<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/33841?offset=70</link>
	<atom:link href="https://bioinformaticsonline.com/related/33841?offset=70" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/44672/libraries-or-management-tools-for-high-throughput-sequencing-data</guid>
	<pubDate>Fri, 04 Oct 2024 02:45:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/44672/libraries-or-management-tools-for-high-throughput-sequencing-data</link>
	<title><![CDATA[Libraries or management tools for high throughput sequencing data]]></title>
	<description><![CDATA[<ul>
<li><a href="http://gatb.inria.fr/"><span>GATB</span></a>&nbsp;Library.&nbsp;The&nbsp;<span>Genome Analysis Toolbox with de-Bruijn graph.&nbsp;</span>A large part of tools developed by the GenScale team are based on this library.<br />These methods enable the analysis of data sets of any size on multi-core desktop computers, including very huge amount of reads data coming from any kind of organisms such as bacteria, plants, animals and even complex samples (<em>e.g.</em>&nbsp;metagenomes). Among them are (the full is available here:&nbsp;<a href="https://gatb.inria.fr/software/">https://gatb.inria.fr/software/</a>):</li>
<li><a href="https://github.com/morispi/LRez"><span>LRez</span></a>: C++ Library and toolkit for the barcode-based management and indexation of linked-read datasets.</li>
</ul><h2>Variant calling and/or genotyping</h2><ul>
<li><a href="https://gatb.inria.fr/software/discosnp/" title="DiscoSNP">DiscoSNP++ and&nbsp;discoSnpRAD</a>: Reference-free small variant discovery (SNPs and indels)</li>
<li><a href="https://gatb.inria.fr/software/mind-the-gap/" title="MindTheGap">MindTheGap</a>: Detection and assembly of large insertion variants</li>
<li><a href="https://gatb.inria.fr/software/takeabreak/" title="TakeABreak">TakeABreak</a>:&nbsp;reference-free inversion discovery tool</li>
<li><a href="https://github.com/llecompte/SVJedi">SVJedi</a>: Structural Variant genotyper with long read data</li>
<li><a href="https://github.com/SandraLouise/SVJedi-graph">SVJedi-graph</a>: Structural Variant genotyper with long read data using a variation graph</li>
</ul><h2>Sequence assembly</h2><ul>
<li><a href="https://github.com/cguyomar/MinYS">MinYS</a>: reference-guided genome assembly in metagenomics data</li>
<li><a href="https://github.com/anne-gcd/MTG-Link">MTG-link</a>: local assembly tool for linked-read data</li>
<li><a href="https://gatb.inria.fr/software/minia/" title="Minia">Minia</a>: De novo short read assembler</li>
<li><a href="https://gatb.inria.fr/de-novo-genome-assembly/">de-novo pipeline</a>:&nbsp;<em>de-novo</em>&nbsp;assembly pipeline (error correction / contigs / scaffolding) for genomes and meta-genomes</li>
<li><a href="https://gatb.inria.fr/software/mapsembler/" title="Mapsembler2">Mapsembler2</a>: Targeted assembly (not maintained)</li>
</ul><h2>Managing k-mers &amp; indexation</h2><ul>
<li><a href="https://github.com/lrobidou/findere">findere</a>:&nbsp;simple strategy for speeding up queries and for reducing false positive calls from any Approximate Membership Query data structure.
<ul>
<li><a href="https://github.com/lrobidou/fimpera">fimpera</a>&nbsp;extends findere adding the abundance information.</li>
</ul>
</li>
<li><a href="https://github.com/tlemane/kmtricks">kmtricks</a>:&nbsp;modular tool suite for counting kmers, and constructing Bloom filters or kmer matrices, for large collections of sequencing data.</li>
<li><a href="https://github.com/tlemane/kmindex">kmindex&nbsp;</a>is a tool for indexing and querying sequencing samples. It is built on top of kmtricks.</li>
<li><a href="https://github.com/pierrepeterlongo/back_to_sequences">back to sequences</a>: Find sequences (reads, unitigs, genes) related to a set of kmers in large datasets, in a matter of seconds.</li>
<li><a href="https://github.com/vicLeva/bqf">Backpack Quotient Filter</a>:&nbsp;k-mer indexing data structure with abundance</li>
<li><a href="http://github.com/GATB/rconnector">short read connector</a>:&nbsp;Detect similar reads from potentially large read set</li>
<li><a href="https://gatb.inria.fr/software/dsk/" title="DSK">DSK</a>:&nbsp;Count K-mer in sequences</li>
</ul><h2>Pangenome graph manipulation</h2><ul>
<li><a href="https://github.com/Tharos-ux/pancat">Pancat</a>: Pangenome Comparison and Analysis Toolkit</li>
<li><a href="https://pypi.org/project/gfagraphs/">GFAGraphs</a>: a Python library to handle pangenome graph files in GFA format.</li>
</ul><h2>Comparative metagenomics with k-mers</h2><ul>
<li><a href="https://github.com/GATB/simka">Simka and SimkaMin</a>:&nbsp;Comparative metagenomics for large-scale datasets</li>
<li><a href="https://team.inria.fr/genscale/high-throughput-sequence-analysis/compreads-metagenomic-data-analysis/">Comparead &amp; Commet</a>:&nbsp;comparison of metagenomic datasets</li>
</ul><h2>Species and bacterial strains identification</h2><ul>
<li><a href="https://github.com/gsiekaniec/ORI">ORI</a>: software using long nanopore reads to identify bacteria present in a sample at the strain level</li>
<li><a href="https://github.com/kevsilva/StrainFLAIR">StrainFLAIR</a>:&nbsp;STRAIN-level proFiLing using vArIation gRaph</li>
</ul><h2>General-purpose sequencing data manipulation</h2><ul>
<li><a href="https://team.inria.fr/genscale/ngs-software/gassst/">GASSST</a>:&nbsp;long read mapper</li>
<li><a href="https://gatb.inria.fr/software/leon/" title="Leon">Leon</a>: short read compressor (now included in GATB-core)</li>
<li><a href="https://gatb.inria.fr/software/bloocoo/" title="Bloocoo">Bloocoo</a>:&nbsp;short read corrector</li>
<li><a href="https://github.com/GATB/bcalm">BCALM</a>:&nbsp;Construct compacted de Bruijn graphs (unitigs)</li>
</ul><h2>&nbsp;Protein Structure</h2><ul>
<li><a href="https://team.inria.fr/genscale/protein-structure/a-purva-contact-map-overlap-solver/">A_Purva</a>:&nbsp;Contact Map Overlap solver</li>
<li><a href="https://team.inria.fr/genscale/protein-structure/md-jeep-distance-geomtry-solver/">MD-Jeep</a>:&nbsp;Distance Geometry solver</li>
<li><a href="https://team.inria.fr/genscale/csa-comparative-structural-alignment/">CSA</a>:&nbsp;Comparative Structural Alignment</li>
</ul><h2>Workflow</h2><ul>
<li><a href="https://team.inria.fr/genscale/workflows/slicee/">SLICEE</a>:&nbsp;parallel execution of bioinformatics workflows</li>
</ul><h3>Comparative Genomics</h3><ul>
<li><a href="https://team.inria.fr/genscale/comparative-genomics/cassis/">CASSIS</a>:&nbsp;detection of rearrangement breakpoints</li>
<li><a href="https://team.inria.fr/genscale/high-throughput-sequence-analysis/plast-intensive-sequence-comparison/">PLAST</a>:&nbsp;intensive bank-to-bank sequence comparison</li>
<li><a href="https://github.com/stephanierobin/DrjBreakpointFinder">DRJBreakpointFinder</a>: detection and precise localization of excision sites in proviral segments</li>
</ul>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/428/five-unique-traits-of-effective-computational-biologist</guid>
	<pubDate>Thu, 11 Jul 2013 13:12:51 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/428/five-unique-traits-of-effective-computational-biologist</link>
	<title><![CDATA[Five unique traits of effective computational biologist]]></title>
	<description><![CDATA[<p>Bioinformatics research is driven by large set of software, scripts, and tools to analyse gigantic biological data. Being a great biological programmer or bioinformatician involves more than writing code that works. The biological programmers who rise to the top ranks of their profession are not only good programmer but also expert in biological stuff. Moreover, In order to be a good and effective biological programmer, you need to possess a combination of traits that allow your computational as well as biological skill, experience, and knowledge to produce working code. There are some technically skilled biological programmers who will never be effective because they lack the other important traits needed. Here are top five traits that are necessary to become a great biological programmer.