<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/34416?offset=200</link>
	<atom:link href="https://bioinformaticsonline.com/related/34416?offset=200" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/27080/mrfast-micro-read-fast-alignment-search-tool</guid>
	<pubDate>Tue, 26 Apr 2016 03:50:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/27080/mrfast-micro-read-fast-alignment-search-tool</link>
	<title><![CDATA[mrFAST:  Micro Read Fast Alignment Search Tool]]></title>
	<description><![CDATA[<p><span>mrFAST is a read mapper that is designed to map short reads to reference genome with a special emphasis on the discovery of structural variation and segmental duplications. mrFAST maps short reads with respect to user defined error threshold, including indels up to 4+4 bp. This manual, describes how to choose the parameters and tune mrFAST with respect to the library settings. mrFAST is designed to find&nbsp;</span><strong><span style="text-decoration: underline;">'all'</span></strong><span>&nbsp; mappings for a given set of reads, however it can return one "best" map location if the relevant parameter is invoked.</span></p>
<p><span>More at&nbsp;http://mrfast.sourceforge.net/manual.html</span></p><p>Address of the bookmark: <a href="http://mrfast.sourceforge.net/manual.html" rel="nofollow">http://mrfast.sourceforge.net/manual.html</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/27839/lorma-a-tool-for-correcting-sequencing-errors-in-long-reads-such-those-produced-by-pacific-biosciences-sequencing-machines</guid>
	<pubDate>Wed, 15 Jun 2016 17:18:36 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/27839/lorma-a-tool-for-correcting-sequencing-errors-in-long-reads-such-those-produced-by-pacific-biosciences-sequencing-machines</link>
	<title><![CDATA[LoRMA: a tool for correcting sequencing errors in long reads such those produced by Pacific Biosciences sequencing machines]]></title>
	<description><![CDATA[<p>LoRMA is a tool for correcting sequencing errors in long reads such those produced by Pacific Biosciences sequencing machines.</p>
<p>Publication:</p>
<ul>
<li>L. Salmela, R. Walve, E. Rivals, and E. Ukkonen: Accurate selfcorrection of errors in long reads using de Bruijn graphs. Accepted to RECOMB-Seq 2016.</li>
</ul>
<p>Download:</p>
<ul>
<li><a href="https://www.cs.helsinki.fi/u/lmsalmel/LoRMA/LoRMA-0.3.tar.gz">LoRMA 0.3 source files</a></li>
<li><a href="https://www.cs.helsinki.fi/u/lmsalmel/LoRMA/README.txt">README</a></li>
</ul><p>Address of the bookmark: <a href="https://www.cs.helsinki.fi/u/lmsalmel/LoRMA/" rel="nofollow">https://www.cs.helsinki.fi/u/lmsalmel/LoRMA/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/29614/art-set-of-simulation-tools</guid>
	<pubDate>Thu, 03 Nov 2016 08:28:25 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/29614/art-set-of-simulation-tools</link>
	<title><![CDATA[ART: Set of Simulation Tools]]></title>
	<description><![CDATA[<p>ART is a set of simulation tools to generate synthetic next-generation sequencing reads. ART simulates sequencing reads by mimicking real sequencing process with empirical error models or quality profiles summarized from large recalibrated sequencing data. ART can also simulate reads using user own read error model or quality profiles. ART supports simulation of single-end, paired-end/mate-pair reads of three major commercial next-generation sequencing platforms: Illumina's Solexa, Roche's 454 and Applied Biosystems' SOLiD. ART can be used to test or benchmark a variety of method or tools for next-generation sequencing data analysis, including read alignment, de novo assembly, SNP and structure variation discovery. ART was used as a primary tool for the simulation study of the <span><a href="http://www.1000genomes.org/" target="_blank">1000 Genomes Project<span></span></a></span> . ART is implemented in C++ with optimized algorithms and is highly efficient in read simulation. ART outputs reads in the FASTQ format, and alignments in the ALN format. ART can also generate alignments in the SAM alignment or UCSC BED file format. ART can be used together with genome variants simulators (e.g. <span><a href="http://bioinform.github.io/varsim/" target="_blank">VarSim<span></span></a></span>) for evaluating variant calling tools or methods.</p><p>Address of the bookmark: <a href="http://www.niehs.nih.gov/research/resources/software/biostatistics/art/" rel="nofollow">http://www.niehs.nih.gov/research/resources/software/biostatistics/art/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/30557/speedseq</guid>
	<pubDate>Fri, 20 Jan 2017 06:05:43 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/30557/speedseq</link>
	<title><![CDATA[SpeedSeq]]></title>
	<description><![CDATA[<p>A flexible framework for rapid genome analysis and interpretation</p>
<p>C Chiang, R M Layer, G G Faust, M R Lindberg, D B Rose, E P Garrison, G T Marth, A R Quinlan, and I M Hall. SpeedSeq: ultra-fast personal genome analysis and interpretation. Nat Meth (2015). doi:10.1038/nmeth.3505.</p>
<p><a href="http://www.nature.com/nmeth/journal/vaop/ncurrent/full/nmeth.3505.html">http://www.nature.com/nmeth/journal/vaop/ncurrent/full/nmeth.3505.html</a></p><p>Address of the bookmark: <a href="https://github.com/hall-lab/speedseq" rel="nofollow">https://github.com/hall-lab/speedseq</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/35621/bbtools-for-bioinformatician</guid>
	<pubDate>Thu, 15 Feb 2018 16:45:52 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/35621/bbtools-for-bioinformatician</link>
	<title><![CDATA[BBTools for bioinformatician !]]></title>
	<description><![CDATA[<p><span></span><br /><strong>BBMap.sh</strong><br /><br /></p><ul>
<li><strong>Mapping Nanopore reads</strong></li>
</ul><p><br /><span>BBMap.sh has a length cap of 6kbp. Reads longer than this will be broken into 6kbp pieces and mapped independently.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ mapPacBio.sh -Xmx20g k=7 in=reads.fastq ref=reference.fa maxlen=1000 minlen=200 idtag ow int=f qin=33 out=mapped1.sam minratio=0.15 ignorequality slow ordered maxindel1=40 maxindel2=400</pre></div><p><br /><span>The "maxlen" flag shreds them to a max length of 1000; you can set that up to 6000. But I found 1000 gave a higher mapping rate.&nbsp;&nbsp;</span><br /><br /></p><ul>
<li><strong>Using Paired-end and single-end reads at the same time</strong></li>
</ul><p><br /><span>BBMap itself can only run single-ended or paired-ended in a single run, but it has a wrapper that can accomplish it, like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbwrap.sh in1=read1.fq,singletons.fq in2=read2.fq,null out=mapped.sam append</pre></div><p><span>This will write all the reads to the same output file but only print the headers once. I have not tried that for bam output, only sam output</span><br /><br /><span>Note about alignment stats: For paired reads, you can find the total percent mapped by adding the read 1 percent (where it says "mapped: N%") and read 2 percent, then dividing by 2. The different columns tell you the count/percent of each event. Considering the cigar strings from alignment, "Match Rate" is the number of symbols indicating a reference match (=) and error rate is the number indicating substitution, insertion, or deletion (X, I, D).</span><br /><br /></p><ul>
<li><strong>Exact matches when mapping small reads (e.g. miRNA)</strong></li>
</ul><p><br /><span>When mapping small RNA's with BBMap use the following flags to report only perfect matches.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">ambig=all vslow perfectmode maxsites=1000</pre></div><p><span>It should be very fast in that mode (despite the vslow flag). Vslow mainly removes masking of low-complexity repetitive kmers, which is not usually a problem but can be with extremely short sequences like microRNAs.</span></p><ul>
<li><strong>Important note about BBMap alignments</strong></li>
</ul><p><br /><span>BBMap is always nondeterministic when run in paired-end mode with multiple threads, because the insert-size average is calculated on a per-thread basis, which affects mapping; and which reads are assigned to which thread is nondeterministic. The only way to avoid that would be to restrict it to a single thread (threads=1), or map the reads as single-ended and then fix pairing afterward:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">bbmap.sh in=reads.fq outu=unmapped.fq int=f
repair.sh in=unmapped.fq out=paired.fq fint outs=singletons.fq</pre></div><p><span>In this case you'd want to only keep the paired output.&nbsp;</span><br /><br /><span>BBSplit is based on BBMap, so it is also nondeterministic in paired mode with multiple threads. BBDuk and Seal (which can be used similarly to BBSplit) are always deterministic.&nbsp;</span><br /><br /><span>--------------------------------------------------------</span><br /><br /><strong>Reformat.sh</strong></p><ul>
<li><strong>Count k-mers/find unknown primers</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.fq out=trimmed.fq ftr=19</pre></div><p><span>This will trim all but the first 20 bases (all bases after position 19, zero-based).</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ kmercountexact.sh in=trimmed.fq out=counts.txt fastadump=f mincount=10 k=20 rcomp=f</pre></div><p><span>This will generate a file containing the counts of all 20-mers that occurred at least 10 times, in a 2-column format that is easy to sort in Excel.&nbsp;</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">ACCGTTACCGTTACCGTTAC	100
AAATTTTTTTCCCCCCCCCC	85</pre></div><p><span>...etc. If the primers are 20bp long, they should be pretty obvious.&nbsp;&nbsp;</span></p><ul>
<li><strong>Convert SAM format from 1.4 to 1.3 (required for many programs)</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.sam out=out.sam sam=1.3</pre></div><ul>
<li><strong>Removing N basecalls</strong></li>
</ul><p><br /><span>You can use BBDuk or Reformat with "qtrim=rl trimq=1". That will only trim trailing and leading bases with Q-score below 1, which means Q0, which means N (in either fasta or fastq format). The BBMap package automatically changes q-scores of Ns that are above 0 to 0 and called bases with q-scores below 2 to 2, since occasionally some Illumina software versions produces odd things like a handful of Q0 called bases or Ns with Q&gt;0, neither of which make any sense in the Phred scale.</span></p><ul>
<li><strong>Sampling reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.fq out=sampled.fq sample=3000</pre></div><div><div>Code:</div><pre dir="ltr">To sample 10% of the reads:
reformat.sh in1=reads1.fq in2=reads2.fq out1=sampled1.fq out2=sampled2.fq samplerate=0.1

or more concisely:
reformat.sh in=reads#.fq out=sampled#.fq samplerate=0.1

and for exact sampling:
reformat.sh in=reads#.fq out=sampled#.fq samplereadstarget=100k</pre></div><ul>
<li><strong>Changing fasta headers</strong></li>
</ul><p><br /><span>Remove anything after the first space in fasta header.&nbsp;</span><br /><br /></p><div><div>Code:</div><pre dir="ltr"> reformat.sh in=sequences.fasta out=renamed.fasta trd</pre></div><p><span>"trd" stands for "trim read description" and will truncate everything after the first whitespace.</span></p><ul>
<li><strong>Extract reads from a sam file</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.sam out=reads.fastq</pre></div><ul>
<li><strong>Verify pairing and optionally de-interleave the reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.fastq verifypairing</pre></div><ul>
<li><strong>Verify pairing if the reads are in separate files</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in1=r1.fq in2=r2.fq vpair</pre></div><p><span>If that completes successfully and says the reads were correctly paired, then you can simply de-interleave reads into two files like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.fastq out1=r1.fastq out2=r2.fastq</pre></div><ul>
<li><strong>Base quality histograms</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=reads.fq qchist=qchist.txt</pre></div><p><span>That stands for "quality count histogram".&nbsp;</span></p><ul>
<li><strong>Filter SAM/BAM file by read length</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=x.sam out=y.sam minlength=50 maxlength=200</pre></div><ul>
<li><strong>Filter SAM/BAM file to detect/filter spliced reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=mapped.bam out=filtered.bam maxdellen=50</pre></div><p><span>You can set "maxdellen" to whatever length deletion event you consider the minimum to signify splicing, which depends on the organism.</span><br /><span>-------------------------------------------------------------</span><br /><strong>Repair.sh</strong></p><ul>
<li><strong>"Re-pair" out-of-order reads from paired-end data files</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ repair.sh in1=r1.fq.gz in2=r2.fq.gz out1=fixed1.fq.gz out2=fixed2.fq.gz outsingle=singletons.fq.gz</pre></div><p><span>--------------------------------------------------------------</span><br /><strong>BBMerge.sh</strong><br /><br /><span>BBMerge now has a new flag - "outa" or "outadapter". This allows you to automatically detect the adapter sequence of reads with short insert sizes, in case you don't know what adapters were used. It works like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbmerge.sh in=reads.fq outa=adapters.fa reads=1m</pre></div><p><span>Of course, it will only work for paired reads! The output fasta file will look like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">&gt;Read1_adapter
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
&gt;Read2_adapter
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG</pre></div><p><span>If you have multiplexed things with different barcodes in the adapters, the part with the barcode will show up as Ns, like this:</span><br /><br /><span>GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG&nbsp;&nbsp;</span><br /><br /><span>Note: For BBMerge with micro-RNA, you need to add the flag&nbsp;</span><strong>mininsert=17</strong><span>. The default is 35, which is too long for micro-RNA libraries.&nbsp;</span></p><ul>
<li><strong>Identifying adapters</strong></li>
</ul><p><span>If you have paired reads, and enough of the reads have inserts shorter than read length, you can identify adapter sequences with BBMerge, like this (they will be printed to adapters.fa):</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbmerge.sh in1=r1.fq in2=r2.fq outa=adapters.fa</pre></div><p><br /><span>-----------------------------------------------------------------</span><br /><br /><strong>BBDuk.sh</strong><br /><br /><span>Note: BBDuk is strictly deterministic on a per-read basis, however it does by default reorder the reads when run multithreaded. You can add the flag "ordered" to keep output reads in the same order as input reads</span></p><ul>
<li><strong>Finding reads with a specific sequence at the beginning of read</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ bbduk.sh -Xmx1g in=reads.fq outm=matched.fq outu=unmatched.fq restrictleft=25 k=25 literal=AAAAACCCCCTTTTTGGGGGAAAAA</pre></div><p><span>In this case, all reads starting with "AAAAACCCCCTTTTTGGGGGAAAAA" will end up in "matched.fq" and all other reads will end up in "unmatched.fq". Specifically, the command means "look for 25-mers in the leftmost 25 bp of the read", which will require an exact prefix match, though you can relax that if you want.</span><br /><br /><span>So you could bin all the reads with your known sequence, then look at the remaining reads to see what they have in common. You can do the same thing with the tail of the read using "restrictright" instead, though you can't use both restrictions at the same time.&nbsp;&nbsp;</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbduk.sh in=reads.fq outm=matched.fq literal=NNNNNNCCCCGGGGGTTTTTAAAAA k=25 copyundefined</pre></div><p><span>With the "copyundefined" flag, a copy of each reference sequence will be made representing every valid combination of defined letter. So instead of increasing memory or time use by 6^75, it only increases them by 4^6 or 4096 which is completely reasonable, but it only allows substitutions at predefined locations. You can use the "copyundefined", "hdist", and "qhdist" flags together for a lot of flexibility - for example, hdist=2 qhdist=1 and 3 Ns in the reference would allow a hamming distance of 6 with much lower resource requirements than hdist=6. Just be sure to give BBDuk as much memory as possible.</span></p><ul>
<li><strong>Removing illumina adapters (if exact adapters not known)</strong></li>
</ul><p><br /><span>If you're not sure which adapters are used, you can add "ref=truseq.fa.gz,truseq_rna.fa.gz,nextera.fa.gz" and get them all (this will increase the amount of overtrimming, though it should still be negligible).&nbsp;</span></p><ul>
<li><strong>Removing illumina control sequences/phiX reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">bbduk.sh in=trimmed.fq.gz out=filtered.fq.gz k=31 ref=artifacts,phix ordered cardinality</pre></div><ul>
<li><strong>Identify certain reads that contain a specific sequence</strong></li>
</ul><div><div>Code:</div><pre dir="ltr">$ bbduk.sh in=reads.fq out=unmatched.fq outm=matched.fq literal=ACGTACGTACGTACGTAC k=18 mm=f hdist=2</pre></div><p><span>Make sure "k" is set to the exact length of the sequence. "hdist" controls the number of substitutions allowed. "outm" gets the reads that match. By default this also looks for the reverse-complement; you can disable that with "rcomp=f".&nbsp;&nbsp;</span></p><ul>
<li><strong>Extract sequences that share kmers with your sequences with BBDuk</strong></li>
</ul><div><div>Code:</div><pre dir="ltr">$ bbduk.sh in=a.fa ref=b.fa out=c.fa mkf=1 mm=f k=31</pre></div><p><span>This will print to C all the sequences in A that share 100% of their 31-mers with sequences in B.&nbsp;</span><br /><br /></p><ul>
<li><strong>Extract sequences that contain N's with BBDuk</strong></li>
</ul><div><div>Code:</div><pre dir="ltr">bbduk.sh in=reads.fq out=readsWithoutNs.fq outm=readsWithNs.fq maxns=0</pre></div><p><span>If you have, say, 100bp reads and only want to separate reads containing all 100 Ns, change that to "maxns=99".</span><br /><br /><strong>General notes for BBDuk.sh</strong><span>&nbsp;</span><br /><br /><span>BBDuk can operate in one of 4 kmer-matching modes:</span><br /><span>Right-trimming (ktrim=r), left-trimming (ktrim=l), masking (ktrim=n), and filtering (default). But it can only do one at a time because all kmers are stored in a single table. It can still do non-kmer-based operations such as quality trimming at the same time.</span><br /><br /><span>BBDuk2 can do all 4 kmer operations at once and is designed for integration into automated pipelines where you do contaminant removal and adapter-trimming in a single pass to minimize filesystem I/O. Personally, I never use BBDuk2 from the command line. Both have identical capabilities and functionality otherwise, but the syntax is different.</span><br /><br /><span>------------------------------------------------------------------</span><br /><br /><strong>Randomreads.sh</strong></p><ul>
<li><strong>Generate random reads in various formats</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ randomreads.sh ref=genome.fasta out=reads.fq len=100 reads=10000</pre></div><p><span>You can specify paired reads, an insert size distribution, read lengths (or length ranges), and so forth. But because I developed it to benchmark mapping algorithms, it is specifically designed to give excellent control over mutations. You can specify the number of snps, insertions, deletions, and Ns per read, either exactly or probabilistically; the lengths of these events is individually customizable, the quality values can alternately be set to allow errors to be generated on the basis of quality; there's a PacBio error model; and all of the reads are annotated with their genomic origin, so you will know the correct answer when mapping.</span><br /><br /><span>Bear in mind that 50% of the reads are going to be generated from the plus strand and 50% from the minus strand. So, either a read will match the reference perfectly, OR its reverse-complement will match perfectly.</span><br /><br /><span>You can generate the same set of reads with and without SNPs by fixing the seed to a positive number, like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ randomreads.sh maxsnps=0 adderrors=false out=perfect.fastq reads=1000 minlength=18 maxlength=55 seed=5

$ randomreads.sh maxsnps=2 snprate=1 adderrors=false out=2snps.fastq reads=1000 minlength=18 maxlength=55 seed=5</pre></div><p><span>[As of BBmap v. 36.59] rendomreads.sh gains the ability to simulate metagenomes.&nbsp;</span><br /><br /><span>coverage=X will automatically set "reads" to a level that will give X average coverage (decimal point is allowed).</span><br /><br /><span>metagenome will assign each scaffold a random exponential variable, which decides the probability that a read be generated from that scaffold. So, if you concatenate together 20 bacterial genomes, you can run randomreads and get a metagenomic-like distribution. It could also be used for RNA-seq when using a transcriptome reference.</span><br /><br /><span>The coverage is decided on a per-reference-sequence level, so if a bacterial assembly has more than one contig, you may want to glue them together first with fuse.sh before concatenating them with the other references.&nbsp;</span><br /><br /></p><ul>
<li><strong>Simulate a jump library</strong></li>
</ul><p><br /><span>You can simulate a 4000bp jump library from your existing data like this.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ cat assembly1.fa assembly2.fa &gt; combined.fa
$ bbmap.sh ref=combined.fa
$ randomreads.sh reads=1000000 length=100 paired interleaved mininsert=3500 maxinsert=4500 bell perfect=1 q=35 out=jump.fq.gz</pre></div><p><span>--------------------------------------------------------------</span><br /><strong>Shred.sh</strong><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ shred.sh in=ref.fasta out=reads.fastq length=200</pre></div><p><span>The difference is that RandomReads will make reads in a random order from random locations, ensuring flat coverage on average, but it won't ensure 100% coverage unless you generate many fold depth. Shred, on the other hand, gives you exactly 1x depth and exactly 100% coverage (and is not capable of modelling errors). So, the use-cases are different.&nbsp;</span><br /><span>---------------------------------------------------------------</span><br /><strong>Demuxbyname.sh</strong></p><ul>
<li><strong>Demultiplex fastq files when the tag is present in the fastq read header (illumina)</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ demuxbyname.sh in=r#.fq out=out_%_#.fq prefixmode=f names=GGACTCCT+GCGATCTA,TAAGGCGA+TCTACTCT,...
outu=filename</pre></div><p><span>"Names" can also be a text file with one barcode per line (in exactly the format found in the read header). You do have to include all of the expected barcodes, though.</span><br /><br /><span>In the output filename, the "%" symbol gets replaced by the barcode; in both the input and output names, the "#" symbol gets replaced by 1 or 2 for read 1 or read 2. It's optional, though; you can leave it out for interleaved input/output, or specify in1=/in2=/out1=/out2= if you want custom naming.</span><br /><br /><span>----------------------------------------------------------------</span><br /><br /><strong>Readlength.sh</strong></p><ul>
<li><strong>Plotting the length distribution of reads</strong></li>
</ul><div><div>Code:</div><pre dir="ltr">$ readlength.sh in=file out=histogram.txt bin=10 max=80000</pre></div><p><span>That will plot the result in bins of size 10, with everything above 80k placed in the same bin. The defaults are set for relatively short sequences so if they are many megabases long you may need to add the flag "-Xmx8g" and increase "max=" to something much higher.</span><br /><br /><span>Alternatively, if these are assemblies and you're interested in continuity information (L50, N50, etc), you can run stats on each or statswrapper on all of them:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">stats.sh in=file</pre></div><p><span>or</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">statswrapper.sh in=file,file,file,file&hellip;</pre></div><p><span>----------------------------------------------------------------</span><br /><strong>Filterbyname.sh</strong><br /><br /><span>By default, "filterbyname" discards reads with names in your name list, and keeps the rest. To include them and discard the others, do this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ filterbyname.sh in=003.fastq out=filter003.fq names=names003.txt include=t</pre></div><p><span>----------------------------------------------------------------</span><br /><strong>getreads.sh</strong><br /><br /><span>If you only know the number(s) of the fasta/fastq record(s) in a file (records start at 0) then you can use the following command to extract those reads in a new file.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ getreads.sh in= id=&lt;number,number,number...&gt; out=</pre></div><p><span>The first read (or pair) has ID 0, the second read (or pair) has ID 1, etc.</span><br /><br /><span>Parameters:</span><br /><span>in= Specify the input file, or stdin.</span><br /><span>out= Specify the output file, or stdout.</span><br /><span>id= Comma delimited list of numbers or ranges, in any order.</span><br /><span>For example: id=5,93,17-31,8,0,12-13&nbsp;</span><br /><span>----------------------------------------------------------------</span><br /><strong>Splitsam.sh</strong></p><ul>
<li><strong>Splits a sam file into forward and reverse reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">splitsam.sh mapped.sam plus.sam minus.sam unmapped.sam
reformat.sh in=plus.sam out=plus.fq
reformat.sh in=minus.sam out=minus.fq rcomp</pre></div><p><span>----------------------------------------------------------------</span><br /><strong>BBSplit.sh</strong><br /><br /><span>BBSplit now has the ability to output paired reads in dual files using the # symbol. For example:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbsplit.sh ref=x.fa,y.fa in1=read1.fq in2=read2.fq basename=o%_#.fq</pre></div><p><span>will produce ox_1.fq, ox_2.fq, oy_1.fq, and oy_2.fq</span><br /><br /><span>You can use the # symbol for input also, like "in=read#.fq", and it will get expanded into 1 and 2.&nbsp;&nbsp;</span><br /><br /><strong>Added feature:&nbsp;</strong><span>One can specify a directory for the "ref=" argument. If anything in the list is a directory, it will use all fasta files in that directory. They need a fasta extension, like .fa or .fasta, but can be compressed with an additional .gz after that. Reason this is useful is to use BBSplit is to have it split input into one output file per reference file.</span><br /><br /><br /><strong>NOTE: 1</strong><span>&nbsp;By default BBSplit uses fairly strict mapping parameters; you can get the same sensitivity as BBMap by adding the flags "minid=0.76 maxindel=16k minhits=1". With those parameters it is extremely sensitive.</span><br /><br /><strong>NOTE: 2</strong><span>&nbsp;BBSplit has different ambiguity settings for dealing with reads that map to multiple genomes. In any case, if the alignment score is higher to one genome than another, it will be associated with that genome only (this considers the combined scores of read pairs - pairs are always kept together). But when a read or pair has two identically-scoring mapping locations, on different genomes, the behavior is controlled by the "ambig2" flag - "ambig2=toss" will discard the read, "all" will send it to all output files, and "split" will send it to a separate file for ambiguously-mapped reads (one per genome to which it maps).</span><br /><br /><strong>NOTE: 3</strong><span>&nbsp;Zero-count lines are suppressed by default, but they should be printed if you include the flag "nzo=f" (nonzeroonly=false).&nbsp;</span><br /><br /><strong>NOTE: 4</strong><span>&nbsp;BBSplit needs multiple reference files as input; one per organism, or one for target and another for everything else. It only outputs one file per reference file.</span><br /><br /><span>Seal.sh, on the other hand, which is similar, can use a single concatenated file, as it (by default) will output one file per reference sequence within a concatenated set of references.&nbsp;</span><br /><span>--------------------------------------------------------------</span><br /><strong>Pileup.sh</strong></p><ul>
<li><strong>To generate transcript coverage stats</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ pileup.sh in=mapped.sam normcov=normcoverage.txt normb=20 stats=stats.txt</pre></div><p><span>That will generate coverage per transcript, with 20 lines per transcript, each line showing the coverage for that fraction of the transcript. "stats" will contain other information like the fraction of bases in each transcript that was covered.&nbsp;</span></p><ul>
<li><strong>To calculate physical coverage stats (region covered by paired-end reads)&nbsp;</strong></li>
</ul><p><span>BBMap has a "physcov" flag that allows it to report physical rather than sequenced coverage. It can be used directly in BBMap, or with pileup, if you already have a sam file. For example:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ pileup.sh in=mapped.sam covstats=coverage.txt</pre></div><ul>
<li><strong>Calculating coverage of the genome</strong></li>
</ul><p><br /><span>Program will take sam or bam, sorted or unsorted.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ pileup.sh in=mapped.sam out=stats.txt hist=histogram.txt</pre></div><p><span>stats.txt will contain the average depth and percent covered of each reference sequence; the histogram will contain the exact number of bases with a each coverage level. You can also get per-base coverage or binned coverage if you want to plot the coverage. It also generates median and standard deviation, and so forth.</span><br /><br /><span>It's also possible to generate coverage directly from BBMap, without an intermediate sam file, like this:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ bbmap.sh in=reads.fq ref=reference.fasta nodisk covstats=stats.txt covhist=histogram.txt</pre></div><p><span>We use this a lot in situations where all you care about is coverage distributions, which is somewhat common in metagenome assemblies. It also supports most of the flags that pileup.sh supports, though the syntax is slightly different to prevent collisions. In each case you can see all the possible flags by running the shellscript with no arguments.</span></p><ul>
<li><strong>To bin aligned reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ pileup.sh in=mapped.sam out=stats.txt bincov=coverage.txt binsize=1000</pre></div><p><span>That will give coverage within each bin. For read density regardless of read length, add the "startcov=t" flag.&nbsp;&nbsp;</span><br /><br /><span>--------------------------------------------------------------</span><br /><strong>Dedupe.sh</strong><br /><br /><span>Dedupe ensures that there is at most one copy of any input sequence, optionally allowing contaminants (substrings) to be removed, and a variable hamming or edit distance to be specified. Usage:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ dedupe.sh in=assembly1.fa,assembly2.fa out=merged.fa</pre></div><p><span>That will absorb exact duplicates and containments. You can use "hdist" and "edist" flags to allow mismatches, or get a complete list of flags by running the shellscript with no arguments.&nbsp;&nbsp;</span><br /><br /><span>Dedupe&nbsp;</span><span style="text-decoration: underline;">will merge assemblies</span><span>, but it&nbsp;</span><span style="text-decoration: underline;">will not produce consensus sequences or join overlapping reads</span><span>; it only removes sequences that are fully contained within other sequences (allowing the specified number of mismatches or edits).</span><br /><br /><span>Dedupe can remove duplicate reads from multiple files simultaneously, if they are comma-delimited (e.g. in=file1.fastq,file2.fastq,file3.fastq). And if you set the flag "uniqueonly=t" then ALL copies of duplicate reads will be removed, as opposed to the default behavior of leaving one copy of duplicate reads.</span><br /><br /><span>However, it does not care which file a read came from; in other words, it can't remove only reads that are duplicates across multiple files but leave the ones that are duplicates within a file. That can still be accomplished, though, like this:</span><br /><br /><span>1) Run dedupe on each sample individually, so now there are at most 1 copy of a read per sample.</span><br /><span>2) Run dedupe again on all of the samples together, with "uniqueonly=t". The only remaining duplicate reads will be the ones duplicated between samples, so that's all that will be removed.&nbsp;&nbsp;</span><br /><br /><span>--------------------------------------------------------------</span></p><ul>
<li><strong>Generate ROC curves from any aligner</strong></li>
</ul><p><br /><strong>[*]index the reference<br /><br /></strong></p><div><div>Code:</div><pre dir="ltr">$ bbmap.sh ref=reference.fasta</pre></div><p><br /><strong>[*]Generate random reads</strong><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ randomreads.sh reads=100000 length=100 out=synth.fastq maxq=35 midq=25 minq=15</pre></div><p><strong>[*]Map to produce a sam file</strong><br /><br /><span>...substitute this command with the appropriate one from your aligner of choice</span></p><div><div>Code:</div><pre dir="ltr">$ bbmap.sh in=synth.fq out=mapped.sam</pre></div><p><strong>[*]Generate ROC curve</strong><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ samtoroc.sh in=mapped.sam reads=100000</pre></div><p><span>--------------------------------------------------------------</span></p><ul>
<li><strong>Calculate heterozygous rate for sequence data</strong></li>
</ul><p><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ kmercountexact.sh in=reads.fq khist=histogram.txt peaks=peaks.txt</pre></div><p><span>You can examine the histogram manually, or use the "peaks" file which tells you the number of unique kmers in each peak on the histogram. For a diploid, the first peak will be the het peak, the second will be the homozygous peak, and the rest will be repeat peaks. The peak caller is not perfect, though, so particularly with noisy data I would only rely on it for the first two peaks, and try to quantify the higher-order peaks manually if you need to (which you generally don't).</span><br /><br /><span>-----------------------------------------------------------------</span></p><ul>
<li><strong>Compare mapped reads between two files</strong></li>
</ul><p><br /><span>To see how many mapped reads (can be mapped concordant or discordant, doesn't matter) are shared between the two alignment files and how many mapped reads are unique to one file or the other.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ reformat.sh in=file1.sam out=mapped1.sam mappedonly
$ reformat.sh in=file2.sam out=mapped2.sam mappedonly</pre></div><p><span>That gets you the mapped reads only. Then:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ filterbyname.sh in=mapped1.sam names=mapped2.sam out=shared.sam include=t</pre></div><p><span>...which gets you the set intersection;</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ filterbyname.sh in=mapped1.sam names=mapped2.sam out=only1.sam include=f
$ filterbyname.sh in=mapped2.sam names=mapped1.sam out=only2.sam include=f</pre></div><p><span>...which get you the set subtractions.&nbsp;&nbsp;</span><br /><br /><span>--------------------------------------------------------------</span><br /><br /><strong>BBrename.sh</strong></p><div><div>Code:</div><pre dir="ltr">$ bbrename.sh in=old.fasta out=new.fasta</pre></div><p><span>That will rename the reads as 1, 2, 3, 4, ... 222.</span><br /><br /><span>You can also give a custom prefix if you want. The input has to be text format, not .doc.&nbsp;&nbsp;</span><br /><br /><span>---------------------------------------------------------------------</span><br /><br /><strong>BBfakereads.sh</strong></p><ul>
<li><strong>Generating &ldquo;fake&rdquo; paired end reads from a single end read file</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ bfakereads.sh in=reads.fastq out1=r1.fastq out2=r2.fastq length=100</pre></div><p><span>That will generate fake pairs from the input file, with whatever length you want (maximum of input read length). We use it in some cases for generating a fake LMP library for scaffolding from a set of contigs. Read 1 will be from the left end, and read 2 will be reverse-complemented and from the right end; both will retain the correct original qualities. And " /1" " /2" will be suffixed after the read name.&nbsp;&nbsp;</span><br /><br /><span>------------------------------------------------------------------</span><br /><strong>Randomreads.sh</strong></p><ul>
<li><strong>Generate random reads</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ randomreads.sh ref=genome.fasta out=reads.fq len=100 reads=10000</pre></div><p><span>"seed=-1" will use a random seed; any other value will use that specific number as the seed</span><br /><br /><span>You can specify paired reads, an insert size distribution, read lengths (or length ranges), and so forth. But because I developed it to benchmark mapping algorithms, it is specifically designed to give excellent control over mutations. You can specify the number of snps, insertions, deletions, and Ns per read, either exactly or probabilistically; the lengths of these events is individually customizable, the quality values can alternately be set to allow errors to be generated on the basis of quality; there's a PacBio error model; and all of the reads are annotated with their genomic origin, so you will know the correct answer when mapping.</span><br /><br /><span>--------------------------------------------------------------------</span></p><ul>
<li><strong>Generate saturation curves to assess sequencing depth</strong></li>
</ul><p>&nbsp;</p><div><div>Code:</div><pre dir="ltr">$ bbcountunique.sh in=reads.fq out=histogram.txt</pre></div><p><span>It works by pulling kmers from each input read, and testing whether it has been seen before, then storing it in a table.</span><br /><br /><span>The bottom line, "first", tracks whether the first kmer of the read has been seen before (independent of whether it is read 1 or read 2).</span><br /><br /><span>The top line, "pair", indicates whether a combined kmer from both read 1 and read 2 has been seen before. The other lines are generally safe to ignore but they track other things, like read1- or read2-specific data, and random kmers versus the first kmer.</span><br /><br /><span>It plots a point every X reads (configurable, default 25000).</span><br /><br /><span>In noncumulative mode (default), a point indicates "for the last X reads, this percentage had never been seen before". In this mode, once the line hits zero, sequencing more is not useful.</span><br /><br /><span>In cumulative mode, a point indicates "for all reads, this percentage had never been seen before", but still only one point is plotted per X reads.</span><br /><br /><span>-----------------------------------------------------------------</span><br /><strong>CalcTrueQuality.sh</strong><br /><br /><a href="http://seqanswers.com/forums/showthread.php?p=170904" target="_blank">http://seqanswers.com/forums/showthread.php?p=170904</a><br /><br /><span>In light of the quality-score issues with the NextSeq platform, and the possibility of future Illumina platforms (HiSeq 3000 and 4000) also using quantized quality scores, I developed it for recalibrating the scores to ensure accuracy and restore the full range of values.</span><br /><br /><span>-----------------------------------------------------------------</span><br /><br /><strong>BBMapskimmer.sh</strong><br /><br /><span>BBMap is designed to find the best mapping, and heuristics will cause it to ignore mappings that are valid but substantially worse. Therefore, I made a different version of it, BBMapSkimmer, which is designed to find all of the mappings above a certain threshold. The shellscript is bbmapskimmer.sh and the usage is similar to bbmap.sh or mapPacBio.sh. For primers, which I assume will be short, you may wish to use a lower than default K of, say, 10 or 11, and add the "slow" flag.</span><br /><br /><span>--------------------------------------------------------------</span><br /><br /><strong>msa.sh and curprimers.sh</strong><br /><br /><span>Quoted from Brian's response directly.</span><br /><br /><span>I also wrote another pair of programs specifically for working with primer pairs, msa.sh and cutprimers.sh. msa.sh will forcibly align a primer sequence (or a set of primer sequences) against a set of reference sequences to find the single best matching location per reference sequence - in other words, if you have 3 primers and 100 ref sequences, it will output a sam file with exactly 100 alignments - one per ref sequence, using the primer sequence that matched best. Of course you can also just run it with 1 primer sequence.</span><br /><br /><span>So you run msa twice - once for the left primer, and once for the right primer - and generate 2 sam files. Then you feed those into cutprimers.sh, which will create a new fasta file containing the sequence between the primers, for each reference sequence. We used these programs to synthetically cut V4 out of full-length 16S sequences.</span><br /><br /><span>I should say, though, that the primer sites identified are based on the normal BBMap scoring, which is not necessarily the same as where the primers would bind naturally, though with highly conserved regions there should be no difference.</span><br /><br /><span>------------------------------------------------------</span><br /><strong>testformat.sh</strong><br /><br /><strong>Identify type of Q-score encoding in sequence files</strong><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ testformat.sh in=seq.fq.gz
sanger    fastq    gz    interleaved    150bp</pre></div><p><span>--------------------------------------------------</span><br /><strong>kcompress.sh</strong><br /><br /><span>Newest member of BBTools. Identify constituent k-mers.&nbsp;</span><br /><a href="http://seqanswers.com/forums/showthread.php?t=63258" target="_blank">http://seqanswers.com/forums/showthread.php?t=63258</a><br /><br /><span>----------------------------------------------------</span><br /><strong>commonkmers.sh</strong><br /><br /><span>Find all k-mers for a given sequence.</span></p><div><div>Code:</div><pre dir="ltr">$ commonkmers.sh in=reads.fq out=kmers.txt k=4 count=t display=999</pre></div><p><span>Will produce output that looks like</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">MISEQ05:239:000000000-A74HF:1:2110:14788:23085	ATGA=8	ATGC=6	GTCA=6	AAAT=5	AAGC=5	AATG=5	AGCA=5	ATAA=5	ATTA=5	CAAA=5	CATA=5	CATC=5	CTGC=5	AACC=4	AACG=4	AAGA=4	ACAT=4	ACCA=4	AGAA=4	ATCA=4	ATGG=4	CAAG=4	CCAA=4	CCTC=4	CTCA=4	CTGA=4	CTTC=4	GAGC=4	GGTA=4	GTAA=4	GTTA=4	AAAA=3	AAAC=3	AAGT=3	ACCG=3	ACGG=3	ACTG=3	AGAT=3	AGCT=3	AGGA=3	AGTA=3	AGTC=3	CAGC=3	CATG=3	CGAG=3	CGGA=3	CGTC=3	CTAA=3	CTCC=3	CTTA=3	GAAA=3	GACA=3	GACC=3	GAGA=3	GCAA=3	GGAC=3	TCAA=3	TGCA=3	AAAG=2	AACA=2	AATA=2	AATC=2	ACAA=2	ACCC=2	ACCT=2	ACGA=2	ACGC=2	AGAC=2	AGCG=2	AGGC=2	CAAC=2	CAGG=2	CCGC=2	GCCA=2	GCTA=2	GGAA=2	GGCA=2	TAAA=2	TAGA=2	TCCA=2	TGAA=2	AAGG=1	AATT=1	ACGT=1	AGAG=1	AGCC=1	AGGG=1	ATAC=1	ATAG=1	ATTG=1	CACA=1	CACG=1	CAGA=1	CCAC=1	CCCA=1	CCGA=1	CCTA=1	CGAC=1	CGCA=1	CGCC=1	CGCG=1	CGTA=1	CTAC=1	GAAC=1	GCGA=1	GCGC=1	GTAC=1	GTGA=1	TTAA=1</pre></div><p><span>-----------------------------------------------------</span><br /><strong>Mutate.sh</strong><br /><br /><span>Simulate multiple mutants from a known reference (e.g.&nbsp;</span><em>E. coli</em><span>).</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">$ mutate.sh in=e_coli.fasta out=mutant.fasta id=99 
$ randomreads.sh ref=mutant.fasta out=reads.fq.gz reads=5m length=150 paired adderrors</pre></div><p><span>That will create a mutant version of E.coli with 99% identity to the original, and then generate 5 million simulated read pairs from the new genome. You can repeat this multiple times; each mutant will be different.</span><br /><br /><span>------------------------------------</span><br /><br /><strong>Partition.sh</strong><br /><br /><span>One can partition a large dataset with partition.sh into smaller subsets (example below splits data into 8 chunks).</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">partition.sh in=r1.fq in2=r2.fq out=r1_part%.fq out2=r2_part%.fq ways=8</pre></div><p><span>-----------------------------------</span><br /><strong>clumpify.sh</strong><br /><br /><span>If you are concerned about file size and want the files to be as small as possible, give Clumpify a try. It can reduce filesize by around 30% losslessly by reordering the reads. I've found that this also typically accelerates subsequent analysis pipelines by a similar factor (up to 30%). Usage:</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">clumpify.sh in=reads.fastq.gz out=clumped.fastq.gz</pre></div><div><div>Code:</div><pre dir="ltr">clumpify.sh in1=reads_R1.fastq.gz in2=reads_R2.fastq.gz out1=clumped_R1.fastq.gz out2=clumped_R2.fastq.gz</pre></div><ul>
<li><strong>Clumpify.sh can now mark/remove sequence duplicates (optical/PCR/otherwise) from NGS data</strong></li>
</ul><p><br /><span>This does NOT require alignments so it should prove more useful compared to Picard MarkDuplicates. Relevant options for clumpify.sh command are listed below.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">dedupe=f optical=f (default)
Nothing happens with regards to duplicates.

dedupe=t optical=f
All duplicates are detected, whether optical or not.  All copies except one are removed for each duplicate.

dedupe=f optical=t
Nothing happens.

dedupe=t optical=t

Only optical duplicates (those with an X or Y coordinate within dist) are detected.  All copies except one are removed for each duplicate.
The allduplicates flag makes all copies of duplicates removed, rather than leaving a single copy.  But like optical, it has no effect unless dedupe=t.

Note: If you set "dupedist" to anything greater than 0, "optical" gets enabled automatically.</pre></div><p><span>-------------------------------------</span><br /><strong>fuse.sh</strong><br /><br /><span>Fuse will automatically reverse-complement read 2. Pad (N) amount can be adjusted as necessary. This will for example create a full size amplicon that can be used for alignments.</span><br /><br /></p><div><div>Code:</div><pre dir="ltr">fuse.sh in1=r1.fq in2=r2.fq pad=130 out=fused.fq fusepairs</pre></div>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44593/bear-better-emulation-for-artificial-reads</guid>
	<pubDate>Sat, 06 Jul 2024 04:27:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44593/bear-better-emulation-for-artificial-reads</link>
	<title><![CDATA[BEAR: Better Emulation for Artificial Reads]]></title>
	<description><![CDATA[<p dir="auto">Created by Stephen Johnson, Brett Trost, Dr. Jeffrey R. Long, Dr. Anthony Kusalik University of Saskatchewan, Department of Computer Science</p>
<p dir="auto">BEAR is intended to be an easy-to-use collection of scripts for generating simulated WGS metagenomic reads with read lengths, quality scores, error profiles, and species abundances derived from real user-supplied WGS data.</p><p>Address of the bookmark: <a href="https://github.com/sej917/BEAR" rel="nofollow">https://github.com/sej917/BEAR</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34246/unicycler-hybrid-assembly-pipeline-for-bacterial-genomes</guid>
	<pubDate>Fri, 10 Nov 2017 03:58:27 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34246/unicycler-hybrid-assembly-pipeline-for-bacterial-genomes</link>
	<title><![CDATA[Unicycler: Hybrid assembly pipeline for bacterial genomes]]></title>
	<description><![CDATA[<p><span>Unicycler is an assembly pipeline for bacterial genomes. It can assemble&nbsp;</span><a href="http://www.illumina.com/">Illumina</a><span>-only read sets where it functions as a&nbsp;</span><a href="http://cab.spbu.ru/software/spades/">SPAdes</a><span>-optimiser. It can also assembly long-read-only sets (</span><a href="http://www.pacb.com/">PacBio</a><span>&nbsp;or&nbsp;</span><a href="https://nanoporetech.com/">Nanopore</a><span>) where it runs a&nbsp;</span><a href="https://github.com/lh3/miniasm">miniasm</a><span>+</span><a href="https://github.com/isovic/racon">Racon</a><span>&nbsp;pipeline. For the best possible assemblies, give it both Illumina reads&nbsp;</span><em>and</em><span>&nbsp;long reads, and it will conduct a hybrid assembly.</span></p><p>Address of the bookmark: <a href="https://github.com/rrwick/Unicycler" rel="nofollow">https://github.com/rrwick/Unicycler</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34501/dnapipete-de-novo-assembly-annotation-pipeline-for-transposable-elements</guid>
	<pubDate>Sat, 02 Dec 2017 18:25:44 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34501/dnapipete-de-novo-assembly-annotation-pipeline-for-transposable-elements</link>
	<title><![CDATA[dnaPipeTE: de-novo assembly &amp; annotation Pipeline for Transposable Elements]]></title>
	<description><![CDATA[<p>dnaPipeTE (for de-novo assembly &amp; annotation Pipeline for Transposable Elements), is a pipeline designed to find, annotate and quantify Transposable Elements in small samples of NGS datasets. It is very useful to quantify the proportion of TEs in newly sequenced genomes since it does not require genome assembly and works on small datasets (&lt; 1X).</p>
<ul>
<li>
<p>dnaPipeTE is developped by Cl&eacute;ment Goubert, Laurent Modolo and the TREEP team of the LBBE:&nbsp;<a href="http://lbbe.univ-lyon1.fr/-Equipe-Elements-transposables-.html?lang=en">http://lbbe.univ-lyon1.fr/-Equipe-Elements-transposables-.html?lang=en</a></p>
</li>
<li>
<p>You can find the original publication in GBE here:&nbsp;<a href="https://academic.oup.com/gbe/article/7/4/1192/533768">https://academic.oup.com/gbe/article/7/4/1192/533768</a></p>
</li>
</ul>
<p><a href="https://github.com/clemgoub/dnaPipeTE/blob/dev/dnaPipefront.png" target="_blank"><img src="https://github.com/clemgoub/dnaPipeTE/raw/dev/dnaPipefront.png" alt="Front" style="border: 0px;"></a><em>output examples of quantification and TE landscape (relative age) produced by dnaPipeTE</em></p>
<p><em>&nbsp;</em></p><p>Address of the bookmark: <a href="https://github.com/clemgoub/dnaPipeTE" rel="nofollow">https://github.com/clemgoub/dnaPipeTE</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36985/swalo-scaffolding-with-assembly-likelihood-optimization</guid>
	<pubDate>Wed, 20 Jun 2018 02:45:16 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36985/swalo-scaffolding-with-assembly-likelihood-optimization</link>
	<title><![CDATA[SWALO: Scaffolding with assembly likelihood optimization]]></title>
	<description><![CDATA[SWALO (scaffolding with assembly likelihood optimization) is a method for scaffolding based on likelihood of genome assemblies computed using generative models for sequencing.

Please email your questions, comments, suggestions, and bug reports to atif.bd@gmail.com.<p>Address of the bookmark: <a href="https://atifrahman.github.io/SWALO/" rel="nofollow">https://atifrahman.github.io/SWALO/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</guid>
	<pubDate>Fri, 20 Jul 2018 10:03:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</link>
	<title><![CDATA[Converting a VCF into a FASTA given some reference !]]></title>
	<description><![CDATA[<p>Samtools/BCFtools (Heng Li) provides a Perl script&nbsp;<a href="https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl"><code>vcfutils.pl</code></a>&nbsp;which does this, the function&nbsp;<code>vcf2fq</code>&nbsp;(lines 469-528)</p><p>This script has been modified by others to convert InDels as well, e.g.&nbsp;<a href="https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl">this</a>&nbsp;by David Eccles</p><pre><code><span>./</span><span>vcf2fq</span><span>.</span><span>pl </span><span>-</span><span>f </span><span>&lt;</span><span>input</span><span>.</span><span>fasta</span><span>&gt;</span><span> </span><span>&lt;</span><span>all</span><span>-</span><span>site</span><span>.</span><span>vcf</span><span>&gt;</span><span> </span><span>&gt;</span><span> </span><span>&lt;</span><span>output</span><span>.</span><span>fastq</span><span>&gt;</span></code></pre><p>https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl</p><p>https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>