss>