<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/33586?offset=30</link>
	<atom:link href="https://bioinformaticsonline.com/related/33586?offset=30" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41020/cancer-dependency-map</guid>
	<pubDate>Thu, 13 Feb 2020 04:38:47 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41020/cancer-dependency-map</link>
	<title><![CDATA[Cancer Dependency Map]]></title>
	<description><![CDATA[<p><span>The consequences of alterations in the DNA of cancer cells and subsequent vulnerabilities are not fully understood. This project aims to assign a dependency to every cancer cell in a patient which could be exploited to develop new therapies. This knowledge is foundational for precision cancer medicine.</span></p><p>Address of the bookmark: <a href="https://depmap.sanger.ac.uk/" rel="nofollow">https://depmap.sanger.ac.uk/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41405/sequence-tube-maps-displays-multiple-genomic-sequences-in-the-form-of-a-tube-map</guid>
	<pubDate>Wed, 11 Mar 2020 01:12:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41405/sequence-tube-maps-displays-multiple-genomic-sequences-in-the-form-of-a-tube-map</link>
	<title><![CDATA[Sequence Tube Maps: displays multiple genomic sequences in the form of a tube map]]></title>
	<description><![CDATA[<p>A JavaScript module for the visualization of genomic sequence graphs. It automatically generates a "tube map"-like visualization of sequence graphs which have been created with <a href="https://github.com/vgteam/vg">vg</a>. (<a href="https://github.com/vgteam/vg">https://github.com/vgteam/vg</a>)</p>
<h3>Link to working demo: <a href="https://vgteam.github.io/sequenceTubeMap/">https://vgteam.github.io/sequenceTubeMap/</a></h3>
<p><img src="https://raw.githubusercontent.com/vgteam/sequenceTubeMap/master/images/header.png" alt="image" style="border: 0px; border: 0px;"></p><p>Address of the bookmark: <a href="https://github.com/vgteam/sequenceTubeMap" rel="nofollow">https://github.com/vgteam/sequenceTubeMap</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/710/how-to-install-perl-modules-manually-using-cpan-command-and-other-quick-ways</guid>
	<pubDate>Fri, 12 Jul 2013 07:20:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/710/how-to-install-perl-modules-manually-using-cpan-command-and-other-quick-ways</link>
	<title><![CDATA[How to install Perl modules manually, using CPAN command, and other quick ways]]></title>
	<description><![CDATA[<p>As a bioinformatics programmer, and crunchy data analyser you need to install several perl modules and dependencies. Installing Perl modules manually by resolving all the dependencies is&nbsp; tedious and annoying process. Some of the packages like GD is the real pain. <br /><br />However, Installing Perl modules using CPAN is a better solution, as it resolves all the dependencies automatically. In this article, let us review how to install Perl modules on Linux ( which is prefereced amonst bioinformatician) using both manual and CPAN method.<br /><br />When a Perl module is not installed, application will display the following error message. In this example, XML::Parser Perl module is missing.</p><p>Can't locate XML/parser.pm in @INC (@INC contains:<br />/usr/lib/perl5/5.10.0/i386-linux-thread-multi<br />/usr/lib/perl5/5.10.0<br />/usr/local/lib/perl5/site_perl/5.10.0/i386-linux-thread-multi<br />/usr/local/lib/perl5/site_perl/5.10.0<br />/usr/lib/perl5/vendor_perl/5.10.0/i386-linux-thread-multi<br />/usr/lib/perl5/vendor_perl/5.10.0 /usr/lib/perl5/vendor_perl<br />/usr/lib/perl5/site_perl/5.10.0 .)</p><p><strong>Manual Method of Perl Module Installation</strong></p><ul>
<li>Install Perl Modules Manually</li>
</ul><p>This manual method is very useful when your computer or server is not connected to the Internet.</p><p>Download Perl module: <br />Go to CPAN Search website and search for the module that you wish to download. In this example, let us search, download and install XML::Parser Perl module. I have downloaded the XML-Parser-2.36.tar.gz to /home/download<br /><br /># cd /home/download<br /># gzip -d XML-Parser-2.36.tar.gz<br /># tar xvf XML-Parser-2.36.tar<br /># cd XML-Parser-2.36<br /><br />Build the perl module: <br />Build by running Makefile.PL, remember the case sensitivity, make and make test.<br /><br /># perl Makefile.PL<br />Checking if your kit is complete...<br />Looks good<br />Writing Makefile for XML::Parser::Expat<br />Writing Makefile for XML::Parser<br /># make<br /># make test<br /><br />Install the perl module:<br />Now your package is ready to install.<br /><br /># make install<br /><br />As a newbie it looks pretty simple, and one go. But, luckily this is a very simple one module with no dependencies. Typically, Perl modules will be dependent on several other modules. Just imagine chasing all these dependencies one-by-one, thinking ... oh ye I got it. That will be very painful and annoying task. I recommend the CPAN method of installation as shown below.</p><p><strong>Install Perl Modules using CPAN automatically</strong></p><p>Logically, you should must have the CPAN perl module installed in your server or computer before you can install any other Perl modules using CPAN. I know you&nbsp; are laughing, "to install a perl module you need another perl module"&nbsp; ;)<br /><br />Lets verify whether CPAN is already installed:<br /><br />To install Perl modules using CPAN, make sure the cpan command is working. Following are the error message when CPAN module is not installed.<br /><br /># cpan<br />-bash: cpan: command not found<br /><br /># perl -MCPAN -e shell<br />Can't locate CPAN.pm in @INC (@INC contains:<br />/usr/lib/perl5/5.10.0/i386-linux-thread-multi<br />/usr/lib/perl5/5.10.0<br />/usr/local/lib/perl5/site_perl/5.10.0/i386-linux-thread-multi<br />/usr/local/lib/perl5/site_perl/5.10.0<br />/usr/lib/perl5/vendor_perl/5.10.0/i386-linux-thread-multi<br />/usr/lib/perl5/vendor_perl/5.10.0<br />/usr/lib/perl5/vendor_perl /usr/lib/perl5/site_perl/5.10.0 .).<br />BEGIN failed--compilation aborted.<br /><br />Install the CPAN module using yum:<br />If CPAN in not installed in your system, you can use "yum" for the rescue. Dont worry biological data cruncher, this is true we are now dependent all these tiny magicians :). <br /><br /># yum install perl-CPAN<br /><br />Output of yum install perl-CPAN command:</p><p>Loaded plugins: refresh-packagekit<br />updates-newkey&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; | 2.3 kB&nbsp;&nbsp;&nbsp;&nbsp; 00:00<br />primary.sqlite.bz2&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; | 2.4 MB&nbsp;&nbsp;&nbsp;&nbsp; 00:00<br />Setting up Install Process<br />Parsing package install arguments<br /><br />Resolving Dependencies<br />Transaction Summary<br />=============================================================================<br />Install&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 5 Package(s)<br />Update&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 0 Package(s)<br />Remove&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 0 Package(s)<br /><br />Total download size: 1.0 M<br />Is this ok [y/N]: y<br />Downloading Packages:<br />(1/5): perl-ExtUtils-ParseXS-2.18-31.fc9.i386.rpm&nbsp;&nbsp;&nbsp;&nbsp; |&nbsp; 30 kB&nbsp;&nbsp;&nbsp;&nbsp; 00:00<br />(2/5): perl-Test-Harness-2.64-31.fc9.i386.rpm&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; |&nbsp; 70 kB&nbsp;&nbsp;&nbsp;&nbsp; 00:00<br />(3/5): perl-CPAN-1.9205-31.fc9.i386.rpm&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; | 217 kB&nbsp;&nbsp;&nbsp;&nbsp; 00:00<br />(4/5): perl-ExtUtils-MakeMaker-6.36-31.fc9.i386.rpm&nbsp;&nbsp; | 284 kB&nbsp;&nbsp;&nbsp;&nbsp; 00:00<br />(5/5): perl-devel-5.10.0-31.fc9.i386.rpm&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; | 408 kB&nbsp;&nbsp;&nbsp;&nbsp; 00:00<br /><br />Installing&nbsp;&nbsp;&nbsp;&nbsp; : perl-ExtUtils-ParseXS&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; [1/5]<br />Installing&nbsp;&nbsp;&nbsp;&nbsp; : perl-devel&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; [2/5]<br />Installing&nbsp;&nbsp;&nbsp;&nbsp; : perl-Test-Harness&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; [3/5]<br />Installing&nbsp;&nbsp;&nbsp;&nbsp; : perl-ExtUtils-MakeMaker&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; [4/5]<br />Installing&nbsp;&nbsp;&nbsp;&nbsp; : perl-CPAN&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; [5/5]<br /><br /><br />Installed: perl-CPAN.i386 0:1.9205-31.fc9<br />Dependency Installed:<br />&nbsp; perl-ExtUtils-MakeMaker.i386 0:6.36-31.fc9<br />&nbsp; perl-ExtUtils-ParseXS.i386 1:2.18-31.fc9<br />&nbsp; perl-Test-Harness.i386 0:2.64-31.fc9<br />&nbsp; perl-devel.i386 4:5.10.0-31.fc9<br />Complete!<br /><br />Configure cpan the first time:<br />Once the CPAN is installed, you need to configure it by executing cpan, you should set some configuration parameters as shown below. I have shown only the important configuration parameters below. Accept all the default values by pressing enter.<br /><br />Note: Make sure to execute &ldquo;o conf commit&rdquo; in the cpan prompt after the configuration to save the settings.<br /><br /># cpan<br /><br />Sorry, we have to rerun the configuration dialog for CPAN.pm due<br />to some missing parameters...<br /><br />CPAN build and cache directory? [/root/.cpan]<br />Download target directory? [/root/.cpan/sources]<br />Directory where the build process takes place? [/root/.cpan/build]<br /><br />Always commit changes to config variables to disk? [no]<br />Cache size for build directory (in MB)? [100]<br />Let the index expire after how many days? [1]<br /><br />Perform cache scanning (atstart or never)? [atstart]<br />Cache metadata (yes/no)? [yes]<br />Policy on building prerequisites (follow, ask or ignore)? [ask]<br /><br />Parameters for the 'perl Makefile.PL' command? []<br />Parameters for the 'perl Build.PL' command? []<br /><br />Your ftp_proxy? []<br />Your http_proxy? []<br />Your no_proxy? []<br />Is it OK to try to connect to the Internet? [yes]<br /><br />First, pick a nearby continent and country by typing in the number(s)<br />(1) Africa<br />(2) Asia<br />(3) Central America<br />(4) Europe<br />(5) North America<br />(6) Oceania<br />(7) South America<br />Select your continent (or several nearby continents) [] 5<br /><br />(1) Bahamas<br />(2) Canada<br />(3) Mexico<br />(4) United States<br />Select your country (or several nearby countries) [] 4<br /><br />(2) ftp://carroll.cac.psu.edu/pub/CPAN/<br />(3) ftp://cpan-du.viaverio.com/pub/CPAN/<br />(4) ftp://cpan-sj.viaverio.com/pub/CPAN/<br />(5) ftp://cpan.calvin.edu/pub/CPAN<br />(6) ftp://cpan.cs.utah.edu/pub/CPAN/<br />e.g. '1 4 5' or '7 1-4 8' [] 2-16<br /><br />cpan[1]&gt; o conf commit<br />commit: wrote '/usr/lib/perl5/5.10.0/CPAN/Config.pm'<br /><br />cpan[2]&gt; quit<br />No history written (no histfile specified).<br />Lockfile removed.<br /><br /></p><ul>
<li>Install Perl Modules using CPAN</li>
</ul><p>Hey smile please, now you are ready with CPAN and can download modules in one line command. <br /><br />You can use one of the following method to install a Perl module using cpan:<br /><br /># perl -MCPAN -e 'install Bundle::BioPerl'<br /><br />(or)<br /><br /># cpan<br />cpan shell -- CPAN exploration and modules installation (v1.9205)<br />ReadLine support available (maybe install Bundle::CPAN or Bundle::CPANxxl?)<br /><br />cpan[1]&gt; install "Bundle::BioPerl"<br /><br />In the example above, CPAN will check for&nbsp;Bundle::BioPerl dependencies and automatically resolves and installs&nbsp;Bundle::BioPerl with all the dependent Perl modules.</p><ul>
<li>Quick Ways</li>
</ul><p>Oh, look at your face.. smily hmm :). This is what your are looking for, a quick and best way to install Perl modules, Bioperl. Following are the the steps to download BioPerl in your server/computer.</p><p># sudo apt-cache search perl BioPerl</p><p>Output will be like as follows:</p><p>bioperl - Perl tools for computational molecular biology<br />bioperl-run - BioPerl wrappers: scripts<br />libbio-perl-perl - BioPerl core perl modules<br />libbio-perl-run-perl - BioPerl wrappers: modules<br />libbio-samtools-perl - Perl interface to SamTools library for DNA sequencing<br />libbiojava-java - Java API to biological data and applications (default version)<br />libbiojava3-java - Java API to biological data and applications (default version)<br />python-biopython-sql - Biopython support for the BioSQL database schema<br />libbtlib-perl - library for basic sequence manipulation<br /><br /></p><p># sudo apt-get install bioperl</p><p>If it is installed then flash the following message:</p><p>Reading package lists... Done<br />Building dependency tree&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; <br />Reading state information... Done<br />bioperl is already the newest version.<br />0 upgraded, 0 newly installed, 0 to remove and 10 not upgraded.</p><p>In it is found not installed in your server or system them install all with dependencies.</p><p>You can use the same approach to install all the modules, and packages if required.</p><p>Thanks for reading. Best of luck for your research.</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/1494/perl-maven-tutorial-by-gabor-szabo</guid>
	<pubDate>Fri, 09 Aug 2013 05:43:10 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/1494/perl-maven-tutorial-by-gabor-szabo</link>
	<title><![CDATA[Perl Maven tutorial by Gabor Szabo]]></title>
	<description><![CDATA[<p>I personally reccoment this tutorial for Perl users.</p><p>More detail http://perlmaven.com/</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/2377/cava-deployment-tools</guid>
	<pubDate>Wed, 14 Aug 2013 15:00:48 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/2377/cava-deployment-tools</link>
	<title><![CDATA[Cava Deployment Tools]]></title>
	<description><![CDATA[<p>Cava Packager allows packaging of applications written in Perl. Packaged applications can be distributed without the need for an installation of Perl on the target machine. Cava Packager is currently distributed under a free to use license.</p>
<p>Supported Perl Versions<br><br>Threaded Perl with a shared libperl&nbsp; 5.8, 5.10, 5.12, 5.14, 5.16<br><br>Supported Operating Systems<br><br>&nbsp;&nbsp;&nbsp; MS Windows XP and later 32 and 64 bit.<br><br>&nbsp;&nbsp;&nbsp; Linux 32 and 64 bit - minimum glibc 2.5, GTK+ 2.10, libstdc++6.<br><br>&nbsp;&nbsp;&nbsp; Linux 32 bit&nbsp; RHEL 3 and 4.<br><br>&nbsp;&nbsp;&nbsp; Mac OSX 10.4 and 10.5 - ppc and i386.<br><br>&nbsp;&nbsp;&nbsp; Mac OSX 10.6, 10.7, 10.8&nbsp; - i386 and x86_64 ( 64 bit for Perl 5.16 only ).</p><p>Address of the bookmark: <a href="http://www.cavapackager.com/" rel="nofollow">http://www.cavapackager.com/</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/4882/detect-the-sequence-pattern-and-its-location-in-fasta-file-with-match-and-mismatches-information</guid>
	<pubDate>Thu, 26 Sep 2013 15:02:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/4882/detect-the-sequence-pattern-and-its-location-in-fasta-file-with-match-and-mismatches-information</link>
	<title><![CDATA[Detect the sequence pattern and its location in fasta file with match and mismatches information.]]></title>
	<description><![CDATA[<p>This script is one of my old script to detect some centromeric pattern in chromosomes. User can also control the number of mismatches allowed through command line ..</p><p>To run:</p><p>perl centro.pl</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/4882" length="3596" type="text/x-perl" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/26627/scientist-computational-genomics-two-positions</guid>
  <pubDate>Sat, 12 Mar 2016 18:07:56 -0600</pubDate>
  <link></link>
  <title><![CDATA[Scientist - Computational Genomics (Two Positions)]]></title>
  <description><![CDATA[
<p>ICRISAT is a non-profit, non-political organization that conducts agricultural research for development in Asia and sub-Saharan Africa with a wide array of partners throughout the world. Covering 6.5 million square kilometers of land in 55 countries, the semi-arid tropics is home to over 2 billion people, with 650 million of these being the poorest of the poor. ICRISAT and its partners help empower those living in the semi-arid tropics, especially smallholder farmers, to overcome poverty, hunger, malnutrition and a degraded environment through more efficient and profitable agriculture.</p>

<p>ICRISAT is headquartered in Patancheru near Hyderabad, India, with two regional hubs and five country offices in sub-Saharan Africa. ICRISAT, established in 1972, is a member of the CGIAR Consortium. For more details, see www.icrisat.org.</p>

<p>Responsibilities:Design efficient SQL queries for pulling large sequencing projects.<br />Serve as a technical adviser to the project leadership and provide computational perspective on product design and deliverability.<br />Develop and oversee a rapid and incremental software development and release schedule.<br />Design the software architecture, oversee the implementation and evolution of the design on appropriate hardware platforms.<br />Working collaboratively in a team environment to design, code, test, debug, and document programs for an integrated genomic analysis pipeline in a rapid and incremental software development and release schedule.<br />Supervise and review code development and ensure that software products meet project objectives in terms of functionality, scalability, robustness and user experience.<br />Implement and oversee the QA/QC practices to ensure the development team is adhering to quality standards.<br />Work closely with the application specialist to integrate feedbacks from teams in each CGIAR center into software customization and improvement.<br />Assist in training of breeders in the CGIAR centers to use software developed.<br /> Personal Profile:</p>

<p>The applicant should have:</p>

<p>Understanding of genomics data and advanced knowledge of Java, and C/C++ as the programming languages and any of the scripting language like perl and/or Python, SQL<br />High Performance Computing, data architecture, database platforms and QA/QC practices in software engineering.<br />She/he should have solid experience in software development projects, preferably as a senior programmer or in the software project management role, and in projects involving big data.<br />Excellent communication skills are needed to work in this multi-disciplinary, multi-location and multi-cultural team.<br />Ability to mentor colleagues in quality software development practices is desired.<br />Educational Qualification : Ph. D or Masters Degree in Computational Biology / Computational Genomics or Equivalent with Research Experience in Mentioned Areas.</p>

<p>More at http://www.icrisat.org/careers/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/31502/perl-way-to-check-if-an-array-contains-values</guid>
	<pubDate>Thu, 09 Mar 2017 17:17:01 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/31502/perl-way-to-check-if-an-array-contains-values</link>
	<title><![CDATA[Perl way to check if an array contains values]]></title>
	<description><![CDATA[<p><span>Perl is always is known for their flexibility (<span>There is more than one way to do it</span>). </span></p><p><span>Followings are the quick way to check if a value exist in an array.</span></p><blockquote><p><span>do_something </span><span>if</span><span> </span><span>'flour'</span><span> </span><span>~~</span><span> </span><span>@ingredients</span><span> &nbsp; </span><span># ~~ operand. &nbsp; BEWARE: it is broken.</span><span><br /><br />do_something </span><span>if</span><span> grep </span><span>{</span><span>$_ eq </span><span>'flour'</span><span>}</span><span> </span><span>@ingredients</span><span> </span><span># grep (slower than 'any')</span><span><br /><br />do_something </span><span>if</span><span> any </span><span>{</span><span>$_ eq </span><span>'flour'</span><span>}</span><span> </span><span>@ingredients</span><span> </span><span># List::MoreUtils / Util::Any</span><span><br /><br />do_something </span><span>if</span><span> any</span><span>(</span><span>@ingredients</span><span>)</span><span> eq </span><span>'flour'</span><span> &nbsp; </span><span># use syntax 'junction';</span><span><br /><br />do_something </span><span>if</span><span> </span><span>@ingredients</span><span>-&gt;</span><span>contains</span><span>(</span><span>'flour'</span><span>)</span><span> &nbsp; </span><span># added with autobox</span></p></blockquote>]]></description>
	<dc:creator>Shruti Paniwala</dc:creator>
</item>

</channel>
</rss>