<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/33689?offset=0</link>
	<atom:link href="https://bioinformaticsonline.com/related/33689?offset=0" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/26424/biotoolbox</guid>
	<pubDate>Fri, 19 Feb 2016 09:14:44 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/26424/biotoolbox</link>
	<title><![CDATA[BioToolbox]]></title>
	<description><![CDATA[<p>This is a collection of libraries and high-quality end-user scripts for bioinformatic analysis, including working with gene annotation, collecting data scores from a variety of modern file formats, and conversion between file formats. The Bio::ToolBox libraries provide a unified, abstracted interface to multiple common gene annotation formats and the collection of data from multiple data files. They rely on BioPerl SeqFeature libraries and related adaptors to access binary file formats including Bam, BigWig, BigBed, and USeq. The Bio::ToolBox package includes scripts for setting up databases of annotation, collecting annotated features, collecting genomic data relative to features, manipulating and analyzing data, and data format conversion.</p>
<p>More at http://cpansearch.perl.org/src/TJPARNELL/</p><p>Address of the bookmark: <a href="http://cpansearch.perl.org/src/TJPARNELL/" rel="nofollow">http://cpansearch.perl.org/src/TJPARNELL/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37509/vcftools-perform-common-tasks-with-vcf-files-such-as-file-validation-file-merging-intersecting-complements</guid>
	<pubDate>Tue, 07 Aug 2018 10:01:46 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37509/vcftools-perform-common-tasks-with-vcf-files-such-as-file-validation-file-merging-intersecting-complements</link>
	<title><![CDATA[VCFtools: perform common tasks with VCF files such as file validation, file merging, intersecting, complements]]></title>
	<description><![CDATA[<p>VCFtools contains a Perl API (<a href="http://vcftools.sourceforge.net/perl_module.html#Vcf.pm">Vcf.pm</a>) and a number of Perl scripts that can be used to perform common tasks with VCF files such as file validation, file merging, intersecting, complements, etc. The Perl tools support all versions of the VCF specification (3.2, 3.3, 4.0, 4.1 and 4.2), nevertheless, the users are encouraged to use the latest versions VCFv4.1 or VCFv4.2. The VCFtools in general have been used mainly with diploid data, but the Perl tools aim to support polyploid data as well. Run any of the Perl scripts with the&nbsp;<strong>--help</strong>&nbsp;switch to obtain more help.</p>
<p>Many of the&nbsp;<strong>Perl scripts require that the VCF files are compressed by&nbsp;<span>bgzip</span>&nbsp;and indexed by&nbsp;<span>tabix</span></strong>&nbsp;(both tools are part of the tabix package, available for&nbsp;<a href="https://sourceforge.net/projects/samtools/files/tabix/">download here</a>). The VCF files can be compressed and indexed using the following commands</p>
<p>bgzip my_file.vcf<br>tabix -p vcf my_file.vcf.gz</p>
<p>&nbsp;</p>
<p>http://vcftools.sourceforge.net/perl_module.html</p><p>Address of the bookmark: <a href="http://vcftools.sourceforge.net/perl_module.html" rel="nofollow">http://vcftools.sourceforge.net/perl_module.html</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/26559/microscope</guid>
	<pubDate>Fri, 04 Mar 2016 05:26:31 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/26559/microscope</link>
	<title><![CDATA[Microscope]]></title>
	<description><![CDATA[<p>Microscope Platform user documentation.</p>
<p>The MicroScope platform is available at this URL:</p>
<p><a href="https://www.genoscope.cns.fr/agc/microscope">https://www.genoscope.cns.fr/agc/microscope</a></p><p>Address of the bookmark: <a href="http://microscope.readthedocs.org/en/latest/index.html" rel="nofollow">http://microscope.readthedocs.org/en/latest/index.html</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42713/gggenomes-a-grammar-of-graphics-for-comparative-genomics</guid>
	<pubDate>Mon, 01 Feb 2021 14:47:32 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42713/gggenomes-a-grammar-of-graphics-for-comparative-genomics</link>
	<title><![CDATA[gggenomes: A grammar of graphics for comparative genomics]]></title>
	<description><![CDATA[<p><span>gggenomes is a versatile graphics package for comparative genomics. It extends the popular R visualization package</span><a href="https://ggplot2.tidyverse.org/">ggplot2</a><span>&nbsp;by adding dedicated plot functions for genes, syntenic regions, etc. and verbs to manipulate the plot to, for example, quickly zoom in into gene neighborhoods.</span></p><p>Address of the bookmark: <a href="https://github.com/thackl/gggenomes" rel="nofollow">https://github.com/thackl/gggenomes</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/428/five-unique-traits-of-effective-computational-biologist</guid>
	<pubDate>Thu, 11 Jul 2013 13:12:51 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/428/five-unique-traits-of-effective-computational-biologist</link>
	<title><![CDATA[Five unique traits of effective computational biologist]]></title>
	<description><![CDATA[<p>Bioinformatics research is driven by large set of software, scripts, and tools to analyse gigantic biological data. Being a great biological programmer or bioinformatician involves more than writing code that works. The biological programmers who rise to the top ranks of their profession are not only good programmer but also expert in biological stuff. Moreover, In order to be a good and effective biological programmer, you need to possess a combination of traits that allow your computational as well as biological skill, experience, and knowledge to produce working code. There are some technically skilled biological programmers who will never be effective because they lack the other important traits needed. Here are top five traits that are necessary to become a great biological programmer.</p><p><strong>1. Learn and get updated</strong></p><p>Some of the bad biological programmers only learn new technical or non-technical things when it&rsquo;s absolutely necessary. The good biological programmers learn new technical skills proactively. But great biological programmers not only learn new technical skills on their own but also learn non-technical skills, and have an open mind to sources of knowledge that others may shut out.</p><p>In other concrete term, the bad biological programmer learn Perl's regular expression when they started a project on comparative genomics; the good biological programmer learned it a year before because it looked interesting; and the great biological programmer also read about the BioPerl packages, genomics, DNA string, genomic theories, or some similar course of study so that they could understand the results and explain it biologically.</p><p><strong>2. Not a merely coder!!!</strong></p><p>I often encountered with biological programmer who call themself a hard-core computer programmer and avoid biology. I can almost guarantee that if you are one of them then you are not doing research but merely writing "dry" codes.</p><p>According to my supervisor most of the computational biologist, don't know what they are doing biologically. Even they struggle to explain their own programs output and results. Therefore, It is highly advisable to learn basic of biology which can assist you to explain the result and understand your discovery. Always remember you are a researcher not a coder.</p><p><strong>3. Be Social with biologist</strong></p><p>The computational biologist spends most of the time in from of computers, writing codes. They always think their job is to produce working codes, not technical research perfections. But, they are completely wrong. You should not forget that apart from your computational skills you also need some biologist, other than your supervisor, to explain and make you understand the complex biological mechanism.</p><p>I highly recommend your to interact with biotech researchers and learn how do they explain their one graph (which they generally produce after one year of work) biologically. Remember, the origin of your research project is complex biological phenomenon, which is more complex than that of your limited programming rules.</p><p><strong>4. Do not search, research for answers</strong></p><p>Researching for answers means more than typing several keywords into a search engine or posting a question at Stack Overflow or the BioStars forums. I have entered problems into search engines that generate no results, and every question I posted on Stack Overflow or the BioStars forums never got anything resembling an answer, yet I solved the issues and moved on. I&rsquo;m not a magician &mdash; I just know how to find answers or discover root causes.</p><p>Many problems are situational, and if you depend on search engines and forums, you can waste a lot of time going down a rabbit hole and possibly never getting a solution. Learn to perform root cause analysis, learn enough about the underlying system to look for other clues and solutions, and learn to take a long distance view of an issue before deep diving into it.</p><p><strong>5. Love and defend your research</strong></p><p>You cannot rise to the top in this research profession without loving your work. There are some very good &ldquo;it&rsquo;s just a job&rdquo; biological programmers (I&rsquo;ve been one at times), but if that is your outlook, you won&rsquo;t be willing to do whatever it takes to succeed. This idea gets a lot of folks in a huff, because they feel it is a personal insult. &ldquo;I&rsquo;m a good programmer, but I have other priorities and can&rsquo;t make work my life.&rdquo; I understand completely; I have other priorities too. As much as I hate to say it, when I am passionate about my work, I am willing (though not eager) to abandon my other priorities to finish the job. It is not an insult to say that if you aren&rsquo;t willing to pull out all the stops you can&rsquo;t be the best, it is a fact.</p><p>You must be passionate about more than programming &mdash; you must also be excited about your research, the tools and technology you are using, and so on. I have seen very good and even great biological programmers operating at mediocre levels because something was not a good fit, such as they hated the project or were using a technology they disliked. Therefore, like your research project and get excited about your discoveries. You have not only to discover but also defend your finding with scientific words.</p><p>Thanks to all of you for reading.</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/1737/perl-in-a-day</guid>
	<pubDate>Sat, 10 Aug 2013 21:14:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/1737/perl-in-a-day</link>
	<title><![CDATA[Perl in a day !!]]></title>
	<description><![CDATA[<p>This pdf based tutorial in good resource to understand the basic of Perl in a day</p><p><a href="http://ritg.med.harvard.edu/training/perl/RC_Perl_Intro.pdf">http://ritg.med.harvard.edu/training/perl/RC_Perl_Intro.pdf</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/view/2379</guid>
	<pubDate>Wed, 14 Aug 2013 15:43:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/view/2379</link>
	<title><![CDATA[Which Perl distribution should I choose for bioinformatics study : ActivePerl, Strawberry Perl, DWIM Perl, Citrus Perl ?]]></title>
	<description><![CDATA[<p>I'm new to bioinformatics and recently started learning Perl. I found several rival distributions available for Windows platform, which confuse me at the begining.</p><p>I google it and found that Strawberry comes with additional dev tools to compile CPAN modules if necessary. Whereas&nbsp;ActivePerl has a lot of prepackaged modules which are easier to install with PPM. In addition,&nbsp;DWIM Perl contains the standard Perl and a lot of extension and Citrus Perl is a binary distribution of Perl created for GUI application developers.&nbsp;</p><p>Now, I wonder what should I pick to get started?&nbsp;</p><p>Note: I am going to use BioPerl in near future.</p><p>http://dwimperl.com/</p><p>http://www.activestate.com/activeperl</p><p>http://www.citrusperl.com/</p><p>http://strawberryperl.com/</p>]]></description>
	<dc:creator>Manshi Raghubanshi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/5307/clean-the-fasta-file</guid>
	<pubDate>Thu, 03 Oct 2013 14:19:14 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/5307/clean-the-fasta-file</link>
	<title><![CDATA[Clean the FASTA file]]></title>
	<description><![CDATA[<p>Mostly FASTA file contain NNN characters, which can be replace by random A T G C character with this perl script. It also print the FASTA sequence name, N's counts, nucleotide count and percentage details at command prompt/standard output.</p><p>&nbsp;</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/5307" length="1408" type="text/x-perl" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>