In comparative genome analysis work, we usually compare more than two genomes and looks for syntenic regions amongst them. In my research I used Evolution Highway (RH) http://eh-demo.ncsa.uiuc.edu/, which is a collaborative project designed to provide a visual means for simultaneously comparing genomes of multiple amniote species. The tool removes the burden of manually aligning these maps and allows cognitive skills to be used toward something more valuable than preparation and transformation of data. In addition to EH, attractive Circos (http://circos.ca/) is also very popular for this kind of analysis.

The EH is available online, and can be easily access and use, whereas Circos installation is not entirely straightforward. One of the most difficult parts of the installation involves installing the GD library. Since there weren't good instructions for installing this library on the internet I decided to post instructions here in case they are useful to anyone else.

Following are the steps to install GD modules in Mac OS

1. Setup

Create a folder for the files:

$ mkdir -p /SourceCache
$ cd /SourceCache

Get and unpack the required Jpeg-6b and GD libraries:
Download Jpeg-6b (http://code.google.com/p/google-desktop-for-linux-mirror/downloads/detail?name=jpeg-6b.tar.gz&can=2&q)
Download GD (http://search.cpan.org/~lds/GD-2.46/)

Place the "tar.gz" files in "/SourceCache" and double click to unpack.

2. Install libjpeg

Copy the "config.sub" and "config.guess" files to "/SourceCache". Note that your "config.sub" and ""config.guess" files may be in a slightly different location. The commands below show where they were on my machine:

$ cd /SourceCache/jpeg-6b/src
$ cp /usr/share/libtool/config/config.sub .
$ cp /usr/share/libtool/config/config.guess .

Configure libjpeg as follows. Note that this was installed on a 64 bit machine. However, this method may configure it in a 32 bit format. This may not be the best way to configure the installation but it works.

$ .configure --enable-shared
$ make

Check to see if the following directories exist on your machine. Create the missing directories in the following manner:

$ mkdir -p /usr/local/include
$ mkdir -p /usr/local/bin
$ mkdir -p /usr/local/lib
$ mkdir -p /usr/local/man/man1

Finish making and installing libjpeg:

$ make install

3. Install GD

$ cd /SourceCache/GD-2.46/GD/
$ perl Makefile.PL
$ make
$ make test (optional)
$ make html (optional)
$ make install

Other way for Mac OS
The easiest way to get a lot of these is with a program called Fink, which is similar in nature to the CPAN installer, but installs common GNU utilities. Fink is available from <http://sourceforge.net/projects/fink/>.

Follow the instructions for setting up Fink. Once it's installed, you'll want to run the following as root: fink install gd

It will prompt you for a number of dependencies, type 'y' and hit enter to install all of the dependencies. Then watch it work.

To prevent creating conflicts with the software that Apple installs by default, Fink creates its own directory tree at /sw where it installs most of the software that it installs. This means your libraries and headers for libgd will be at /sw/lib and /sw/include instead of /usr/lib and /usr/local/include. Because of these changed locations for the libraries, the Perl GD module will not install directly via CPAN, because it looks for the specific paths instead of getting them from your environment. But there's a way around that :-)

Instead of typing "install GD" at the cpan> prompt, type look GD. This should go through the motions of downloading the latest version of the GD module, then it will open a shell and drop you into the build directory. Apply below patch to the Makefile.PL file (save the patch into a file and use the command patch < patchfile.)

Then, run these commands to finish the installation of the GD module:

perl Makefile.PL
make
make test
make install
And don't forget to run exit to get back to CPAN.

