<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/33398?offset=110</link>
	<atom:link href="https://bioinformaticsonline.com/related/33398?offset=110" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43323/biostarhandbook</guid>
	<pubDate>Fri, 27 Aug 2021 01:31:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43323/biostarhandbook</link>
	<title><![CDATA[biostarhandbook]]></title>
	<description><![CDATA[<p>Nice book collection for bioinformatician ... highly recommended.</p><p>Address of the bookmark: <a href="https://www.biostarhandbook.com/" rel="nofollow">https://www.biostarhandbook.com/</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/871/postdoctoral-position-in-bioinformatics-sweden</guid>
  <pubDate>Sun, 14 Jul 2013 13:49:57 -0500</pubDate>
  <link></link>
  <title><![CDATA[Postdoctoral position in bioinformatics @ Sweden]]></title>
  <description><![CDATA[
<p>Information about the department<br />The Department of Mathematical Sciences at Chalmers University of Technology and the University of Gothenburg has about 170 faculty and staff and is the largest department of mathematical sciences in the Nordic countries. The department belongs to both Chalmers University of Technology and the University of Gothenburg (for more information see http://www.chalmers.se/math/).</p>

<p>Job description<br />We are looking for a motivated, self-driven post-doctoral researcher to work with large-scale sequence data analysis. The position is for 24 months and located at Mathematical Statistics, Department of Mathematical Sciences in Erik Kristiansson’s research group. We are focused on methods development for and analysis of next generation DNA sequencing, in particular comparative metagenomics and gene expression analysis (RNA-seq). We have strong interdisciplinary profile and are actively collaborating with several experimental groups, especially within the environmental sciences, ecology, infectious diseases and cancer genomics. More information is available at http://bioinformatics.math.chalmers.se.</p>

<p>The Post-doctoral position is an appointment that offers an opportunity to qualify for further research positions within academia or industry. The majority of your working time is devoted to your own research, normally as a member of a research group. Included in your work is also to take part in supervision of Ph.D. students and M.Sc thesis students. Teaching of undergraduate students may also be included to a small extent.</p>

<p>The employment is limited to a maximum of 2 years (1+1).</p>

<p>Qualifications<br />The applicant should have Ph.D. degree preferably in bioinformatics, mathematics, statistics, computer science or equivalent by the start of the appointment. Experience from analysis of large-scale data, in particular from next generation DNA sequencing, is highly valued. The applicant should also be proficient in programming (e.g. Python/Java/C) and comfortable with Unix/Linux systems. Interaction with experimental biologists is central and good collaborative skills are therefore important. Fluency in written and spoken English is a strong requirement. As a post-doctoral researcher you are expected to work independently and to be able to supervise/co-supervise PhD and Master’s students.</p>

<p>Application procedure<br />The application should be marked with Ref 20130126 and written in English. The application should be sent electronically via Chalmers webpage.</p>

<p>Application deadline: September 8, 2013.</p>

<p>For questions, please contact: <br />Ass prof. Erik Kristiansson, Matematiska Vetenskaper, erik.kristiansson@chalmers.se, +46 31-772 3521, +46 70-5259751.</p>

<p>Chalmers continuously strive to be an attractive employer. Equality and diversity are substantial foundations in all activities at Chalmers.</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/14186/pybedtools</guid>
	<pubDate>Wed, 20 Aug 2014 01:03:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/14186/pybedtools</link>
	<title><![CDATA[pybedtools]]></title>
	<description><![CDATA[<p>pybedtools is a Python wrapper for Aaron Quinlan's BEDtools programs (https://github.com/arq5x/bedtools), which are widely used for genomic interval manipulation or "genome algebra". pybedtools extends BEDTools by offering feature-level manipulations from with Python. See full online documentation, including installation instructions, at http://pythonhosted.org/pybedtools/.</p><p>More at http://pythonhosted.org/pybedtools/</p><p>A powerful toolset for genome arithmetic.http://code.google.com/p/bedtools/</p>]]></description>
	<dc:creator>Shruti Paniwala</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/22961/bioscripts</guid>
	<pubDate>Sun, 28 Jun 2015 07:46:14 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/22961/bioscripts</link>
	<title><![CDATA[BioScripts]]></title>
	<description><![CDATA[<p>You are requested to please bookmark collection of bioinformatics tools, scripts, codes that can be pieced together in a very easy and flexible manner to perform both simple and complex bioinformatics tasks.</p>
<p>The next-generation sequencing included whole genome sequencing(WGS), transcriptome sequencing (whole cDNA sequencing, RNA-seq), digital gene expression sequencing (Tag-Seq), ChIP-Seq, and so on. And there are many sequencing platform to generate sequece, as well know Sanger/ABi(the frist generation), Solexa/illumina, SOLiD/ABi, 454/Roche. But thier sequence format is different, also they have different error type. High quality data is very important for further analysis or data mining. There are many pipeline for raw sequence quality analysis and control with few of process for reporting reads quality statistical details, trimming, filtering, and error correction. Please bookmarks them for the benefits of bioinformatics community.</p>
<p>https://code.google.com/p/biowiki/</p>
<p>https://code.google.com/p/ngs-pipeline/source/browse/#svn%2Ftrunk</p>
<p>NGSand Perl scripts https://code.google.com/hosting/search?q=NGS+perl&amp;projectsearch=Search+projects</p>
<p>NGS and Python scripts https://code.google.com/hosting/search?q=NGS+Python&amp;projectsearch=Search+projects</p><p>Address of the bookmark: <a href="https://code.google.com/hosting/search?q=bioinformatics&amp;sa=Search" rel="nofollow">https://code.google.com/hosting/search?q=bioinformatics&amp;sa=Search</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36497/installing-python-numpy</guid>
	<pubDate>Mon, 07 May 2018 04:31:25 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36497/installing-python-numpy</link>
	<title><![CDATA[Installing  python-numpy !]]></title>
	<description><![CDATA[<p>$ sudo apt-get install python-numpy python-scipy python-matplotlib ipython ipython-notebook python-pandas python-sympy python-nose<br />[sudo] password for urbe: <br />Reading package lists... Done<br />Building dependency tree <br />Reading state information... Done<br />The following packages were automatically installed and are no longer required:<br /> bridge-utils containerd linux-headers-4.4.0-116 linux-headers-4.4.0-116-generic linux-headers-4.4.0-21 linux-headers-4.4.0-21-generic<br /> linux-image-4.4.0-116-generic linux-image-4.4.0-21-generic linux-image-extra-4.4.0-116-generic linux-image-extra-4.4.0-21-generic<br /> linux-signed-image-4.4.0-116-generic runc ubuntu-fan<br />Use 'sudo apt autoremove' to remove them.<br />The following additional packages will be installed:<br /> blt fonts-lyx fonts-mathjax ipython-notebook-common isympy libaec0 libamd2.4.1 libdsdp-5.8gf libglpk36 libgsl2 libhdf5-10 libjs-highlight<br /> libjs-highlight.js libjs-jquery-ui libjs-marked libjs-mathjax libjs-underscore libsz2 python-antlr python-bs4 python-chardet python-cvxopt<br /> python-cycler python-dateutil python-decorator python-glade2 python-gmpy python-html5lib python-imaging python-jdcal python-jinja2 python-joblib<br /> python-lxml python-markupsafe python-matplotlib-data python-mpmath python-numexpr python-openpyxl python-pandas-lib python-patsy python-pexpect<br /> python-pil python-ptyprocess python-py python-pycurl python-pyglet python-pymysql python-pyparsing python-pytest python-simplegeneric<br /> python-simplejson python-statsmodels python-statsmodels-lib python-sympy-doc python-tables python-tables-data python-tables-lib python-tk<br /> python-tornado python-tz python-xlrd python-xlwt python-zmq tk8.6-blt2.5 ttf-bitstream-vera<br />Suggested packages:<br /> blt-demo ipython-doc ipython-qtconsole python-pygments nodejs pandoc libiodbc2-dev libmysqlclient-dev gsl-ref-psdoc | gsl-doc-pdf | gsl-doc-info<br /> | gsl-ref-html libjs-jquery-ui-docs fonts-mathjax-extras libjs-mathjax-doc python-gtk2-doc python-genshi python-jinja2-doc python-lxml-dbg<br /> python-lxml-doc ffmpeg inkscape python-cairocffi python-configobj python-excelerator python-matplotlib-doc python-qt4 python-sip python-traits<br /> python-wxgtk3.0 ttf-staypuft python-gmpy2 python-mpmath-doc python-coverage python-nose-doc python-numpy-dbg python-numpy-doc python-pandas-doc<br /> python-patsy-doc python-pexpect-doc python-pil-doc python-pil-dbg subversion python-pytest-xdist libcurl4-gnutls-dev python-pycurl-dbg<br /> python-pycurl-doc python-pymysql-doc python-mock python-scipy-doc python-statsmodels-doc python-tables-doc python-netcdf vitables tix<br /> python-tk-dbg<br />The following NEW packages will be installed:<br /> blt fonts-lyx fonts-mathjax ipython ipython-notebook ipython-notebook-common isympy libaec0 libamd2.4.1 libdsdp-5.8gf libglpk36 libgsl2<br /> libhdf5-10 libjs-highlight libjs-highlight.js libjs-jquery-ui libjs-marked libjs-mathjax libjs-underscore libsz2 python-antlr python-bs4<br /> python-chardet python-cvxopt python-cycler python-dateutil python-decorator python-glade2 python-gmpy python-html5lib python-imaging<br /> python-jdcal python-jinja2 python-joblib python-lxml python-markupsafe python-matplotlib python-matplotlib-data python-mpmath python-nose<br /> python-numexpr python-numpy python-openpyxl python-pandas python-pandas-lib python-patsy python-pexpect python-pil python-ptyprocess python-py<br /> python-pycurl python-pyglet python-pymysql python-pyparsing python-pytest python-scipy python-simplegeneric python-simplejson python-statsmodels<br /> python-statsmodels-lib python-sympy python-sympy-doc python-tables python-tables-data python-tables-lib python-tk python-tornado python-tz<br /> python-xlrd python-xlwt python-zmq tk8.6-blt2.5 ttf-bitstream-vera<br />0 upgraded, 73 newly installed, 0 to remove and 35 not upgraded.<br />Need to get 49,5 MB of archives.<br />After this operation, 271 MB of additional disk space will be used.<br />Do you want to continue? [Y/n] Y<br />Get:1 http://be.archive.ubuntu.com/ubuntu xenial-updates/main amd64 python-pymysql all 0.7.2-1ubuntu1 [56,4 kB]<br />Get:2 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 tk8.6-blt2.5 amd64 2.5.3+dfsg-3 [574 kB]<br />Get:3 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 blt amd64 2.5.3+dfsg-3 [4.852 B]<br />Get:4 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 fonts-lyx all 2.1.4-2 [161 kB]<br />Get:5 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 fonts-mathjax all 2.6.1-1 [960 kB]<br />Get:6 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-decorator all 4.0.6-1 [9.326 B]<br />Get:7 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-ptyprocess all 0.5-1 [12,9 kB]<br />Get:8 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-pexpect all 4.0.1-1 [40,5 kB]<br />Get:9 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-simplegeneric all 0.8.1-1 [11,5 kB]<br />Get:10 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 ipython all 2.4.1-1 [610 kB]<br />Get:11 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 libjs-highlight.js all 8.2+ds-4build1 [151 kB]<br />Get:12 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 libjs-highlight all 8.2+ds-4build1 [7.032 B]<br />Get:13 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 libjs-jquery-ui all 1.10.1+dfsg-1 [458 kB]<br />Get:14 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 libjs-marked all 0.3.2+dfsg-1 [12,7 kB]<br />Get:15 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 libjs-mathjax all 2.6.1-1 [5.601 kB]<br />Get:16 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 libjs-underscore all 1.7.0~dfsg-1ubuntu1 [46,7 kB]<br />Get:17 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 ipython-notebook-common all 2.4.1-1 [712 kB]<br />Get:18 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-markupsafe amd64 0.23-2build2 [15,5 kB]<br />Get:19 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-jinja2 all 2.8-1 [109 kB]<br />Get:20 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-pycurl amd64 7.43.0-1ubuntu1 [43,3 kB]<br />Get:21 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-tornado amd64 4.2.1-1ubuntu3 [273 kB]<br />Get:22 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-zmq amd64 15.2.0-0ubuntu4 [200 kB]<br />Get:23 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 ipython-notebook all 2.4.1-1 [48,4 kB]<br />Get:24 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 isympy all 0.7.6.1-1 [82,5 kB]<br />Get:25 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 libaec0 amd64 0.3.2-1 [18,0 kB]<br />Get:26 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 libamd2.4.1 amd64 1:4.4.6-1 [21,3 kB]<br />Get:27 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 libglpk36 amd64 4.57-1build3 [386 kB]<br />Get:28 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 libgsl2 amd64 2.1+dfsg-2 [840 kB]<br />Get:29 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 libsz2 amd64 0.3.2-1 [5.048 B]<br />Get:30 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 libhdf5-10 amd64 1.8.16+docs-4ubuntu1 [995 kB]<br />Get:31 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-antlr all 2.7.7+dfsg-6ubuntu1 [19,0 kB]<br />Get:32 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-bs4 all 4.4.1-1 [64,2 kB]<br />Get:33 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-chardet all 2.3.0-2 [96,3 kB]<br />Get:34 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 libdsdp-5.8gf amd64 5.8-9.1ubuntu2 [192 kB]<br />Get:35 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-cvxopt amd64 1.1.4-1.4 [1.344 kB]<br />Get:36 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-cycler all 0.9.0-1 [5.426 B]<br />Get:37 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-dateutil all 2.4.2-1 [42,5 kB]<br />Get:38 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-glade2 amd64 2.24.0-4ubuntu1 [9.078 B]<br />Get:39 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-gmpy amd64 1.17-1 [91,1 kB]<br />Get:40 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-html5lib all 0.999-4 [83,1 kB]<br />Get:41 http://be.archive.ubuntu.com/ubuntu xenial-updates/main amd64 python-pil amd64 3.1.2-0ubuntu1.1 [312 kB]<br />Get:42 http://be.archive.ubuntu.com/ubuntu xenial-updates/universe amd64 python-imaging all 3.1.2-0ubuntu1.1 [4.596 B]<br />Get:43 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-jdcal all 1.0-1build1 [7.702 B]<br />Get:44 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-joblib all 0.9.4-1 [74,6 kB]<br />Get:45 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-lxml amd64 3.5.0-1build1 [819 kB]<br />Get:46 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 ttf-bitstream-vera all 1.10-8 [352 kB]<br />Get:47 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-matplotlib-data all 1.5.1-1ubuntu1 [2.414 kB]<br />Get:48 http://be.archive.ubuntu.com/ubuntu xenial-updates/main amd64 python-pyparsing all 2.0.3+dfsg1-1ubuntu0.1 [35,4 kB]<br />Get:49 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-tz all 2014.10~dfsg1-0ubuntu2 [31,5 kB]<br />Get:50 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-numpy amd64 1:1.11.0-1ubuntu1 [1.763 kB]<br />Get:51 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-matplotlib amd64 1.5.1-1ubuntu1 [3.888 kB]<br />Get:52 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-mpmath all 0.19-3 [387 kB]<br />Get:53 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-nose all 1.3.7-1 [116 kB]<br />Get:54 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-numexpr amd64 2.4.3-1ubuntu1 [129 kB]<br />Get:55 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-openpyxl all 2.3.0-1 [193 kB]<br />Get:56 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-pandas-lib amd64 0.17.1-3ubuntu2 [1.538 kB]<br />Get:57 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-pandas all 0.17.1-3ubuntu2 [2.386 kB]<br />Get:58 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-patsy all 0.4.1-2 [169 kB]<br />Get:59 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-py all 1.4.31-1 [62,5 kB]<br />Get:60 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-pyglet all 1.1.4.dfsg-3 [726 kB]<br />Get:61 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-pytest all 2.8.7-4 [119 kB]<br />Get:62 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-simplejson amd64 3.8.1-1ubuntu2 [60,4 kB]<br />Get:63 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-sympy all 0.7.6.1-1 [2.252 kB]<br />Get:64 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-sympy-doc all 0.7.6.1-1 [4.774 kB]<br />Get:65 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-tables-lib amd64 3.2.2-2 [353 kB]<br />Get:66 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-tables-data all 3.2.2-2 [45,3 kB]<br />Get:67 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-tables all 3.2.2-2 [335 kB]<br />Get:68 http://be.archive.ubuntu.com/ubuntu xenial-updates/main amd64 python-tk amd64 2.7.12-1~16.04 [26,3 kB]<br />Get:69 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-xlrd all 0.9.4-1 [107 kB]<br />Get:70 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-xlwt all 0.7.5+debian1-1 [83,5 kB]<br />Get:71 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-scipy amd64 0.17.0-1 [8.733 kB]<br />Get:72 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-statsmodels-lib amd64 0.6.1-4 [173 kB]<br />Get:73 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-statsmodels all 0.6.1-4 [2.581 kB]<br />Fetched 49,5 MB in 0s (52,8 MB/s) <br />Extracting templates from packages: 100%<br />Selecting previously unselected package python-pymysql.<br />(Reading database ... 435155 files and directories currently installed.)<br />Preparing to unpack .../python-pymysql_0.7.2-1ubuntu1_all.deb ...<br />Unpacking python-pymysql (0.7.2-1ubuntu1) ...<br />Selecting previously unselected package tk8.6-blt2.5.<br />Preparing to unpack .../tk8.6-blt2.5_2.5.3+dfsg-3_amd64.deb ...<br />Unpacking tk8.6-blt2.5 (2.5.3+dfsg-3) ...<br />Selecting previously unselected package blt.<br />Preparing to unpack .../blt_2.5.3+dfsg-3_amd64.deb ...<br />Unpacking blt (2.5.3+dfsg-3) ...<br />Selecting previously unselected package fonts-lyx.<br />Preparing to unpack .../fonts-lyx_2.1.4-2_all.deb ...<br />Unpacking fonts-lyx (2.1.4-2) ...<br />Selecting previously unselected package fonts-mathjax.<br />Preparing to unpack .../fonts-mathjax_2.6.1-1_all.deb ...<br />Unpacking fonts-mathjax (2.6.1-1) ...<br />Selecting previously unselected package python-decorator.<br />Preparing to unpack .../python-decorator_4.0.6-1_all.deb ...<br />Unpacking python-decorator (4.0.6-1) ...<br />Selecting previously unselected package python-ptyprocess.<br />Preparing to unpack .../python-ptyprocess_0.5-1_all.deb ...<br />Unpacking python-ptyprocess (0.5-1) ...<br />Selecting previously unselected package python-pexpect.<br />Preparing to unpack .../python-pexpect_4.0.1-1_all.deb ...<br />Unpacking python-pexpect (4.0.1-1) ...<br />Selecting previously unselected package python-simplegeneric.<br />Preparing to unpack .../python-simplegeneric_0.8.1-1_all.deb ...<br />Unpacking python-simplegeneric (0.8.1-1) ...<br />Selecting previously unselected package ipython.<br />Preparing to unpack .../ipython_2.4.1-1_all.deb ...<br />Unpacking ipython (2.4.1-1) ...<br />Selecting previously unselected package libjs-highlight.js.<br />Preparing to unpack .../libjs-highlight.js_8.2+ds-4build1_all.deb ...<br />Unpacking libjs-highlight.js (8.2+ds-4build1) ...<br />Selecting previously unselected package libjs-highlight.<br />Preparing to unpack .../libjs-highlight_8.2+ds-4build1_all.deb ...<br />Unpacking libjs-highlight (8.2+ds-4build1) ...<br />Selecting previously unselected package libjs-jquery-ui.<br />Preparing to unpack .../libjs-jquery-ui_1.10.1+dfsg-1_all.deb ...<br />Unpacking libjs-jquery-ui (1.10.1+dfsg-1) ...<br />Selecting previously unselected package libjs-marked.<br />Preparing to unpack .../libjs-marked_0.3.2+dfsg-1_all.deb ...<br />Unpacking libjs-marked (0.3.2+dfsg-1) ...<br />Selecting previously unselected package libjs-mathjax.<br />Preparing to unpack .../libjs-mathjax_2.6.1-1_all.deb ...<br />Unpacking libjs-mathjax (2.6.1-1) ...<br />Selecting previously unselected package libjs-underscore.<br />Preparing to unpack .../libjs-underscore_1.7.0~dfsg-1ubuntu1_all.deb ...<br />Unpacking libjs-underscore (1.7.0~dfsg-1ubuntu1) ...<br />Selecting previously unselected package ipython-notebook-common.<br />Preparing to unpack .../ipython-notebook-common_2.4.1-1_all.deb ...<br />Unpacking ipython-notebook-common (2.4.1-1) ...<br />Selecting previously unselected package python-markupsafe.<br />Preparing to unpack .../python-markupsafe_0.23-2build2_amd64.deb ...<br />Unpacking python-markupsafe (0.23-2build2) ...<br />Selecting previously unselected package python-jinja2.<br />Preparing to unpack .../python-jinja2_2.8-1_all.deb ...<br />Unpacking python-jinja2 (2.8-1) ...<br />Selecting previously unselected package python-pycurl.<br />Preparing to unpack .../python-pycurl_7.43.0-1ubuntu1_amd64.deb ...<br />Unpacking python-pycurl (7.43.0-1ubuntu1) ...<br />Selecting previously unselected package python-tornado.<br />Preparing to unpack .../python-tornado_4.2.1-1ubuntu3_amd64.deb ...<br />Unpacking python-tornado (4.2.1-1ubuntu3) ...<br />Selecting previously unselected package python-zmq.<br />Preparing to unpack .../python-zmq_15.2.0-0ubuntu4_amd64.deb ...<br />Unpacking python-zmq (15.2.0-0ubuntu4) ...<br />Selecting previously unselected package ipython-notebook.<br />Preparing to unpack .../ipython-notebook_2.4.1-1_all.deb ...