</p><p><strong>1. Learn and get updated</strong></p><p>Some of the bad biological programmers only learn new technical or non-technical things when it&rsquo;s absolutely necessary. The good biological programmers learn new technical skills proactively. But great biological programmers not only learn new technical skills on their own but also learn non-technical skills, and have an open mind to sources of knowledge that others may shut out.</p><p>In other concrete term, the bad biological programmer learn Perl's regular expression when they started a project on comparative genomics; the good biological programmer learned it a year before because it looked interesting; and the great biological programmer also read about the BioPerl packages, genomics, DNA string, genomic theories, or some similar course of study so that they could understand the results and explain it biologically.</p><p><strong>2. Not a merely coder!!!</strong></p><p>I often encountered with biological programmer who call themself a hard-core computer programmer and avoid biology. I can almost guarantee that if you are one of them then you are not doing research but merely writing "dry" codes.</p><p>According to my supervisor most of the computational biologist, don't know what they are doing biologically. Even they struggle to explain their own programs output and results. Therefore, It is highly advisable to learn basic of biology which can assist you to explain the result and understand your discovery. Always remember you are a researcher not a coder.</p><p><strong>3. Be Social with biologist</strong></p><p>The computational biologist spends most of the time in from of computers, writing codes. They always think their job is to produce working codes, not technical research perfections. But, they are completely wrong. You should not forget that apart from your computational skills you also need some biologist, other than your supervisor, to explain and make you understand the complex biological mechanism.</p><p>I highly recommend your to interact with biotech researchers and learn how do they explain their one graph (which they generally produce after one year of work) biologically. Remember, the origin of your research project is complex biological phenomenon, which is more complex than that of your limited programming rules.</p><p><strong>4. Do not search, research for answers</strong></p><p>Researching for answers means more than typing several keywords into a search engine or posting a question at Stack Overflow or the BioStars forums. I have entered problems into search engines that generate no results, and every question I posted on Stack Overflow or the BioStars forums never got anything resembling an answer, yet I solved the issues and moved on. I&rsquo;m not a magician &mdash; I just know how to find answers or discover root causes.</p><p>Many problems are situational, and if you depend on search engines and forums, you can waste a lot of time going down a rabbit hole and possibly never getting a solution. Learn to perform root cause analysis, learn enough about the underlying system to look for other clues and solutions, and learn to take a long distance view of an issue before deep diving into it.</p><p><strong>5. Love and defend your research</strong></p><p>You cannot rise to the top in this research profession without loving your work. There are some very good &ldquo;it&rsquo;s just a job&rdquo; biological programmers (I&rsquo;ve been one at times), but if that is your outlook, you won&rsquo;t be willing to do whatever it takes to succeed. This idea gets a lot of folks in a huff, because they feel it is a personal insult. &ldquo;I&rsquo;m a good programmer, but I have other priorities and can&rsquo;t make work my life.&rdquo; I understand completely; I have other priorities too. As much as I hate to say it, when I am passionate about my work, I am willing (though not eager) to abandon my other priorities to finish the job. It is not an insult to say that if you aren&rsquo;t willing to pull out all the stops you can&rsquo;t be the best, it is a fact.</p><p>You must be passionate about more than programming &mdash; you must also be excited about your research, the tools and technology you are using, and so on. I have seen very good and even great biological programmers operating at mediocre levels because something was not a good fit, such as they hated the project or were using a technology they disliked. Therefore, like your research project and get excited about your discoveries. You have not only to discover but also defend your finding with scientific words.</p><p>Thanks to all of you for reading.</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/1737/perl-in-a-day</guid>
	<pubDate>Sat, 10 Aug 2013 21:14:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/1737/perl-in-a-day</link>
	<title><![CDATA[Perl in a day !!]]></title>
	<description><![CDATA[<p>This pdf based tutorial in good resource to understand the basic of Perl in a day</p><p><a href="http://ritg.med.harvard.edu/training/perl/RC_Perl_Intro.pdf">http://ritg.med.harvard.edu/training/perl/RC_Perl_Intro.pdf</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/view/2379</guid>
	<pubDate>Wed, 14 Aug 2013 15:43:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/view/2379</link>
	<title><![CDATA[Which Perl distribution should I choose for bioinformatics study : ActivePerl, Strawberry Perl, DWIM Perl, Citrus Perl ?]]></title>
	<description><![CDATA[<p>I'm new to bioinformatics and recently started learning Perl. I found several rival distributions available for Windows platform, which confuse me at the begining.</p><p>I google it and found that Strawberry comes with additional dev tools to compile CPAN modules if necessary. Whereas&nbsp;ActivePerl has a lot of prepackaged modules which are easier to install with PPM. In addition,&nbsp;DWIM Perl contains the standard Perl and a lot of extension and Citrus Perl is a binary distribution of Perl created for GUI application developers.&nbsp;</p><p>Now, I wonder what should I pick to get started?&nbsp;</p><p>Note: I am going to use BioPerl in near future.</p><p>http://dwimperl.com/</p><p>http://www.activestate.com/activeperl</p><p>http://www.citrusperl.com/</p><p>http://strawberryperl.com/</p>]]></description>
	<dc:creator>Manshi Raghubanshi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/5307/clean-the-fasta-file</guid>
	<pubDate>Thu, 03 Oct 2013 14:19:14 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/5307/clean-the-fasta-file</link>
	<title><![CDATA[Clean the FASTA file]]></title>
	<description><![CDATA[<p>Mostly FASTA file contain NNN characters, which can be replace by random A T G C character with this perl script. It also print the FASTA sequence name, N's counts, nucleotide count and percentage details at command prompt/standard output.</p><p>&nbsp;</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/5307" length="1408" type="text/x-perl" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/26627/scientist-computational-genomics-two-positions</guid>
  <pubDate>Sat, 12 Mar 2016 18:07:56 -0600</pubDate>
  <link></link>
  <title><![CDATA[Scientist - Computational Genomics (Two Positions)]]></title>
  <description><![CDATA[
<p>ICRISAT is a non-profit, non-political organization that conducts agricultural research for development in Asia and sub-Saharan Africa with a wide array of partners throughout the world. Covering 6.5 million square kilometers of land in 55 countries, the semi-arid tropics is home to over 2 billion people, with 650 million of these being the poorest of the poor. ICRISAT and its partners help empower those living in the semi-arid tropics, especially smallholder farmers, to overcome poverty, hunger, malnutrition and a degraded environment through more efficient and profitable agriculture.</p>

<p>ICRISAT is headquartered in Patancheru near Hyderabad, India, with two regional hubs and five country offices in sub-Saharan Africa. ICRISAT, established in 1972, is a member of the CGIAR Consortium. For more details, see www.icrisat.org.</p>

<p>Responsibilities:Design efficient SQL queries for pulling large sequencing projects.<br />Serve as a technical adviser to the project leadership and provide computational perspective on product design and deliverability.<br />Develop and oversee a rapid and incremental software development and release schedule.<br />Design the software architecture, oversee the implementation and evolution of the design on appropriate hardware platforms.<br />Working collaboratively in a team environment to design, code, test, debug, and document programs for an integrated genomic analysis pipeline in a rapid and incremental software development and release schedule.<br />Supervise and review code development and ensure that software products meet project objectives in terms of functionality, scalability, robustness and user experience.<br />Implement and oversee the QA/QC practices to ensure the development team is adhering to quality standards.<br />Work closely with the application specialist to integrate feedbacks from teams in each CGIAR center into software customization and improvement.<br />Assist in training of breeders in the CGIAR centers to use software developed.<br /> Personal Profile:</p>

<p>The applicant should have:</p>

<p>Understanding of genomics data and advanced knowledge of Java, and C/C++ as the programming languages and any of the scripting language like perl and/or Python, SQL<br />High Performance Computing, data architecture, database platforms and QA/QC practices in software engineering.<br />She/he should have solid experience in software development projects, preferably as a senior programmer or in the software project management role, and in projects involving big data.<br />Excellent communication skills are needed to work in this multi-disciplinary, multi-location and multi-cultural team.<br />Ability to mentor colleagues in quality software development practices is desired.<br />Educational Qualification : Ph. D or Masters Degree in Computational Biology / Computational Genomics or Equivalent with Research Experience in Mentioned Areas.</p>

<p>More at http://www.icrisat.org/careers/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/31502/perl-way-to-check-if-an-array-contains-values</guid>
	<pubDate>Thu, 09 Mar 2017 17:17:01 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/31502/perl-way-to-check-if-an-array-contains-values</link>
	<title><![CDATA[Perl way to check if an array contains values]]></title>
	<description><![CDATA[<p><span>Perl is always is known for their flexibility (<span>There is more than one way to do it</span>). </span></p><p><span>Followings are the quick way to check if a value exist in an array.</span></p><blockquote><p><span>do_something </span><span>if</span><span> </span><span>'flour'</span><span> </span><span>~~</span><span> </span><span>@ingredients</span><span> &nbsp; </span><span># ~~ operand. &nbsp; BEWARE: it is broken.</span><span><br /><br />do_something </span><span>if</span><span> grep </span><span>{</span><span>$_ eq </span><span>'flour'</span><span>}</span><span> </span><span>@ingredients</span><span> </span><span># grep (slower than 'any')</span><span><br /><br />do_something </span><span>if</span><span> any </span><span>{</span><span>$_ eq </span><span>'flour'</span><span>}</span><span> </span><span>@ingredients</span><span> </span><span># List::MoreUtils / Util::Any</span><span><br /><br />do_something </span><span>if</span><span> any</span><span>(</span><span>@ingredients</span><span>)</span><span> eq </span><span>'flour'</span><span> &nbsp; </span><span># use syntax 'junction';</span><span><br /><br />do_something </span><span>if</span><span> </span><span>@ingredients</span><span>-&gt;</span><span>contains</span><span>(</span><span>'flour'</span><span>)</span><span> &nbsp; </span><span># added with autobox</span></p></blockquote>]]></description>
	<dc:creator>Shruti Paniwala</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/33693/circleator</guid>
	<pubDate>Sun, 25 Jun 2017 18:04:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/33693/circleator</link>
	<title><![CDATA[Circleator]]></title>
	<description><![CDATA[<p>The Charm City Circleator--or Circleator for short--is a Perl-based visualization tool developed at the&nbsp;<a href="http://igs.umaryland.edu/">Institute for Genome Sciences</a>&nbsp;in the University of Maryland's School of Medicine. Circleator produces circular plots of genome-associated data, like this one:</p>
<p><a href="https://camo.githubusercontent.com/0b414f050a7dcb672386932ee0cd83e5f42d2271/687474703a2f2f6a6f6e617468616e63726162747265652e6769746875622e696f2f436972636c6561746f722f696d616765732f43503030323732352d322d3432302e706e673f7261773d74727565" target="_blank"><img src="https://camo.githubusercontent.com/0b414f050a7dcb672386932ee0cd83e5f42d2271/687474703a2f2f6a6f6e617468616e63726162747265652e6769746875622e696f2f436972636c6561746f722f696d616765732f43503030323732352d322d3432302e706e673f7261773d74727565" alt="Sample Circleator image" title="Sample Circleator Image" style="border: 0px;"></a></p>
<p>Common uses of the tool include:</p>
<ul>
<li>Displaying the sequence and/or genes in a&nbsp;<a href="http://www.ncbi.nlm.nih.gov/genbank/">GenBank</a>&nbsp;flat file.</li>
<li>Highlighting differences and/or similarities in gene content between related organisms.</li>
<li>Comparing SNPs and indels between closely-related strains or serovars.</li>
<li>Comparing gene expression values across multiple samples or timepoints.</li>
<li>Visualizing coverage plots of RNA-Seq read alignments.</li>
</ul>
<h3><a href="https://github.com/jonathancrabtree/Circleator#key-features"></a>Key Features</h3>
<p>Circleator...</p>
<ul>
<li>Builds on&nbsp;<a href="http://www.bioperl.org/">BioPerl</a>&nbsp;and the input file formats that it supports, including:
<ul>
<li><a href="http://www.ncbi.nlm.nih.gov/genbank/">GenBank</a>&nbsp;flat files, GFF, FASTA</li>
</ul>
</li>
<li>Accepts a number of other commonly-used datatypes and file formats:
<ul>
<li><a href="http://bsr.igs.umaryland.edu/">BSR</a>&nbsp;and&nbsp;<a href="http://tandem.bu.edu/trf/trf.html">TRF</a>&nbsp;output,&nbsp;<a href="http://samtools.sourceforge.net/">SAM/BAM</a>&nbsp;files,&nbsp;<a href="http://vcftools.sourceforge.net/">VCF</a>-encoded SNPs, tab-delimited files</li>
</ul>
</li>
<li>Outputs publication-ready figures in the&nbsp;<a href="http://www.w3.org/Graphics/SVG/">SVG</a>&nbsp;(Scalable Vector Graphics) format.</li>
<li>Requires only a single configuration file whose layout mirrors that of the figure itself.
<ul>
<li>Predefined configuration files and "track" types are supplied for common datasets.</li>
<li>Advanced features allow limited analyses to be performed as a figure is drawn.</li>
</ul>
</li>
<li>Includes an extensive set of regression tests.</li>
<li>Offers a prototype web-based GUI (under the "Ringmaster" project.)</li>
</ul>
<p>https://github.com/jonathancrabtree/Circleator</p><p>Address of the bookmark: <a href="https://github.com/jonathancrabtree/Circleator" rel="nofollow">https://github.com/jonathancrabtree/Circleator</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>