Install on MS Window, using PPM

C:\Documents and Settings\Owner>ppm
PPM interactive shell (2.2.0) - type 'help' for available commands.
PPM> install GD
Install package 'GD?' (y/N): y
Installing package 'GD'...
Downloading http://ppm.ActiveState.com/PPMPackages/5.6plus/MSW. ...
Installing C:\Perl\site\lib\auto\GD\GD.bs
Installing C:\Perl\site\lib\auto\GD\GD.dll
Installing C:\Perl\site\lib\auto\GD\GD.exp
Installing C:\Perl\site\lib\auto\GD\GD.lib
Installing C:\Perl\html\site\lib\GD.html
Installing C:\Perl\site\lib\GD.pm
Installing C:\Perl\site\lib\qd.pl
Installing C:\Perl\site\lib\auto\GD\autosplit.ix
PPM>


If you can't install it from ppm. You can download it:
http://ppm.ActiveState.com/PPMPackages/5.6plus/MSW.


BTW,All Perl 5.6.1 Modules are located at:

http://ppm.ActiveState.com/PPMPackages/5.6plus/MSW.

Install the Perl GD Module on Linux

$ sudo perl -MCPAN -e shell

Since it was the first time I had run this command on this particular machine I had to answer a lot of questions but simply selected the defaults for everything as this usually works for me. Once in the CPAN shell I entered

$ install Bundle::CPAN

and selected all of the defaults again. Once the CPAN bundle had finished installing I tried to install GD::Graph by typing

$ install GD::Graph

but it failed with hundreds of errors – the first of which was

GD.xs:7:16: error: gd.h: No such file or directory

This was fixed with the following apt-get command (in the bash shell)

$ sudo apt-get install libgd2-xpm-dev

back in the CPAN shell I still couldn’t get GD::Graph to build and I guessed this was because of some left over files from the failed build. I don’t know the command to clean things up inside the CPAN shell and am too lazy to read the docs so I simply went into the .cpan/build directory in my home directory and deleted anything that started with GD – eg

$ rm -rf GD-2.35-HC_vkB

$ rm -rf GDGraph-1.44-Evfibe

and so on. Those strings at the end (VkB and so on) look random so they might be different on your machine. Then I went back into the CPAN shell and ran

$ install GD::Graph

There were a few dependencies which the script fetched and installed for me but everything worked smoothly.

Manual and other Perl Module instalation are mentioned in my previous blog @ http://bioinformaticsonline.com/blog/view/710/how-to-install-perl-modules-manually-using-cpan-command-and-other-quick-ways

Address of the bookmark: http://www.citrusperl.com/

Address of the bookmark: http://cbb.sjtu.edu.cn/course/database/beginning.pdf

Perl one-liners are small and awesome Perl programs that fit in a single line of code and they do one thing really well. These things include changing line spacing, numbering lines, doing calculations, converting and substituting text, deleting and printing certain lines, parsing logs, editing files in-place, doing statistics, carrying out system administration tasks, updating a bunch of files at once, and many more. Perl one-liners will make you the shell warrior. Anything that took you minutes to solve, will now take you seconds!

perl -pe '$\="\n"'   
#double space a file

perl -pe '$_ .= "\n" unless /^$/'
#double space a file except blank lines

perl -pe '$_.="\n"x7'
#7 space in a line.

perl -ne 'print unless /^$/'
#remove all blank lines

perl -lne 'print if length($_) < 20'
#print all lines with length less than 20.

perl -00 -pe ''
#If there are multiple spaces, delete all leaving one(make the file a single spaced file).

perl -00 -pe '$_.="\n"x4'
#Expand single blank lines into 4 consecutive blank lines

perl -pe '$_ = "$. $_"'
#Number all lines in a file

perl -pe '$_ = ++$a." $_" if /./'
#Number only non-empty lines in a file

perl -ne 'print ++$a." $_" if /./'
#Number and print only non-empty lines in a file

perl -pe '$_ = ++$a." $_" if /regex/'
#Number only lines that match a pattern

perl -ne 'print ++$a." $_" if /regex/'
#Number and print only lines that match a pattern

perl -ne 'printf "%-5d %s", $., $_ if /regex/'
#Left align lines with 5 white spaces if matches a pattern (perl -ne 'printf "%-5d %s", $., $_' : for all the lines)

perl -le 'print scalar(grep{/./}<>)'
#prints the total number of non-empty lines in a file

perl -lne '$a++ if /regex/; END {print $a+0}'
#print the total number of lines that matches the pattern

perl -alne 'print scalar @F'
#print the total number fields(words) in each line.

perl -alne '$t += @F; END { print $t}'
#Find total number of words in the file

perl -alne 'map { /regex/ && $t++ } @F; END { print $t }'
#find total number of fields that match the pattern

perl -lne '/regex/ && $t++; END { print $t }'
#Find total number of lines that match a pattern

perl -le '$n = 20; $m = 35; ($m,$n) = ($n,$m%$n) while $n; print $m'
#will calculate the GCD of two numbers.

perl -le '$a = $n = 20; $b = $m = 35; ($m,$n) = ($n,$m%$n) while $n; print $a*$b/$m'
#will calculate lcd of 20 and 35.

perl -le '$n=10; $min=5; $max=15; $, = " "; print map { int(rand($max-$min))+$min } 1..$n'
#Generates 10 random numbers between 5 and 15.

perl -le 'print map { ("a".."z",”0”..”9”)[rand 36] } 1..8'
#Generates a 8 character password from a to z and number 0 – 9.

perl -le 'print map { ("a",”t”,”g”,”c”)[rand 4] } 1..20'
#Generates a 20 nucleotide long random residue.

perl -le 'print "a"x50'
#generate a string of ‘x’ 50 character long

perl -le 'print join ", ", map { ord } split //, "hello world"'
#Will print the ascii value of the string hello world.

perl -le '@ascii = (99, 111, 100, 105, 110, 103); print pack("C*", @ascii)'
#converts ascii values into character strings.

perl -le '@odd = grep {$_ % 2 == 1} 1..100; print "@odd"'
#Generates an array of odd numbers.

perl -le '@even = grep {$_ % 2 == 0} 1..100; print "@even"'
#Generate an array of even numbers

perl -lpe 'y/A-Za-z/N-ZA-Mn-za-m/' file
#Convert the entire file into 13 characters offset(ROT13)

perl -nle 'print uc'
#Convert all text to uppercase:

perl -nle 'print lc'
#Convert text to lowercase:

perl -nle 'print ucfirst lc'
#Convert only first letter of first word to uppercas

perl -ple 'y/A-Za-z/a-zA-Z/'
#Convert upper case to lower case and vice versa

perl -ple 's/(\w+)/\u$1/g'
#Camel Casing

perl -pe 's|\n|\r\n|'
#Convert unix new lines into DOS new lines:

perl -pe 's|\r\n|\n|'
#Convert DOS newlines into unix new line

perl -pe 's|\n|\r|'
#Convert unix newlines into MAC newlines:

perl -pe '/regexp/ && s/foo/bar/'
#Substitute a foo with a bar in a line with a regexp.

Reference/Sources:

http://genomics-array.blogspot.in/2010/11/some-unixperl-oneliners-for.html

http://genomespot.blogspot.com/2013/08/a-selection-of-useful-bash-one-liners.html

http://biowize.wordpress.com/2012/06/15/command-line-magic-for-your-gene-annotations/

http://genomics-array.blogspot.com/2010/11/some-unixperl-oneliners-for.html

http://bioexpressblog.wordpress.com/2013/04/05/split-multi-fasta-sequence-file/

Bioinformatics Textbook Track

Find more about Rosalind puzzle at http://rosalind.info/problems/list-view/?location=bioinformatics-textbook-track

I will provide solution of all the Rosalind problem with Perl for community.

Check out the right sidebar for more links ...

More at http://cpansearch.perl.org/src/TJPARNELL/

Address of the bookmark: http://cpansearch.perl.org/src/TJPARNELL/

CORE MODULES

Three modules make up the core engine for MCE.

MCE::Core

Provides the Core API for Many-Core Engine. The various MCE options are described here.

MCE::Signal

Temporary directory creation, cleanup, and signal handling.

