<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/33842?offset=80</link>
	<atom:link href="https://bioinformaticsonline.com/related/33842?offset=80" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35119/frontend-perl-web-framework-documentation-andrej-sali-lab</guid>
	<pubDate>Mon, 08 Jan 2018 22:32:03 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35119/frontend-perl-web-framework-documentation-andrej-sali-lab</link>
	<title><![CDATA[Frontend: Perl Web framework documentation - Andrej Sali Lab]]></title>
	<description><![CDATA[<p><span>The frontend is a set of Perl classes that displays the web interface, allowing a user to upload their input files, start a job, display a list of all jobs in the system, and get back job results. The main&nbsp;</span><a href="https://saliweb.readthedocs.io/en/latest/modules/frontend.html#saliwebfrontend" title="saliwebfrontend"><code><span>saliwebfrontend</span></code></a><span>&nbsp;class must be subclassed for each web service. This class is then used to display the web pages using a set of CGI scripts that are set up automatically by the build system.</span></p><p>Address of the bookmark: <a href="https://saliweb.readthedocs.io/en/latest/frontend.html" rel="nofollow">https://saliweb.readthedocs.io/en/latest/frontend.html</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38067/metaplotr-a-perlr-pipeline-for-plotting-metagenes-of-nucleotide-modifications-and-other-transcriptomic-sites</guid>
	<pubDate>Mon, 05 Nov 2018 08:12:45 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38067/metaplotr-a-perlr-pipeline-for-plotting-metagenes-of-nucleotide-modifications-and-other-transcriptomic-sites</link>
	<title><![CDATA[MetaPlotR: a Perl/R pipeline for plotting metagenes of nucleotide modifications and other transcriptomic sites]]></title>
	<description><![CDATA[<p><span>An increasing number of studies are mapping protein binding and nucleotide modifications sites throughout the transcriptome. Often, these sites cluster in certain regions of the transcript, giving clues to their function. Hence, it is informative to summarize where in the transcript these sites occur. A metagene is a simple and effective tool for visualizing the distribution of sites along a simplified transcript model. In this work, we introduce MetaPlotR, a Perl/R pipeline for creating metagene plots.</span></p><p>Address of the bookmark: <a href="https://github.com/olarerin/metaPlotR" rel="nofollow">https://github.com/olarerin/metaPlotR</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/41043/postdoctoral-scientist-genome-analytics-genome-bioinformatics-mf</guid>
  <pubDate>Sun, 16 Feb 2020 02:57:40 -0600</pubDate>
  <link></link>
  <title><![CDATA[Postdoctoral scientist genome analytics/ genome bioinformatics (m/f/*)]]></title>
  <description><![CDATA[
<p>https://www.uksh.de/jobs/Stellenangebote-nr-20190570-p-8.html<br />Your profile:<br />Degree in bioinformatics, biostatistics, or equivalent<br />Experience in the processing and analysis of large-scale genomics data using compute clusters / high-performance computing<br />Strong competence in working in Unix/Linux environments (shell)<br />Strong programming skills (in particular: Python, R, Perl)<br />Experience with using git and snakemake<br />Fluent English language skills, both spoken and written<br />Strong communication skills and motivation to work in a young, interdisciplinary, dynamic team</p>

<p>Additional Information:</p>

<p>If you have any questions about scientific aspects of this position, please contact Prof. Lars Bertram, head of LIGA (lars.bertram@uni-luebeck.de).</p>

<p>Please contact Ms. Anna Wolbert for further questions about administrative details (recruiting@uksh.de).</p>

<p>Weitere Informationen erhalten Sie auch unter www.uksh.de/karriere.</p>

<p>Wir freuen uns auf Ihre Bewerbung bis zum 15.03.2020 unter Angabe unserer Ausschreibungsnummer 20190570.119.CL.</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/33866/perlbrew-admin-free-perl-installation-management-tool</guid>
	<pubDate>Wed, 12 Jul 2017 03:53:08 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/33866/perlbrew-admin-free-perl-installation-management-tool</link>
	<title><![CDATA[Perlbrew: admin-free perl installation management tool.]]></title>
	<description><![CDATA[<p>perlbrew is an admin-free perl installation management tool. The latest version is 0.79, read the release note:&nbsp;<a href="https://perlbrew.pl/Release-0.79.html">Release 0.79</a>.&nbsp;</p>
<p>Copy &amp; Paste this line into your terminal:</p>
<pre><code>\curl -L https://install.perlbrew.pl | bash
</code></pre>
<p>Or, if your system does not have curl but something else:</p>
<pre><code># Linux
\wget -O - https://install.perlbrew.pl | bash

# FreeBSD
\fetch -o- https://install.perlbrew.pl | sh
</code></pre>
<p>If you prefer to install with cpan, there are two steps:</p>
<pre><code>sudo cpan App::perlbrew
perlbrew init
</code></pre>
<p>If it is installed with cpan, the perlbrew executable should be installed as&nbsp;<code>/usr/bin/perlbrew</code>&nbsp;or&nbsp;<code>/usr/local/bin/perlbrew</code>. For all users who want to use perlbrew, a prior&nbsp;<code>perlbrew init</code>&nbsp;needs to be executed.</p>
<p>The default perlbrew root directory is&nbsp;<code>~/perl5/perlbrew</code>, which can be changed by setting&nbsp;<code>PERLBREW_ROOT</code>environment variable before the installation and initialization. For more advanced installation process, please read&nbsp;<a href="http://metacpan.org/module/App::perlbrew">the perlbrew document</a>.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://perlbrew.pl/" rel="nofollow">https://perlbrew.pl/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39913/twinblast-when-two-is-better-than-one</guid>
	<pubDate>Sat, 07 Sep 2019 08:50:08 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39913/twinblast-when-two-is-better-than-one</link>
	<title><![CDATA[TwinBLAST: When Two Is Better than One]]></title>
	<description><![CDATA[<p>TwinBLAST is a web-based tool for viewing 2 BLAST reports simultaneouslyside-by-side. It uses ExtJS (www.sencha.com/products/extjs/) to provide 2independently scrollable panels. BioPerl (www.bioperl.org) is used to indexraw BLAST reports and Bio::Graphics is used to draw pictograms of the BLASThits.</p>
<p><a href="https://github.com/IGS/twinblast">https://github.com/IGS/twinblast</a></p>
<p><a href="https://mra.asm.org/content/8/35/e00842-19">https://mra.asm.org/content/8/35/e00842-19</a></p><p>Address of the bookmark: <a href="https://github.com/IGS/twinblast" rel="nofollow">https://github.com/IGS/twinblast</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/5254/mike-ritchie-lab</guid>
  <pubDate>Wed, 02 Oct 2013 15:25:45 -0500</pubDate>
  <link></link>
  <title><![CDATA[Mike Ritchie Lab]]></title>
  <description><![CDATA[
<p>Mike Ritchie Lab primary research focus is the detection of susceptibility genes for common diseases such as cancer, diabetes, hypertension, and cardiovascular disease, among others. The approaches will involve the development and application of new statistical methods with a focus on the detection of gene-gene interactions associated with human disease.</p>

<p>Gene expression and protein expression patterns between normal and non-normal tissues is a growing area of research that may lead to the identification of candidate genes for understanding the etiology of common, complex diseases. </p>

<p>Lab homepage @ http://ritchielab.psu.edu/ritchielab/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/11457/commercial-and-public-next-gen-seq-ngs-software</guid>
	<pubDate>Tue, 03 Jun 2014 20:45:11 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/11457/commercial-and-public-next-gen-seq-ngs-software</link>
	<title><![CDATA[Commercial and public next-gen-seq (NGS) software]]></title>
	<description><![CDATA[<p><strong>Integrated solutions</strong><br /> <a href="http://www.clcbio.com/index.php?id=1240" target="_blank">CLCbio Genomics Workbench</a> - <em>de novo</em> and reference assembly of Sanger, Roche FLX, Illumina, Helicos, and SOLiD data. Commercial next-gen-seq software that extends the CLCbio Main Workbench software. Includes SNP detection, CHiP-seq, browser and other features. Commercial. Windows, Mac OS X and Linux.<br /><a href="http://g2.trac.bx.psu.edu/" target="_blank">Galaxy</a> - Galaxy = interactive and reproducible genomics. A job webportal.<br /> <a href="http://www.genomatix.de/products/index.html" target="_blank">Genomatix</a> - Integrated Solutions for Next Generation Sequencing data analysis.<br /> <a href="http://www.jmp.com/software/genomics/" target="_blank">JMP Genomics</a> - Next gen visualization and statistics tool from SAS. They are <a href="http://www.marketwatch.com/news/story/JMPR-Genomics-NCGR-Partnership-Foster/story.aspx?guid=%7B7AC9DE36-B6AA-4EDE-9CD5-633B29FE6154%7D" target="_blank">working with NCGR</a> to refine this tool and produce others.<br /> <a href="http://softgenetics.com/NextGENe.html" target="_blank">NextGENe</a> - <em>de novo</em> and reference assembly of Illumina, SOLiD and Roche FLX data. Uses a novel Condensation Assembly Tool approach where reads are joined via "anchors" into mini-contigs before assembly. Includes SNP detection, CHiP-seq, browser and other features. Commercial. Win or MacOS.<br /><a href="http://www.partek.com" target="_blank" title="Partek Incorporated">Partek</a>&nbsp;<span>- Commercial software for NGS, microarray, and qPCR data analysis. Streamlined analysis workflows for: ChIP-Seq, RNA-Seq, DNA-Seq, DNA Methylation, Gene Expression, Exon, miRNA Expression, Copy Number, Allele-Specific Copy Number, LOH, Association, Trio Analysis, and Tiling. Supports all commercial sequencing and microarray technologies.&nbsp;</span><br /> <a href="http://www.dnastar.com/products/SMGA.php" target="_blank">SeqMan Genome Analyser</a> - Software for Next Generation sequence assembly of Illumina, Roche FLX and Sanger data integrating with Lasergene Sequence Analysis software for additional analysis and visualization capabilities. Can use a hybrid templated/de novo approach. Commercial. Win or Mac OS X.<br /><a href="http://1001genomes.org/downloads/shore.html" target="_blank">SHORE</a> - SHORE, for Short Read, is a mapping and analysis pipeline for short DNA sequences produced on a Illumina Genome Analyzer. A suite created by the 1001 Genomes project. Source for POSIX.<br /> <a href="http://www.realtimegenomics.com/" target="_blank">SlimSearch</a> - Fledgling commercial product.<br />Synamatix has SXOligoSearch (<a href="http://synasite.mgrc.com.my:8080/sxog/NewSXOligoSearch.php" target="_blank">http://synasite.mgrc.com.my:8080/sxo...ligoSearch.php</a>)<br />The SWIFT suit is a software collection for fast index-based sequence comparison. It contains the following programs: SWIFT &mdash; fast local alignment search, guaranteeing to find epsilon-matches between two sequences; SWIFT BALSAM &mdash; a very fast program to find semiglobal non-gapped alignments based on k-mer seeds. <a href="http://bibiserv.techfak.uni-bielefeld.de/swift/" target="_blank">http://bibiserv.techfak.uni-bielefeld.de/swift/</a><br /><a href="http://http//bioinf.comav.upv.es/svn/biolib/biolib/src/" target="_blank">biolib</a>.is library and a set of script targeted to NGS. There are modules to: clean sequences (sanger, 454, ilumina), parse caf, ace and bowtie map files, clean and filter contigs, look for snps and indels., filter snps, do statistics for: reads, contigs and snps.</p><p><br /> <strong>Align/Assemble to a reference</strong><br /> <a href="https://secure.genome.ucla.edu/index.php/BFAST" target="_blank">BFAST</a> - Blat-like Fast Accurate Search Tool. Written by Nils Homer, Stanley F. Nelson and Barry Merriman at UCLA.<br /><a href="http://bowtie-bio.sourceforge.net/" target="_blank">Bowtie</a> - Ultrafast, memory-efficient short read aligner. It aligns short DNA sequences (reads) to the human genome at a rate of 25 million reads per hour on a typical workstation with 2 gigabytes of memory. Uses a Burrows-Wheeler-Transformed (BWT) index. <a href="http://seqanswers.com/forums/showthread.php?t=706" target="_blank">Link to discussion thread here</a>. Written by Ben Langmead and Cole Trapnell. Linux, Windows, and Mac OS X.<br /> <a href="http://maq.sourceforge.net/" target="_blank">BWA</a> - Heng Lee's BWT Alignment program - a progression from Maq. BWA is a fast light-weighted tool that aligns short sequences to a sequence database, such as the human reference genome. By default, BWA finds an alignment within edit distance 2 to the query sequence. C++ source.<br /> <a href="http://bioinfo.cgrb.oregonstate.edu/docs/solexa/" target="_blank">ELAND</a> - Efficient Large-Scale Alignment of Nucleotide Databases. Whole genome alignments to a reference genome. Written by Illumina author Anthony J. Cox for the Solexa 1G machine.<br /> <a href="http://www.ebi.ac.uk/%7Eguy/exonerate/" target="_blank">Exonerate</a> - Various forms of pairwise alignment (including Smith-Waterman-Gotoh) of DNA/protein against a reference. Authors are Guy St C Slater and Ewan Birney from EMBL. C for POSIX.<br /> <a href="http://1001genomes.org/downloads/genomemapper.html" target="_blank">GenomeMapper</a> - GenomeMapper is a short read mapping tool designed for accurate read alignments. It quickly aligns millions of reads either with ungapped or gapped alignments. A tool created by the 1001 Genomes project. Source for POSIX.<br /> <a href="http://www.gene.com/share/gmap/" target="_blank">GMAP</a> - GMAP (Genomic Mapping and Alignment Program) for mRNA and EST Sequences. Developed by Thomas Wu and Colin Watanabe at Genentec. C/Perl for Unix.<br /> <a href="http://dna.cs.byu.edu/gnumap/" target="_blank">gnumap</a> - The Genomic Next-generation Universal MAPper (gnumap) is a program designed to accurately map sequence data obtained from next-generation sequencing machines (specifically that of Solexa/Illumina) back to a genome of any size. It seeks to align reads from nonunique repeats using statistics. From authors at Brigham Young University. C source/Unix.<br /> <a href="http://sourceforge.net/projects/maq/" target="_blank">MAQ</a> - Mapping and Assembly with Qualities (renamed from MAPASS2). Particularly designed for Illumina with preliminary functions to handle ABI SOLiD data. Written by Heng Li from the Sanger Centre. Features extensive supporting tools for DIP/SNP detection, etc. C++ source<br /> <a href="http://bioinformatics.bc.edu/marthlab/Mosaik" target="_blank">MOSAIK</a> - MOSAIK produces gapped alignments using the Smith-Waterman algorithm. Features a number of support tools. Support for Roche FLX, Illumina, SOLiD, and Helicos. Written by Michael Str&ouml;mberg at Boston College. Win/Linux/MacOSX<br /> <a href="http://mrfast.sourceforge.net/" target="_blank">MrFAST and MrsFAST</a> - mrFAST &amp; mrsFAST are designed to map short reads generated with the Illumina platform to reference genome assemblies; in a fast and memory-efficient manner. Robust to INDELs and MrsFAST has a bisulphite mode. Authors are from the University of Washington. C as source.<br /> <a href="http://mummer.sourceforge.net/" target="_blank">MUMmer</a> - MUMmer is a modular system for the rapid whole genome alignment of finished or draft sequence. Released as a package providing an efficient suffix tree library, seed-and-extend alignment, SNP detection, repeat detection, and visualization tools. Version 3.0 was developed by Stefan Kurtz, Adam Phillippy, Arthur L Delcher, Michael Smoot, Martin Shumway, Corina Antonescu and Steven L Salzberg - most of whom are at The Institute for Genomic Research in Maryland, USA. POSIX OS required.<br /> <a href="http://www.novocraft.com/index.html" target="_blank">Novocraft</a> - Tools for reference alignment of paired-end and single-end Illumina reads. Uses a Needleman-Wunsch algorithm. Can support Bis-Seq. Commercial. Available free for evaluation, educational use and for use on open not-for-profit projects. Requires Linux or Mac OS X.<br /> <a href="http://pass.cribi.unipd.it/cgi-bin/pass.pl" target="_blank">PASS</a> - It supports Illumina, SOLiD and Roche-FLX data formats and allows the user to modulate very finely the sensitivity of the alignments. Spaced seed intial filter, then NW dynamic algorithm to a SW(like) local alignment. Authors are from CRIBI in Italy. Win/Linux.<br /> <a href="http://rulai.cshl.edu/rmap/" target="_blank">RMAP</a> - Assembles 20 - 64 bp Illumina reads to a FASTA reference genome. By Andrew D. Smith and Zhenyu Xuan at CSHL. (published in BMC Bioinformatics). POSIX OS required.<br /> <a href="http://biogibbs.stanford.edu/%7Ejiangh/SeqMap/" target="_blank">SeqMap</a> - Supports up to 5 or more bp mismatches/INDELs. Highly tunable. Written by Hui Jiang from the Wong lab at Stanford. Builds available for most OS's.<br /> <a href="http://compbio.cs.toronto.edu/shrimp/" target="_blank">SHRiMP</a> - Assembles to a reference sequence. Developed with Applied Biosystem's colourspace genomic representation in mind. Authors are Michael Brudno and Stephen Rumble at the University of Toronto. POSIX.<br /> <a href="http://www.bcgsc.ca/platform/bioinfo/software/slider" target="_blank"><span style="text-decoration: underline;">Slider</span></a>- An application for the Illumina Sequence Analyzer output that uses the probability files instead of the sequence files as an input for alignment to a reference sequence or a set of reference sequences. Authors are from BCGSC. Paper is <a href="http://seqanswers.com/forums/showthread.php?t=740" target="_blank">here</a>.<br /> <a href="http://soap.genomics.org.cn/" target="_blank">SOAP</a> - SOAP (Short Oligonucleotide Alignment Program). A program for efficient gapped and ungapped alignment of short oligonucleotides onto reference sequences. The updated version uses a BWT. Can call SNPs and INDELs. Author is Ruiqiang Li at the Beijing Genomics Institute. C++, POSIX.<br /> <a href="http://www.sanger.ac.uk/Software/analysis/SSAHA/" target="_blank">SSAHA</a> - SSAHA (Sequence Search and Alignment by Hashing Algorithm) is a tool for rapidly finding near exact matches in DNA or protein databases using a hash table. Developed at the Sanger Centre by Zemin Ning, Anthony Cox and James Mullikin. C++ for Linux/Alpha.<br /> <a href="http://socs.biology.gatech.edu/" target="_blank">SOCS</a> - Aligns SOLiD data. SOCS is built on an iterative variation of the Rabin-Karp string search algorithm, which uses hashing to reduce the set of possible matches, drastically increasing search speed. Authors are Ondov B, Varadarajan A, Passalacqua KD and Bergman NH.<br /> <a href="http://bibiserv.techfak.uni-bielefeld.de/swift/welcome.html" target="_blank">SWIFT</a> - The SWIFT suit is a software collection for fast index-based sequence comparison. It contains: SWIFT &mdash; fast local alignment search, guaranteeing to find epsilon-matches between two sequences. SWIFT BALSAM &mdash; a very fast program to find semiglobal non-gapped alignments based on k-mer seeds. Authors are Kim Rasmussen (SWIFT) and Wolfgang Gerlach (SWIFT BALSAM)<br /> <a href="http://synasite.mgrc.com.my:8080/sxog/NewSXOligoSearch.php" target="_blank">SXOligoSearch</a> - SXOligoSearch is a commercial platform offered by the Malaysian based <a href="http://www.synamatix.com/" target="_blank">Synamatix</a>. Will align Illumina reads against a range of Refseq RNA or NCBI genome builds for a number of organisms. Web Portal. OS independent.<br /> <a href="http://www.vmatch.de/" target="_blank">Vmatch</a> - A versatile software tool for efficiently solving large scale sequence matching tasks. Vmatch subsumes the software tool REPuter, but is much more general, with a very flexible user interface, and improved space and time requirements. Essentially a large string matching toolbox. POSIX.<br /> <a href="http://www.bioinformaticssolutions.com/products/zoom/index.php" target="_blank">Zoom</a> - ZOOM (Zillions Of Oligos Mapped) is designed to map millions of short reads, emerged by next-generation sequencing technology, back to the reference genomes, and carry out post-analysis. ZOOM is developed to be highly accurate, flexible, and user-friendly with speed being a critical priority. Commercial. Supports Illumina and SOLiD data.<br />NCGR uses GMAP (<a href="http://www.gene.com/share/gmap/" target="_blank">http://www.gene.com/share/gmap/</a>) to alignment Solexa reads. GMAP is free, though.<br />Exonerate (<a href="http://www.ebi.ac.uk/%7Eguy/exonerate/" target="_blank">http://www.ebi.ac.uk/~guy/exonerate/</a>)<br /> MUMmer (<a href="http://mummer.sourceforge.net/" target="_blank">http://mummer.sourceforge.net/</a>)<br /> The mapping short reads called gnumap (<a href="http://dna.cs.byu.edu/gnumap/" target="_blank">http://dna.cs.byu.edu/gnumap/</a>) made to increase the accuracy with duplicate matches. Open source, creates viewable output (with Affy's Integrated Genome Browser), and produces results very similar to novocraft's.<br /><a href="http://socs.biology.gatech.edu/" target="_blank">SOCS</a> (short oligonucleotides in color space)<br />BFAST <a href="https://secure.genome.ucla.edu/index.php/BFAST" target="_blank">https://secure.genome.ucla.edu/index.php/BFAST</a></p><p><br /> <strong><em>De novo</em> Align/Assemble</strong><br /> <a href="http://www.bcgsc.ca/platform/bioinfo/software/abyss" target="_blank">ABySS</a> - Assembly By Short Sequences. ABySS is a de novo sequence assembler that is designed for very short reads. The single-processor version is useful for assembling genomes up to 40-50 Mbases in size. The parallel version is implemented using MPI and is capable of assembling larger genomes. By Simpson JT and others at the Canada's Michael Smith Genome Sciences Centre. C++ as source. <br /> <a href="http://www.broad.mit.edu/science/programs/genome-biology/computational-rd/computational-research-and-development" target="_blank">ALLPATHS</a> - ALLPATHS: De novo assembly of whole-genome shotgun microreads. ALLPATHS is a whole genome shotgun assembler that can generate high quality assemblies from short reads. Assemblies are presented in a graph form that retains ambiguities, such as those arising from polymorphism, thereby providing information that has been absent from previous genome assemblies. Broad Institute.<br /> <a href="http://www.genomic.ch/edena.php" target="_blank">Edena</a> - Edena (Exact DE Novo Assembler) is an assembler dedicated to process the millions of very short reads produced by the Illumina Genome Analyzer. Edena is based on the traditional overlap layout paradigm. By D. Hernandez, P. Fran&ccedil;ois, L. Farinelli, M. Osteras, and J. Schrenzel. Linux/Win.<br /> <a href="http://euler-assembler.ucsd.edu/portal/" target="_blank">EULER-SR</a> - Short read <em>de novo</em> assembly. By Mark J. Chaisson and Pavel A. Pevzner from UCSD (published in Genome Research). Uses a de Bruijn graph approach.<br /> <a href="http://chevreux.org/projects_mira.html" target="_blank">MIRA2</a> - MIRA (Mimicking Intelligent Read Assembly) is able to perform true hybrid de-novo assemblies using reads gathered through 454 sequencing technology (GS20 or GS FLX). Compatible with 454, Solexa and Sanger data. Linux OS required.<br /> <a href="http://www.seqan.de/projects/consensus.html" target="_blank">SEQAN</a> - A Consistency-based Consensus Algorithm for De Novo and Reference-guided Sequence Assembly of Short Reads. By Tobias Rausch and others. C++, Linux/Win.<br /> <a href="http://sharcgs.molgen.mpg.de/" target="_blank">SHARCGS</a> - De novo assembly of short reads. Authors are Dohm JC, Lottaz C, Borodina T and Himmelbauer H. from the Max-Planck-Institute for Molecular Genetics.<br /> <a href="http://www.bcgsc.ca/platform/bioinfo/software/ssake" target="_blank">SSAKE</a> - The Short Sequence Assembly by K-mer search and 3' read Extension (SSAKE) is a genomics application for aggressively assembling millions of short nucleotide sequences by progressively searching for perfect 3'-most k-mers using a DNA prefix tree. Authors are Ren&eacute; Warren, Granger Sutton, Steven Jones and Robert Holt from the Canada's Michael Smith Genome Sciences Centre. Perl/Linux.<br /> <a href="http://soap.genomics.org.cn/" target="_blank">SOAPdenovo</a> - Part of the SOAP suite. See above. <br /> <a href="https://sourceforge.net/projects/vcake" target="_blank">VCAKE</a> - De novo assembly of short reads with robust error correction. An improvement on early versions of SSAKE.<br /> <a href="http://www.ebi.ac.uk/%7Ezerbino/velvet/" target="_blank">Velvet</a> - Velvet is a de novo genomic assembler specially designed for short read sequencing technologies, such as Solexa or 454. Need about 20-25X coverage and paired reads. Developed by Daniel Zerbino and Ewan Birney at the European Bioinformatics Institute (EMBL-EBI).<br />SOAP (<a href="http://soap.genomics.org.cn" target="_blank">http://soap.genomics.org.cn</a>) by Ruiqiang Li, as has been pointed by ECO.<br />Euler-SR (Euler-Short Reads Assembly, <a href="http://euler-assembler.ucsd.edu/portal/" target="_blank">http://euler-assembler.ucsd.edu/portal/</a>) by Mark J. Chaisson and Pavel A. Pevzner from UCSD. (published in Genome Research)<br />RMAP (A program for mapping Solexa reads, <a href="http://rulai.cshl.edu/rmap/" target="_blank">http://rulai.cshl.edu/rmap/</a>) by Andrew D. Smith and Zhenyu Xuan at CSHL. (published in BMC Bioinformatics)<br />Short read aligner called Bowtie (<a href="http://bowtie-bio.sourceforge.net/" target="_blank">http://bowtie-bio.sourceforge.net/</a>) designed for fast mapping of Illumina reads<br /> <br /> <strong>SNP/Indel Discovery</strong><br /> <a href="http://www.sanger.ac.uk/Software/analysis/ssahaSNP/" target="_blank">ssahaSNP</a> - ssahaSNP is a polymorphism detection tool. It detects homozygous SNPs and indels by aligning shotgun reads to the finished genome sequence. Highly repetitive elements are filtered out by ignoring those kmer words with high occurrence numbers. More tuned for ABI Sanger reads. Developers are Adam Spargo and Zemin Ning from the Sanger Centre. Compaq Alpha, Linux-64, Linux-32, Solaris and Mac<br /> <a href="http://bioinformatics.bc.edu/marthlab/PbShort" target="_blank">PolyBayesShort</a> - A re-incarnation of the PolyBayes SNP discovery tool developed by Gabor Marth at Washington University. This version is specifically optimized for the analysis of large numbers (millions) of high-throughput next-generation sequencer reads, aligned to whole chromosomes of model organism or mammalian genomes. Developers at Boston College. Linux-64 and Linux-32.<br /> <a href="http://bioinformatics.bc.edu/marthlab/PyroBayes" target="_blank">PyroBayes</a> - PyroBayes is a novel base caller for pyrosequences from the 454 Life Sciences sequencing machines. It was designed to assign more accurate base quality estimates to the 454 pyrosequences. Developers at Boston College.<br />Maq is also able to find SNPs with its own alignment. It has a graphical viewer, but again for its own alignment format.<br />SSAHA has been optimized for short-reads, too. But yes, SSAHASNP appears in your "SNP/INDEL discovery" category.<br /> <br /> <strong>Genome Annotation/Genome Browser/Alignment Viewer/Assembly Database</strong><br /> <a href="http://bioinformatics.bc.edu/marthlab/EagleView" target="_blank">EagleView</a> - An information-rich genome assembler viewer. EagleView can display a dozen different types of information including base quality and flowgram signal. Developers at Boston College.<br /> <a href="http://www.sanger.ac.uk/Software/analysis/lookseq/" target="_blank">LookSeq</a> - LookSeq is a web-based application for alignment visualization, browsing and analysis of genome sequence data. LookSeq supports multiple sequencing technologies, alignment sources, and viewing modes; low or high-depth read pileups; and easy visualization of putative single nucleotide and structural variation. From the Sanger Centre.<br /> <a href="http://evolution.sysu.edu.cn/mapview/" target="_blank">MapView</a> - MapView: visualization of short reads alignment on desktop computer. From the Evolutionary Genomics Lab at Sun-Yat Sen University, China. Linux.<br /> <a href="http://www.bcgsc.ca/platform/bioinfo/software/sam" target="_blank">SAM</a> - Sequence Assembly Manager. Whole Genome Assembly (WGA) Management and Visualization Tool. It provides a generic platform for manipulating, analyzing and viewing WGA data, regardless of input type. Developers are Rene Warren, Yaron Butterfield, Asim Siddiqui and Steven Jones at Canada's Michael Smith Genome Sciences Centre. MySQL backend and Perl-CGI web-based frontend/Linux. <br /> <a href="http://staden.sourceforge.net/" target="_blank">STADEN</a> - Includes GAP4. GAP5 once completed will handle next-gen sequencing data. A partially implemented test version is available <a href="https://sourceforge.net/project/show...kage_id=256957" target="_blank">here</a><br /> <a href="http://www.bcgsc.ca/platform/bioinfo/software/xmatchview" target="_blank">XMatchView</a> - A visual tool for analyzing cross_match alignments. Developed by Rene Warren and Steven Jones at Canada's Michael Smith Genome Sciences Centre. Python/Win or Linux.<br /> <br /> <strong>Counting e.g. CHiP-Seq, Bis-Seq, CNV-Seq</strong><br /> <a href="http://epigenomics.mcdb.ucla.edu/BS-Seq/download.html" target="_blank">BS-Seq</a> - The source code and data for the "Shotgun Bisulphite Sequencing of the Arabidopsis Genome Reveals DNA Methylation Patterning" Nature paper by <a href="http://www.ncbi.nlm.nih.gov/sites/entrez?holding=&amp;db=pubmed&amp;cmd=search&amp;term=Shotgun%20Bisulphite%20Sequencing" target="_blank">Cokus et al.</a> (Steve Jacobsen's lab at UCLA). POSIX.<br /> <a href="http://woldlab.caltech.edu/chipseq/" target="_blank">CHiPSeq</a> - Program used by Johnson et al. (2007) in their Science publication<br /> <a href="http://tiger.dbs.nus.edu.sg/cnv-seq/" target="_blank">CNV-Seq</a> - CNV-seq, a new method to detect copy number variation using high-throughput sequencing. Chao Xie and Martti T Tammi at the National University of Singapore. Perl/R.<br /> <a href="http://www.bcgsc.ca/platform/bioinfo/software/findpeaks" target="_blank">FindPeaks</a> - perform analysis of ChIP-Seq experiments. It uses a naive algorithm for identifying regions of high coverage, which represent Chromatin Immunoprecipitation enrichment of sequence fragments, indicating the location of a bound protein of interest. Original algorithm by Matthew Bainbridge, in collaboration with Gordon Robertson. Current code and implementation by Anthony Fejes. Authors are from the Canada's Michael Smith Genome Sciences Centre. JAVA/OS independent. Latest versions available as part of the <a href="http://vancouvershortr.sourceforge.net/" target="_blank">Vancouver Short Read Analysis Package</a><br /> <a href="http://liulab.dfci.harvard.edu/MACS/" target="_blank">MACS</a> - Model-based Analysis for ChIP-Seq. MACS empirically models the length of the sequenced ChIP fragments, which tends to be shorter than sonication or library construction size estimates, and uses it to improve the spatial resolution of predicted binding sites. MACS also uses a dynamic Poisson distribution to effectively capture local biases in the genome sequence, allowing for more sensitive and robust prediction. Written by Yong Zhang and Tao Liu from Xiaole Shirley Liu's Lab. <br /> <a href="http://www.gersteinlab.org/proj/PeakSeq/" target="_blank">PeakSeq</a> - PeakSeq: Systematic Scoring of ChIP-Seq Experiments Relative to Controls. a two-pass approach for scoring ChIP-Seq data relative to controls. The first pass identifies putative binding sites and compensates for variation in the mappability of sequences across the genome. The second pass filters out sites that are not significantly enriched compared to the normalized input DNA and computes a precise enrichment and significance. By Rozowsky J et al. C/Perl.<br /> <a href="http://mendel.stanford.edu/sidowlab/downloads/quest/" target="_blank">QuEST</a> - Quantitative Enrichment of Sequence Tags. Sidow and Myers Labs at Stanford. From the 2008 publication <a href="http://www.ncbi.nlm.nih.gov/pubmed/18711362" target="_blank">Genome-wide analysis of transcription factor binding sites based on ChIP-Seq data</a>. (C++)<br /> <a href="http://dir.nhlbi.nih.gov/papers/lmi/epigenomes/sissrs/" target="_blank">SISSRs</a> - Site Identification from Short Sequence Reads. BED file input. Raja Jothi @ NIH. Perl.<br />SeqMap (<a href="http://biogibbs.stanford.edu/%7Ejiangh/SeqMap/" target="_blank">http://biogibbs.stanford.edu/~jiangh/SeqMap/</a>) - work like ELand, can do 3 or more bp mismatches and also insdel<br />ChIPSeq analysis is:&nbsp; <a href="http://dir.nhlbi.nih.gov/papers/lmi/epigenomes/sissrs/" target="_blank">http://dir.nhlbi.nih.gov/papers/lmi/epigenomes/sissrs/</a></p><p>See also <a href="http://seqanswers.com/forums/showthread.php?t=742" target="_blank">this thread</a> for ChIP-Seq, until I get time to update this list.<br /> <br /> <strong>Alternate Base Calling</strong><br /> <a href="http://svitsrv25.epfl.ch/R-doc/library/Rolexa/html/00Index.html" target="_blank">Rolexa</a> - R-based framework for base calling of Solexa data. Project <a href="http://www.biomedcentral.com/1471-2105/9/431" target="_blank">publication</a><br /> <a href="http://hannonlab.cshl.edu/Alta-Cyclic/main.html" target="_blank">Alta-cyclic</a> - "a novel Illumina Genome-Analyzer (Solexa) base caller"<br /> <br /> <strong>Transcriptomics</strong><br /> <a href="http://woldlab.caltech.edu/rnaseq/" target="_blank">ERANGE</a> - Mapping and Quantifying Mammalian Transcriptomes by RNA-Seq. Supports Bowtie, BLAT and ELAND. From the Wold lab.