<br />Unpacking ipython-notebook (2.4.1-1) ...<br />Selecting previously unselected package isympy.<br />Preparing to unpack .../isympy_0.7.6.1-1_all.deb ...<br />Unpacking isympy (0.7.6.1-1) ...<br />Selecting previously unselected package libaec0:amd64.<br />Preparing to unpack .../libaec0_0.3.2-1_amd64.deb ...<br />Unpacking libaec0:amd64 (0.3.2-1) ...<br />Selecting previously unselected package libamd2.4.1:amd64.<br />Preparing to unpack .../libamd2.4.1_1%3a4.4.6-1_amd64.deb ...<br />Unpacking libamd2.4.1:amd64 (1:4.4.6-1) ...<br />Selecting previously unselected package libglpk36:amd64.<br />Preparing to unpack .../libglpk36_4.57-1build3_amd64.deb ...<br />Unpacking libglpk36:amd64 (4.57-1build3) ...<br />Selecting previously unselected package libgsl2:amd64.<br />Preparing to unpack .../libgsl2_2.1+dfsg-2_amd64.deb ...<br />Unpacking libgsl2:amd64 (2.1+dfsg-2) ...<br />Selecting previously unselected package libsz2:amd64.<br />Preparing to unpack .../libsz2_0.3.2-1_amd64.deb ...<br />Unpacking libsz2:amd64 (0.3.2-1) ...<br />Selecting previously unselected package libhdf5-10:amd64.<br />Preparing to unpack .../libhdf5-10_1.8.16+docs-4ubuntu1_amd64.deb ...<br />Unpacking libhdf5-10:amd64 (1.8.16+docs-4ubuntu1) ...<br />Selecting previously unselected package python-antlr.<br />Preparing to unpack .../python-antlr_2.7.7+dfsg-6ubuntu1_all.deb ...<br />Unpacking python-antlr (2.7.7+dfsg-6ubuntu1) ...<br />Selecting previously unselected package python-bs4.<br />Preparing to unpack .../python-bs4_4.4.1-1_all.deb ...<br />Unpacking python-bs4 (4.4.1-1) ...<br />Selecting previously unselected package python-chardet.<br />Preparing to unpack .../python-chardet_2.3.0-2_all.deb ...<br />Unpacking python-chardet (2.3.0-2) ...<br />Selecting previously unselected package libdsdp-5.8gf.<br />Preparing to unpack .../libdsdp-5.8gf_5.8-9.1ubuntu2_amd64.deb ...<br />Unpacking libdsdp-5.8gf (5.8-9.1ubuntu2) ...<br />Selecting previously unselected package python-cvxopt.<br />Preparing to unpack .../python-cvxopt_1.1.4-1.4_amd64.deb ...<br />Unpacking python-cvxopt (1.1.4-1.4) ...<br />Selecting previously unselected package python-cycler.<br />Preparing to unpack .../python-cycler_0.9.0-1_all.deb ...<br />Unpacking python-cycler (0.9.0-1) ...<br />Selecting previously unselected package python-dateutil.<br />Preparing to unpack .../python-dateutil_2.4.2-1_all.deb ...<br />Unpacking python-dateutil (2.4.2-1) ...<br />Selecting previously unselected package python-glade2.<br />Preparing to unpack .../python-glade2_2.24.0-4ubuntu1_amd64.deb ...<br />Unpacking python-glade2 (2.24.0-4ubuntu1) ...<br />Selecting previously unselected package python-gmpy.<br />Preparing to unpack .../python-gmpy_1.17-1_amd64.deb ...<br />Unpacking python-gmpy (1.17-1) ...<br />Selecting previously unselected package python-html5lib.<br />Preparing to unpack .../python-html5lib_0.999-4_all.deb ...<br />Unpacking python-html5lib (0.999-4) ...<br />Selecting previously unselected package python-pil:amd64.<br />Preparing to unpack .../python-pil_3.1.2-0ubuntu1.1_amd64.deb ...<br />Unpacking python-pil:amd64 (3.1.2-0ubuntu1.1) ...<br />Selecting previously unselected package python-imaging.<br />Preparing to unpack .../python-imaging_3.1.2-0ubuntu1.1_all.deb ...<br />Unpacking python-imaging (3.1.2-0ubuntu1.1) ...<br />Selecting previously unselected package python-jdcal.<br />Preparing to unpack .../python-jdcal_1.0-1build1_all.deb ...<br />Unpacking python-jdcal (1.0-1build1) ...<br />Selecting previously unselected package python-joblib.<br />Preparing to unpack .../python-joblib_0.9.4-1_all.deb ...<br />Unpacking python-joblib (0.9.4-1) ...<br />Selecting previously unselected package python-lxml.<br />Preparing to unpack .../python-lxml_3.5.0-1build1_amd64.deb ...<br />Unpacking python-lxml (3.5.0-1build1) ...<br />Selecting previously unselected package ttf-bitstream-vera.<br />Preparing to unpack .../ttf-bitstream-vera_1.10-8_all.deb ...<br />Unpacking ttf-bitstream-vera (1.10-8) ...<br />Selecting previously unselected package python-matplotlib-data.<br />Preparing to unpack .../python-matplotlib-data_1.5.1-1ubuntu1_all.deb ...<br />Unpacking python-matplotlib-data (1.5.1-1ubuntu1) ...<br />Selecting previously unselected package python-pyparsing.<br />Preparing to unpack .../python-pyparsing_2.0.3+dfsg1-1ubuntu0.1_all.deb ...<br />Unpacking python-pyparsing (2.0.3+dfsg1-1ubuntu0.1) ...<br />Selecting previously unselected package python-tz.<br />Preparing to unpack .../python-tz_2014.10~dfsg1-0ubuntu2_all.deb ...<br />Unpacking python-tz (2014.10~dfsg1-0ubuntu2) ...<br />Selecting previously unselected package python-numpy.<br />Preparing to unpack .../python-numpy_1%3a1.11.0-1ubuntu1_amd64.deb ...<br />Unpacking python-numpy (1:1.11.0-1ubuntu1) ...<br />Selecting previously unselected package python-matplotlib.<br />Preparing to unpack .../python-matplotlib_1.5.1-1ubuntu1_amd64.deb ...<br />Unpacking python-matplotlib (1.5.1-1ubuntu1) ...<br />Selecting previously unselected package python-mpmath.<br />Preparing to unpack .../python-mpmath_0.19-3_all.deb ...<br />Unpacking python-mpmath (0.19-3) ...<br />Selecting previously unselected package python-nose.<br />Preparing to unpack .../python-nose_1.3.7-1_all.deb ...<br />Unpacking python-nose (1.3.7-1) ...<br />Selecting previously unselected package python-numexpr.<br />Preparing to unpack .../python-numexpr_2.4.3-1ubuntu1_amd64.deb ...<br />Unpacking python-numexpr (2.4.3-1ubuntu1) ...<br />Selecting previously unselected package python-openpyxl.