MCE::Util

Utility functions for Many-Core Engine.

MCE EXTRAS

There are 4 add-on modules for use with MCE.

MCE::Candy

Provides a collection of sugar methods and output iterators for preserving output order.

MCE::Mutex

Provides a simple semaphore implementation supporting threads and processes.

MCE::Queue

Provides a hybrid queuing implementation for MCE supporting normal queues and priority queues from a single module. MCE::Queue exchanges data via the core engine to enable queuing to work for both children (spawned from fork) and threads.

MCE::Relay

Enables workers to receive and pass on information orderly with zero involvement by the manager process while running.

MCE MODELS

The models take Many-Core Engine to a new level for ease of use. Two options (chunk_size and max_workers) are configured automatically as well as spawning and shutdown.

MCE::Loop

Provides a parallel loop utilizing MCE for building creative loops.

MCE::Flow

A parallel flow model for building creative applications. This makes use of user_tasks in MCE. The author has full control when utilizing this model. MCE::Flow is similar to MCE::Loop, but allows for multiple code blocks to run in parallel with a slight change to syntax.

MCE::Grep

Provides a parallel grep implementation similar to the native grep function.

MCE::Map

Provides a parallel map model similar to the native map function.

MCE::Step

Provides a parallel step implementation utilizing MCE::Queue between user tasks. MCE::Step is a spin off from MCE::Flow with a touch of MCE::Stream. This model, introduced in 1.506, allows one to pass data from one sub-task into the next transparently.

MCE::Stream

Provides an efficient parallel implementation for chaining multiple maps and greps together through user_tasks and MCE::Queue. Like with MCE::Flow, MCE::Stream can run multiple code blocks in parallel with a slight change to syntax from MCE::Map and MCE::Grep.

MISCELLANEOUS

Miscellaneous additions included with the distribution.

MCE::Examples

Describes various demonstrations for MCE including a Monte Carlo simulation.

MCE::Subs

Exports functions mapped directly to MCE methods; e.g. mce_wid. The module allows 3 options; :manager, :worker, and :getter.

REQUIREMENTS

Perl 5.8.0 or later. PDL::IO::Storable is required in scripts running PDL.

SOURCE AND FURTHER READING

The source, cookbook, and examples are hosted at GitHub.

• https://github.com/marioroy/mce-perl

• https://github.com/marioroy/mce-cookbook

• https://github.com/marioroy/mce-examples

SEE ALSO

MCE::Shared provides data sharing capabilities for MCE. It includes MCE::Hobo for running code asynchronously.

• MCE::Shared

• MCE::Hobo

Address of the bookmark: https://github.com/marioroy/mce-examples

Common uses of the tool include:

• Displaying the sequence and/or genes in a GenBank flat file.
• Highlighting differences and/or similarities in gene content between related organisms.
• Comparing SNPs and indels between closely-related strains or serovars.
• Comparing gene expression values across multiple samples or timepoints.
• Visualizing coverage plots of RNA-Seq read alignments.

Key Features

Circleator...

• Builds on BioPerl and the input file formats that it supports, including:
  • GenBank flat files, GFF, FASTA
• Accepts a number of other commonly-used datatypes and file formats:
  • BSR and TRF output, SAM/BAM files, VCF-encoded SNPs, tab-delimited files
• Outputs publication-ready figures in the SVG (Scalable Vector Graphics) format.
• Requires only a single configuration file whose layout mirrors that of the figure itself.
  • Predefined configuration files and "track" types are supplied for common datasets.
  • Advanced features allow limited analyses to be performed as a figure is drawn.
• Includes an extensive set of regression tests.
• Offers a prototype web-based GUI (under the "Ringmaster" project.)

https://github.com/jonathancrabtree/Circleator

Address of the bookmark: https://github.com/jonathancrabtree/Circleator

Address of the bookmark: https://saliweb.readthedocs.io/en/latest/frontend.html

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr