Variant calling and/or genotyping

• DiscoSNP++ and discoSnpRAD: Reference-free small variant discovery (SNPs and indels)
• MindTheGap: Detection and assembly of large insertion variants
• TakeABreak: reference-free inversion discovery tool
• SVJedi: Structural Variant genotyper with long read data
• SVJedi-graph: Structural Variant genotyper with long read data using a variation graph

Sequence assembly

• MinYS: reference-guided genome assembly in metagenomics data
• MTG-link: local assembly tool for linked-read data
• Minia: De novo short read assembler
• de-novo pipeline: de-novo assembly pipeline (error correction / contigs / scaffolding) for genomes and meta-genomes
• Mapsembler2: Targeted assembly (not maintained)

Managing k-mers & indexation

• findere: simple strategy for speeding up queries and for reducing false positive calls from any Approximate Membership Query data structure.
  • fimpera extends findere adding the abundance information.
• kmtricks: modular tool suite for counting kmers, and constructing Bloom filters or kmer matrices, for large collections of sequencing data.
• kmindex is a tool for indexing and querying sequencing samples. It is built on top of kmtricks.
• back to sequences: Find sequences (reads, unitigs, genes) related to a set of kmers in large datasets, in a matter of seconds.
• Backpack Quotient Filter: k-mer indexing data structure with abundance
• short read connector: Detect similar reads from potentially large read set
• DSK: Count K-mer in sequences

Pangenome graph manipulation

• Pancat: Pangenome Comparison and Analysis Toolkit
• GFAGraphs: a Python library to handle pangenome graph files in GFA format.

Comparative metagenomics with k-mers

• Simka and SimkaMin: Comparative metagenomics for large-scale datasets
• Comparead & Commet: comparison of metagenomic datasets

Species and bacterial strains identification

• ORI: software using long nanopore reads to identify bacteria present in a sample at the strain level
• StrainFLAIR: STRAIN-level proFiLing using vArIation gRaph

General-purpose sequencing data manipulation

• GASSST: long read mapper
• Leon: short read compressor (now included in GATB-core)
• Bloocoo: short read corrector
• BCALM: Construct compacted de Bruijn graphs (unitigs)

 Protein Structure

• A_Purva: Contact Map Overlap solver
• MD-Jeep: Distance Geometry solver
• CSA: Comparative Structural Alignment

Workflow

• SLICEE: parallel execution of bioinformatics workflows

Comparative Genomics

• CASSIS: detection of rearrangement breakpoints
• PLAST: intensive bank-to-bank sequence comparison
• DRJBreakpointFinder: detection and precise localization of excision sites in proviral segments

1. Learn and get updated

Some of the bad biological programmers only learn new technical or non-technical things when it’s absolutely necessary. The good biological programmers learn new technical skills proactively. But great biological programmers not only learn new technical skills on their own but also learn non-technical skills, and have an open mind to sources of knowledge that others may shut out.

In other concrete term, the bad biological programmer learn Perl's regular expression when they started a project on comparative genomics; the good biological programmer learned it a year before because it looked interesting; and the great biological programmer also read about the BioPerl packages, genomics, DNA string, genomic theories, or some similar course of study so that they could understand the results and explain it biologically.

2. Not a merely coder!!!

I often encountered with biological programmer who call themself a hard-core computer programmer and avoid biology. I can almost guarantee that if you are one of them then you are not doing research but merely writing "dry" codes.

According to my supervisor most of the computational biologist, don't know what they are doing biologically. Even they struggle to explain their own programs output and results. Therefore, It is highly advisable to learn basic of biology which can assist you to explain the result and understand your discovery. Always remember you are a researcher not a coder.

3. Be Social with biologist

The computational biologist spends most of the time in from of computers, writing codes. They always think their job is to produce working codes, not technical research perfections. But, they are completely wrong. You should not forget that apart from your computational skills you also need some biologist, other than your supervisor, to explain and make you understand the complex biological mechanism.

I highly recommend your to interact with biotech researchers and learn how do they explain their one graph (which they generally produce after one year of work) biologically. Remember, the origin of your research project is complex biological phenomenon, which is more complex than that of your limited programming rules.

4. Do not search, research for answers

Researching for answers means more than typing several keywords into a search engine or posting a question at Stack Overflow or the BioStars forums. I have entered problems into search engines that generate no results, and every question I posted on Stack Overflow or the BioStars forums never got anything resembling an answer, yet I solved the issues and moved on. I’m not a magician — I just know how to find answers or discover root causes.

Many problems are situational, and if you depend on search engines and forums, you can waste a lot of time going down a rabbit hole and possibly never getting a solution. Learn to perform root cause analysis, learn enough about the underlying system to look for other clues and solutions, and learn to take a long distance view of an issue before deep diving into it.

5. Love and defend your research

You cannot rise to the top in this research profession without loving your work. There are some very good “it’s just a job” biological programmers (I’ve been one at times), but if that is your outlook, you won’t be willing to do whatever it takes to succeed. This idea gets a lot of folks in a huff, because they feel it is a personal insult. “I’m a good programmer, but I have other priorities and can’t make work my life.” I understand completely; I have other priorities too. As much as I hate to say it, when I am passionate about my work, I am willing (though not eager) to abandon my other priorities to finish the job. It is not an insult to say that if you aren’t willing to pull out all the stops you can’t be the best, it is a fact.

You must be passionate about more than programming — you must also be excited about your research, the tools and technology you are using, and so on. I have seen very good and even great biological programmers operating at mediocre levels because something was not a good fit, such as they hated the project or were using a technology they disliked. Therefore, like your research project and get excited about your discoveries. You have not only to discover but also defend your finding with scientific words.

Thanks to all of you for reading.

http://ritg.med.harvard.edu/training/perl/RC_Perl_Intro.pdf

I google it and found that Strawberry comes with additional dev tools to compile CPAN modules if necessary. Whereas ActivePerl has a lot of prepackaged modules which are easier to install with PPM. In addition, DWIM Perl contains the standard Perl and a lot of extension and Citrus Perl is a binary distribution of Perl created for GUI application developers. 

Now, I wonder what should I pick to get started? 

Note: I am going to use BioPerl in near future.

http://dwimperl.com/

http://www.activestate.com/activeperl

http://www.citrusperl.com/

http://strawberryperl.com/

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

ICRISAT is headquartered in Patancheru near Hyderabad, India, with two regional hubs and five country offices in sub-Saharan Africa. ICRISAT, established in 1972, is a member of the CGIAR Consortium. For more details, see www.icrisat.org.

Responsibilities:Design efficient SQL queries for pulling large sequencing projects.
Serve as a technical adviser to the project leadership and provide computational perspective on product design and deliverability.
Develop and oversee a rapid and incremental software development and release schedule.
Design the software architecture, oversee the implementation and evolution of the design on appropriate hardware platforms.
Working collaboratively in a team environment to design, code, test, debug, and document programs for an integrated genomic analysis pipeline in a rapid and incremental software development and release schedule.
Supervise and review code development and ensure that software products meet project objectives in terms of functionality, scalability, robustness and user experience.
Implement and oversee the QA/QC practices to ensure the development team is adhering to quality standards.
Work closely with the application specialist to integrate feedbacks from teams in each CGIAR center into software customization and improvement.
Assist in training of breeders in the CGIAR centers to use software developed.
Personal Profile:

The applicant should have:

Understanding of genomics data and advanced knowledge of Java, and C/C++ as the programming languages and any of the scripting language like perl and/or Python, SQL
High Performance Computing, data architecture, database platforms and QA/QC practices in software engineering.
She/he should have solid experience in software development projects, preferably as a senior programmer or in the software project management role, and in projects involving big data.
Excellent communication skills are needed to work in this multi-disciplinary, multi-location and multi-cultural team.
Ability to mentor colleagues in quality software development practices is desired.
Educational Qualification : Ph. D or Masters Degree in Computational Biology / Computational Genomics or Equivalent with Research Experience in Mentioned Areas.

More at http://www.icrisat.org/careers/

Followings are the quick way to check if a value exist in an array.

do_something if 'flour' ~~ @ingredients   # ~~ operand.   BEWARE: it is broken.

do_something if grep {$_ eq 'flour'} @ingredients # grep (slower than 'any')

do_something if any {$_ eq 'flour'} @ingredients # List::MoreUtils / Util::Any

do_something if any(@ingredients) eq 'flour'   # use syntax 'junction';

do_something if @ingredients->contains('flour')   # added with autobox

Common uses of the tool include:

• Displaying the sequence and/or genes in a GenBank flat file.
• Highlighting differences and/or similarities in gene content between related organisms.
• Comparing SNPs and indels between closely-related strains or serovars.
• Comparing gene expression values across multiple samples or timepoints.
• Visualizing coverage plots of RNA-Seq read alignments.

Key Features

Circleator...

• Builds on BioPerl and the input file formats that it supports, including:
  • GenBank flat files, GFF, FASTA
• Accepts a number of other commonly-used datatypes and file formats:
  • BSR and TRF output, SAM/BAM files, VCF-encoded SNPs, tab-delimited files
• Outputs publication-ready figures in the SVG (Scalable Vector Graphics) format.
• Requires only a single configuration file whose layout mirrors that of the figure itself.
  • Predefined configuration files and "track" types are supplied for common datasets.
  • Advanced features allow limited analyses to be performed as a figure is drawn.
• Includes an extensive set of regression tests.
• Offers a prototype web-based GUI (under the "Ringmaster" project.)

https://github.com/jonathancrabtree/Circleator

Address of the bookmark: https://github.com/jonathancrabtree/Circleator