<br /> <a href="http://www.genoscope.cns.fr/externe/gmorse/" target="_blank">G-Mo.R-Se</a> - G-Mo.R-Se is a method aimed at using RNA-Seq short reads to build de novo gene models. First, candidate exons are built directly from the positions of the reads mapped on the genome (without any ab initio assembly of the reads), and all the possible splice junctions between those exons are tested against unmapped reads. From CNS in France.<br /> <a href="http://evolution.sysu.edu.cn/english/software/mapnext.htm" target="_blank">MapNext</a> - MapNext: A software tool for spliced and unspliced alignments and SNP detection of short sequence reads. From the Evolutionary Genomics Lab at Sun-Yat Sen University, China.<br /> <a href="http://www.fml.tuebingen.mpg.de/raetsch/suppl/qpalma" target="_blank">QPalma</a> - Optimal Spliced Alignments of Short Sequence Reads. Authors are Fabio De Bona, Stephan Ossowski, Korbinian Schneeberger, and Gunnar R&auml;tsch. A paper is <a href="http://www.fml.tuebingen.mpg.de/raetsch/suppl/qpalma/qpalma-final.pdf" target="_blank">available</a>.<br /> <a href="http://biogibbs.stanford.edu/%7Ejiangh/rsat/" target="_blank">RSAT</a> - RSAT: RNA-Seq Analysis Tools. RNASAT is developed and maintained by Hui Jiang at Stanford University.<br /> <a href="http://tophat.cbcb.umd.edu/" target="_blank">TopHat</a> - TopHat is a fast splice junction mapper for RNA-Seq reads. It aligns RNA-Seq reads to mammalian-sized genomes using the ultra high-throughput short read aligner Bowtie, and then analyzes the mapping results to identify splice junctions between exons. TopHat is a collaborative effort between the University of Maryland and the University of California, Berkeley<br />NGS-Trex: Next Generation Sequencing Transcriptome profile explorer http://www.biomedcentral.com/1471-2105/14/S7/S10</p><p>Reference</p><p>Illumina has a software list: <a href="http://www.illumina.com/pagesnrn.ilmn?ID=245" target="_blank">http://www.illumina.com/pagesnrn.ilmn?ID=245</a>.</p><p>Some softwares in his blog (<a href="http://www.fejes.ca/labels/DNA.html" target="_blank">http://www.fejes.ca/labels/DNA.html</a>)</p><p><a href="http://seqanswers.com/wiki/Software" target="_blank">http://seqanswers.com/wiki/Software</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/26409/ucsc-genome-browser-and-blat-software</guid>
	<pubDate>Thu, 18 Feb 2016 03:18:57 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/26409/ucsc-genome-browser-and-blat-software</link>
	<title><![CDATA[UCSC Genome Browser and Blat software !]]></title>
	<description><![CDATA[<p>This directory contains Genome Browser and Blat application binaries built for standalone <br>command-line use on various supported Linux and UNIX platforms. To determine which set of binaries <br>to download, type "uname -a" on the command line to display your machine type. In most cases the <br>usage statement for the application can be viewed by running the binary with no arguments. <br><br>The UCSC Genome Browser and Blat software are free for academic, nonprofit, and personal use. A <br>license is required for commercial download and installation of these binaries, with the exception <br>of items built from the following source code directories, which are freely available for all uses:<br><br>&nbsp;- kent/src/utils (includes big* tools)<br>&nbsp;- kent/src/lib<br>&nbsp;- kent/src/hg/autoSql<br>&nbsp;- kent/src/hg/autoXml<br><br>For information about commercial licensing of the Genome Browser software, see <br>http://genome.ucsc.edu/license/. The Blat and In-Silico PCR software may be commercially<br>licensed through Kent Informatics (http://www.kentinformatics.com).</p>
<p>More at http://hgdownload.cse.ucsc.edu/admin/exe/</p><p>Address of the bookmark: <a href="http://hgdownload.cse.ucsc.edu/admin/exe/" rel="nofollow">http://hgdownload.cse.ucsc.edu/admin/exe/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/27432/gkno</guid>
	<pubDate>Fri, 20 May 2016 18:56:37 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/27432/gkno</link>
	<title><![CDATA[GKNO]]></title>
	<description><![CDATA[<p><span>gkno opens the world of complex bioinformatic analysis to people of all level of computational expertise. This site contains documentation, tutorials and information on all the tools that comprise gkno.</span></p>
<p><span>http://gkno.me/how-to/install.html</span></p>
<p><span>http://gkno.me/software.html</span></p><p>Address of the bookmark: <a href="http://gkno.me/" rel="nofollow">http://gkno.me/</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

</channel>
</rss>