<br />Preparing to unpack .../python-openpyxl_2.3.0-1_all.deb ...<br />Unpacking python-openpyxl (2.3.0-1) ...<br />Selecting previously unselected package python-pandas-lib.<br />Preparing to unpack .../python-pandas-lib_0.17.1-3ubuntu2_amd64.deb ...<br />Unpacking python-pandas-lib (0.17.1-3ubuntu2) ...<br />Selecting previously unselected package python-pandas.<br />Preparing to unpack .../python-pandas_0.17.1-3ubuntu2_all.deb ...<br />Unpacking python-pandas (0.17.1-3ubuntu2) ...<br />Selecting previously unselected package python-patsy.<br />Preparing to unpack .../python-patsy_0.4.1-2_all.deb ...<br />Unpacking python-patsy (0.4.1-2) ...<br />Selecting previously unselected package python-py.<br />Preparing to unpack .../python-py_1.4.31-1_all.deb ...<br />Unpacking python-py (1.4.31-1) ...<br />Selecting previously unselected package python-pyglet.<br />Preparing to unpack .../python-pyglet_1.1.4.dfsg-3_all.deb ...<br />Unpacking python-pyglet (1.1.4.dfsg-3) ...<br />Selecting previously unselected package python-pytest.<br />Preparing to unpack .../python-pytest_2.8.7-4_all.deb ...<br />Unpacking python-pytest (2.8.7-4) ...<br />Selecting previously unselected package python-simplejson.<br />Preparing to unpack .../python-simplejson_3.8.1-1ubuntu2_amd64.deb ...<br />Unpacking python-simplejson (3.8.1-1ubuntu2) ...<br />Selecting previously unselected package python-sympy.<br />Preparing to unpack .../python-sympy_0.7.6.1-1_all.deb ...<br />Unpacking python-sympy (0.7.6.1-1) ...<br />Selecting previously unselected package python-sympy-doc.<br />Preparing to unpack .../python-sympy-doc_0.7.6.1-1_all.deb ...<br />Unpacking python-sympy-doc (0.7.6.1-1) ...<br />Selecting previously unselected package python-tables-lib.<br />Preparing to unpack .../python-tables-lib_3.2.2-2_amd64.deb ...<br />Unpacking python-tables-lib (3.2.2-2) ...<br />Selecting previously unselected package python-tables-data.<br />Preparing to unpack .../python-tables-data_3.2.2-2_all.deb ...<br />Unpacking python-tables-data (3.2.2-2) ...<br />Selecting previously unselected package python-tables.<br />Preparing to unpack .../python-tables_3.2.2-2_all.deb ...<br />Unpacking python-tables (3.2.2-2) ...<br />Selecting previously unselected package python-tk.<br />Preparing to unpack .../python-tk_2.7.12-1~16.04_amd64.deb ...<br />Unpacking python-tk (2.7.12-1~16.04) ...<br />Selecting previously unselected package python-xlrd.<br />Preparing to unpack .../python-xlrd_0.9.4-1_all.deb ...<br />Unpacking python-xlrd (0.9.4-1) ...<br />Selecting previously unselected package python-xlwt.<br />Preparing to unpack .../python-xlwt_0.7.5+debian1-1_all.deb ...<br />Unpacking python-xlwt (0.7.5+debian1-1) ...<br />Selecting previously unselected package python-scipy.<br />Preparing to unpack .../python-scipy_0.17.0-1_amd64.deb ...<br />Unpacking python-scipy (0.17.0-1) ...<br />Selecting previously unselected package python-statsmodels-lib.<br />Preparing to unpack .../python-statsmodels-lib_0.6.1-4_amd64.deb ...<br />Unpacking python-statsmodels-lib (0.6.1-4) ...<br />Selecting previously unselected package python-statsmodels.<br />Preparing to unpack .../python-statsmodels_0.6.1-4_all.deb ...<br />Unpacking python-statsmodels (0.6.1-4) ...<br />Processing triggers for libc-bin (2.23-0ubuntu10) ...<br />Processing triggers for fontconfig (2.11.94-0ubuntu1.1) ...<br />Processing triggers for man-db (2.7.5-1) ...<br />Processing triggers for hicolor-icon-theme (0.15-0ubuntu1) ...<br />Processing triggers for gnome-menus (3.13.3-6ubuntu3.1) ...<br />Processing triggers for desktop-file-utils (0.22-1ubuntu5.1) ...<br />Processing triggers for mime-support (3.59ubuntu1) ...<br />Processing triggers for doc-base (0.10.7) ...<br />Processing 5 added doc-base files...<br />Setting up python-pymysql (0.7.2-1ubuntu1) ...<br />Setting up tk8.6-blt2.5 (2.5.3+dfsg-3) ...<br />Setting up blt (2.5.3+dfsg-3) ...<br />Setting up fonts-lyx (2.1.4-2) ...<br />Setting up fonts-mathjax (2.6.1-1) ...<br />Setting up python-decorator (4.0.6-1) ...<br />Setting up python-ptyprocess (0.5-1) ...<br />Setting up python-pexpect (4.0.1-1) ...<br />Setting up python-simplegeneric (0.8.1-1) ...<br />Setting up ipython (2.4.1-1) ...<br />Setting up libjs-highlight.js (8.2+ds-4build1) ...<br />Setting up libjs-highlight (8.2+ds-4build1) ...<br />Setting up libjs-jquery-ui (1.10.1+dfsg-1) ...<br />Setting up libjs-marked (0.3.2+dfsg-1) ...<br />Setting up libjs-mathjax (2.6.1-1) ...<br />Setting up libjs-underscore (1.7.0~dfsg-1ubuntu1) ...<br />Setting up ipython-notebook-common (2.4.1-1) ...<br />Setting up python-markupsafe (0.23-2build2) ...<br />Setting up python-jinja2 (2.8-1) ...<br />Setting up python-pycurl (7.43.0-1ubuntu1) ...<br />Setting up python-tornado (4.2.1-1ubuntu3) ...<br />Setting up python-zmq (15.2.0-0ubuntu4) ...<br />Setting up ipython-notebook (2.4.1-1) ...<br />Setting up isympy (0.7.6.1-1) ...<br />Setting up libaec0:amd64 (0.3.2-1) ...<br />Setting up libamd2.4.1:amd64 (1:4.4.6-1) ...<br />Setting up libglpk36:amd64 (4.57-1build3) ...<br />Setting up libgsl2:amd64 (2.1+dfsg-2) ...<br />Setting up libsz2:amd64 (0.3.2-1) ...<br />Setting up libhdf5-10:amd64 (1.8.16+docs-4ubuntu1) ...<br />Setting up python-antlr (2.7.7+dfsg-6ubuntu1) ...<br />Setting up python-bs4 (4.4.1-1) ...<br />Setting up python-chardet (2.3.0-2) ...<br />Setting up libdsdp-5.8gf (5.8-9.1ubuntu2) ...<br />Setting up python-cvxopt (1.1.4-1.4) ...<br />Setting up python-cycler (0.9.0-1) ...<br />Setting up python-dateutil (2.4.2-1) ...<br />Setting up python-glade2 (2.24.0-4ubuntu1) ...<br />Setting up python-gmpy (1.17-1) ...<br />Setting up python-html5lib (0.999-4) ...<br />Setting up python-pil:amd64 (3.1.2-0ubuntu1.1) ...<br />Setting up python-imaging (3.1.2-0ubuntu1.1) ...<br />Setting up python-jdcal (1.0-1build1) ...<br />Setting up python-joblib (0.9.4-1) ...<br />Setting up python-lxml (3.5.0-1build1) ...<br />Setting up ttf-bitstream-vera (1.10-8) ...<br />Setting up python-matplotlib-data (1.5.1-1ubuntu1) ...<br />Setting up python-pyparsing (2.0.3+dfsg1-1ubuntu0.1) ...<br />Setting up python-tz (2014.10~dfsg1-0ubuntu2) ...<br />Setting up python-numpy (1:1.11.0-1ubuntu1) ...<br />Setting up python-matplotlib (1.5.1-1ubuntu1) ...<br />Setting up python-mpmath (0.19-3) ...<br />Setting up python-nose (1.3.7-1) ...<br />Setting up python-numexpr (2.4.3-1ubuntu1) ...<br />Setting up python-openpyxl (2.3.0-1) ...<br />Setting up python-pandas-lib (0.17.1-3ubuntu2) ...<br />Setting up python-pandas (0.17.1-3ubuntu2) ...<br />Setting up python-patsy (0.4.1-2) ...<br />Setting up python-py (1.4.31-1) ...<br />Setting up python-pyglet (1.1.4.dfsg-3) ...<br />Setting up python-pytest (2.8.7-4) ...<br />Setting up python-simplejson (3.8.1-1ubuntu2) ...<br />Setting up python-sympy (0.7.6.1-1) ...<br />Setting up python-sympy-doc (0.7.6.1-1) ...<br />Setting up python-tables-lib (3.2.2-2) ...<br />Setting up python-tables-data (3.2.2-2) ...<br />Setting up python-tables (3.2.2-2) ...<br />Setting up python-tk (2.7.12-1~16.04) ...<br />Setting up python-xlrd (0.9.4-1) ...<br />Setting up python-xlwt (0.7.5+debian1-1) ...<br />Setting up python-scipy (0.17.0-1) ...<br />Setting up python-statsmodels-lib (0.6.1-4) ...<br />Setting up python-statsmodels (0.6.1-4) ...<br />Processing triggers for libc-bin (2.23-0ubuntu10) ...<br />➜ redundans git:(master) ✗ python2 redundans.py -v -i test/*_?.fq.gz -f test/contigs.fa -o test/run1<br />Options: Namespace(fasta='test/contigs.fa', fastq=['test/5000_1.fq.gz', 'test/5000_2.fq.gz', 'test/600_1.fq.gz', 'test/600_2.fq.gz'], identity=0.51, iters=2, joins=5, limit=0.2, linkratio=0.7, log=', mode 'w' at 0x7f85d1de31e0&gt;, longreads=[], mapq=10, mem=16, minLength=200, nocleaning=True, nogapclosing=True, norearrangements=False, noreduction=True, noscaffolding=True, outdir='test/run1', overlap=0.8, reference='', resume=False, threads=4, tmp='/tmp', usebwa=False, verbose=True)</p><p>##################################################<br />[Mon May 7 11:29:18 2018] Reduction...<br />#file name genome size contigs heterozygous size [%] heterozygous contigs [%] identity [%] possible joins homozygous size [%] homozygous contigs [%]<br />/usr/lib/python2.7/dist-packages/matplotlib/font_manager.py:273: UserWarning: Matplotlib is building the font cache using fc-list. This may take a moment.<br /> warnings.warn('Matplotlib is building the font cache using fc-list. This may take a moment.')<br />test/run1/contigs.fa 163897 245 66377 40.50 221 90.20 94.854 0 97520 59.50 24 9.80</p><p>##################################################<br />[Mon May 7 11:29:29 2018] Estimating parameters of libraries...<br /> Aligning 19504 mates per library...<br />Insert size statistics Mates orientation stats<br />FastQ files read length median mean stdev FF FR RF RR<br />test/5000_1.fq.gz test/5000_2.fq.gz 50 4998 4990.20 721.47 0 4674 0 0<br />test/600_1.fq.gz test/600_2.fq.gz 100 599 598.63 47.68 0 10000 0 0</p><p>##################################################<br />[Mon May 7 11:29:29 2018] Scaffolding...<br /> iteration 1.1: test/run1/contigs.reduced.fa 24 97520 39.355 17 94157 7321 2195 0 29603<br /> 19505 pairs. 17302 passed filtering [88.71%]. 1627 in different contigs [8.34%].<br /> 1526 pairs. 558 in different contigs [36.57%].<br /> iteration 1.2: test/run1/_sspace.1.1.fa 3 97626 39.344 3 97626 87536 6063 821 87536<br /> 19505 pairs. 17607 passed filtering [90.27%]. 182 in different contigs [0.93%].<br /> 1077 pairs. 124 in different contigs [11.51%].<br /> iteration 2.1: test/run1/_sspace.1.2.fa 3 97626 39.344 3 97626 87536 6063 821 87536<br /> 19505 pairs. 15112 passed filtering [77.48%]. 1295 in different contigs [6.64%].<br /> 3417 pairs. 396 in different contigs [11.59%].<br /> iteration 2.2: test/run1/_sspace.2.1.fa 1 99133 39.344 1 99133 99133 99133 2328 99133<br /> 19505 pairs. 15152 passed filtering [77.68%]. 0 in different contigs [0.00%].<br /> 3398 pairs. 0 in different contigs [0.00%].</p><p>##################################################<br />[Mon May 7 11:29:34 2018] Gap closing...<br /> iteration 1.1: test/run1/scaffolds.fa 1 99133 39.344 1 99133 99133 99133 2328 99133</p><p>##################################################<br />[Mon May 7 11:29:35 2018] Final reduction...<br />#file name genome size contigs heterozygous size [%] heterozygous contigs [%] identity [%] possible joins homozygous size [%] homozygous contigs [%]<br />[WARNING] Nothing reduced!<br />test/run1/scaffolds.filled.fa 99390 1 0 0.00 0 0.00 0.000 0 99390 100.00 1 100.00</p><p>##################################################<br />[Mon May 7 11:29:35 2018] Reporting statistics...<br />#fname contigs bases GC [%] contigs &gt;1kb bases in contigs &gt;1kb N50 N90 Ns longest<br />test/contigs.fa 245 163897 40.298 24 117391 3975 233 0 29603<br />test/run1/contigs.fa 245 163897 40.298 24 117391 3975 233 0 29603<br />test/run1/contigs.reduced.fa 24 97520 39.355 17 94157 7321 2195 0 29603<br />test/run1/_sspace.1.1.fa 3 97626 39.344 3 97626 87536 6063 821 87536<br />test/run1/_sspace.1.2.fa 3 97626 39.344 3 97626 87536 6063 821 87536<br />test/run1/_sspace.2.1.fa 1 99133 39.344 1 99133 99133 99133 2328 99133<br />test/run1/_sspace.2.2.fa 1 99133 39.344 1 99133 99133 99133 2328 99133<br />test/run1/scaffolds.fa 1 99133 39.344 1 99133 99133 99133 2328 99133<br />test/run1/_gapcloser.1.1.fa 1 99390 39.689 1 99390 99390 99390 2 99390<br />test/run1/scaffolds.filled.fa 1 99390 39.689 1 99390 99390 99390 2 99390<br />test/run1/scaffolds.reduced.fa 1 99390 39.689 1 99390 99390 99390 2 99390</p><p>##################################################<br />[Mon May 7 11:29:35 2018] Cleaning-up...<br />#Time elapsed: 0:00:17.376924</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40221/dash-a-web-application-framework-that-provides-pure-python-abstraction-around-html-css-and-javascript</guid>
	<pubDate>Tue, 05 Nov 2019 06:39:48 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40221/dash-a-web-application-framework-that-provides-pure-python-abstraction-around-html-css-and-javascript</link>
	<title><![CDATA[Dash: a web application framework that provides pure Python abstraction around HTML, CSS, and JavaScript.]]></title>
	<description><![CDATA[<p style="margin-top: 0px; margin-bottom: 0.75rem;">Dash is a web application framework that provides pure Python abstraction around HTML, CSS, and JavaScript.</p>
<p style="margin-top: 0px; margin-bottom: 0.75rem;">Dash Bio is a suite of bioinformatics components that make it simpler to analyze and visualize bioinformatics data and interact with them in a Dash application.</p>
<p style="margin-top: 0px; margin-bottom: 0.75rem;">The source can be found on GitHub at<span>&nbsp;</span><a href="https://github.com/plotly/dash-bio">plotly/dash-bio</a>.</p>
<p style="margin-top: 0px; margin-bottom: 0.75rem;">These docs are using Dash Bio version 0.1.4.</p><p>Address of the bookmark: <a href="https://dash.plot.ly/dash-bio" rel="nofollow">https://dash.plot.ly/dash-bio</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/41043/postdoctoral-scientist-genome-analytics-genome-bioinformatics-mf</guid>
  <pubDate>Sun, 16 Feb 2020 02:57:40 -0600</pubDate>
  <link></link>
  <title><![CDATA[Postdoctoral scientist genome analytics/ genome bioinformatics (m/f/*)]]></title>
  <description><![CDATA[
<p>https://www.uksh.de/jobs/Stellenangebote-nr-20190570-p-8.html<br />Your profile:<br />Degree in bioinformatics, biostatistics, or equivalent<br />Experience in the processing and analysis of large-scale genomics data using compute clusters / high-performance computing<br />Strong competence in working in Unix/Linux environments (shell)<br />Strong programming skills (in particular: Python, R, Perl)<br />Experience with using git and snakemake<br />Fluent English language skills, both spoken and written<br />Strong communication skills and motivation to work in a young, interdisciplinary, dynamic team</p>

<p>Additional Information:</p>

<p>If you have any questions about scientific aspects of this position, please contact Prof. Lars Bertram, head of LIGA (lars.bertram@uni-luebeck.de).</p>

<p>Please contact Ms. Anna Wolbert for further questions about administrative details (recruiting@uksh.de).</p>

<p>Weitere Informationen erhalten Sie auch unter www.uksh.de/karriere.</p>

<p>Wir freuen uns auf Ihre Bewerbung bis zum 15.03.2020 unter Angabe unserer Ausschreibungsnummer 20190570.119.CL.</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/14091/subprocess-pkg</guid>
	<pubDate>Sun, 17 Aug 2014 07:59:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/14091/subprocess-pkg</link>
	<title><![CDATA[Subprocess pkg]]></title>
	<description><![CDATA[<p>Subprocess is one of simplest way of running linux command from within python code</p><p>Example:</p><p>if you want to run fastqc for QC of fastq file:</p><p>from subprocess import Popen,PIPE,call</p><p>p=Popen(["fastqc","-f","fastq","-o", "/home/name/result/","/dev/stdin"],stdin=fopen("read.fastq","r") ,stdout=PIPE,stderr=PIPE)</p><p>print p.stderr</p><p>p.stdout.close()</p><p>More:</p><p>http://pymotw.com/2/subprocess/</p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39441/snakepipes-a-toolkit-based-on-snakemake-and-python-for-analysis-of-ngs-data</guid>
	<pubDate>Thu, 30 May 2019 04:06:13 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39441/snakepipes-a-toolkit-based-on-snakemake-and-python-for-analysis-of-ngs-data</link>
	<title><![CDATA[snakepipes: A toolkit based on snakemake and python for analysis of NGS data]]></title>
	<description><![CDATA[<p><span><span>snakePipes are flexible and powerful workflows built using&nbsp;</span><a href="https://github.com/maxplanck-ie/snakepipes/blob/master/snakemake.readthedocs.io">snakemake</a><span>&nbsp;that simplify the analysis of NGS data.</span></span></p>
<ul>
<li>DNA-mapping*</li>
<li>ChIP-seq*</li>
<li>RNA-seq*</li>
<li>ATAC-seq*</li>
<li>scRNA-seq</li>
<li>Hi-C</li>
<li>Whole Genome Bisulfite Seq/WGBS</li>
</ul>
<p><span>(*Also available in "allele-specific" mode)</span></p>
<p><span>snakePipes can be installed via conda : </span></p>
<p><span>'conda install -c mpi-ie -c bioconda -c conda-forge snakePipes'. </span></p>
<p><span>Source code (</span><a href="https://github.com/maxplanck-ie/snakepipes" target="">https://github.com/maxplanck-ie/snakepipes</a><span>) and documentation (</span><a href="https://snakepipes.readthedocs.io/en/latest/" target="">https://snakepipes.readthedocs.io/en/latest/</a><span>) are available online.</span></p><p>Address of the bookmark: <a href="https://github.com/maxplanck-ie/snakepipes" rel="nofollow">https://github.com/maxplanck-ie/snakepipes</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>