<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/34465?offset=80</link>
	<atom:link href="https://bioinformaticsonline.com/related/34465?offset=80" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/31377/groopm-metagenomic-binning-toolset</guid>
	<pubDate>Tue, 07 Mar 2017 08:59:45 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/31377/groopm-metagenomic-binning-toolset</link>
	<title><![CDATA[GroopM: Metagenomic binning toolset]]></title>
	<description><![CDATA[<p>GroopM is a metagenomic binning toolset. It leverages spatio-temoral<br>dynamics (differential coverage) to accurately (and almost automatically)<br>extract population genomes from multi-sample metagenomic datasets.</p>
<p>GroopM is largely parameter-free. Use: groopm -h for more info.</p>
<p>For installation and usage instructions see : http://ecogenomics.github.io/GroopM/</p><p>Address of the bookmark: <a href="https://github.com/ecogenomics/GroopM" rel="nofollow">https://github.com/ecogenomics/GroopM</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/32048/json</guid>
	<pubDate>Tue, 04 Apr 2017 08:02:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/32048/json</link>
	<title><![CDATA[JSON]]></title>
	<description><![CDATA[<p><strong>JSON</strong>&nbsp;(JavaScript Object Notation) is a lightweight data-interchange format. It is easy for humans to read and write. It is easy for machines to parse and generate. It is based on a subset of the&nbsp;<a href="http://javascript.crockford.com/">JavaScript Programming Language</a>,&nbsp;<a href="http://www.ecma-international.org/publications/files/ecma-st/ECMA-262.pdf">Standard ECMA-262 3rd Edition - December 1999</a>. JSON is a text format that is completely language independent but uses conventions that are familiar to programmers of the C-family of languages, including C, C++, C#, Java, JavaScript, Perl, Python, and many others. These properties make JSON an ideal data-interchange language.</p>
<p>JSON is built on two structures:</p>
<ul>
<li>A collection of name/value pairs. In various languages, this is realized as an&nbsp;<em>object</em>, record, struct, dictionary, hash table, keyed list, or associative array.</li>
<li>An ordered list of values. In most languages, this is realized as an&nbsp;<em>array</em>, vector, list, or sequence.</li>
</ul>
<p>These are universal data structures. Virtually all modern programming languages support them in one form or another. It makes sense that a data format that is interchangeable with programming languages also be based on these structures.</p><p>Address of the bookmark: <a href="http://json.org/" rel="nofollow">http://json.org/</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/32465/tetra-nucleotide-analysis</guid>
	<pubDate>Thu, 04 May 2017 05:07:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/32465/tetra-nucleotide-analysis</link>
	<title><![CDATA[Tetra-Nucleotide Analysis]]></title>
	<description><![CDATA[<p>A tetra-nucleotide is a fragment of DNA sequence with 4 bases (e.g. AGTC or TTGG). Pride&nbsp;<em>et al.</em>&nbsp;(2003) showed that the frequency of tetra-nucleotides in bacterial genomes contain useful, albeit weak, phylogenetic signals. Even though tetra-nucleotide analysis (TNA) utilizes the information of whole genome, it is evident that it cannot replace other alignment-based phylogenetic methods such as&nbsp;<a href="https://chunlab.wordpress.com/orthoani/">OrthoANI</a>&nbsp;or&nbsp;16S rRNA phylogeny. However, TNA can be useful for&nbsp;phylogenetic characterization when whole genome or 16S rRNA gene information is not available. For example, a partial genomic fragment obtained from a metagenome can be identified by TNA (Teeling&nbsp;<em>et al.</em>, 2004). TNA is also fast enough that it can be&nbsp;used&nbsp;as a search engine against a large genome database.</p><p>Address of the bookmark: <a href="https://chunlab.wordpress.com/tetra-nucleotide-analysis/" rel="nofollow">https://chunlab.wordpress.com/tetra-nucleotide-analysis/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/32730/ncbi-prokaryotic-genome-annotation-pipeline</guid>
	<pubDate>Tue, 16 May 2017 08:56:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/32730/ncbi-prokaryotic-genome-annotation-pipeline</link>
	<title><![CDATA[NCBI Prokaryotic Genome Annotation Pipeline]]></title>
	<description><![CDATA[<p>NCBI Prokaryotic Genome Annotation Pipeline is designed to annotate bacterial and archaeal genomes (chromosomes and plasmids).</p>
<p>Genome annotation is a multi-level process that includes prediction of protein-coding genes, as well as other functional genome units such as structural RNAs, tRNAs, small RNAs, pseudogenes, control regions, direct and inverted repeats, insertion sequences, transposons and other mobile elements.</p>
<p>NCBI has developed an automatic prokaryotic genome annotation pipeline that combines&nbsp;<em>ab initio</em>&nbsp;gene prediction algorithms with homology based methods. The first version of NCBI Prokaryotic Genome Automatic Annotation Pipeline (PGAAP;&nbsp;<a href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&amp;db=pubmed&amp;dopt=Abstract&amp;list_uids=18416670">see Pubmed Article</a>) developed in 2005 has been replaced with an upgraded version that is capable of processing a larger data volume. You can find a more detailed description of the new version of&nbsp;the pipeline in&nbsp;<a href="https://www.ncbi.nlm.nih.gov/books/NBK174280/">NCBI Handbook chapter</a>. NCBI's annotation pipeline depends on several internal databases and is not currently available for download or use outside of the NCBI environment.</p>
<p>https://www.ncbi.nlm.nih.gov/genome/annotation_prok/</p><p>Address of the bookmark: <a href="https://www.ncbi.nlm.nih.gov/genome/annotation_prok/" rel="nofollow">https://www.ncbi.nlm.nih.gov/genome/annotation_prok/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35635/ete-3-reconstruction-analysis-and-visualization-of-phylogenomic-data</guid>
	<pubDate>Mon, 19 Feb 2018 06:46:15 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35635/ete-3-reconstruction-analysis-and-visualization-of-phylogenomic-data</link>
	<title><![CDATA[ETE 3: Reconstruction, Analysis, and Visualization of Phylogenomic Data]]></title>
	<description><![CDATA[<p><span>ETE v3, featuring numerous improvements in the underlying library of methods, and providing a novel set of standalone tools to perform common tasks in comparative genomics and phylogenetics. </span></p>
<p><span>The new features include </span></p>
<p><span>(i) building gene-based and supermatrix-based phylogenies using a single command, </span></p>
<p><span>(ii) testing and visualizing evolutionary models, </span></p>
<p><span>(iii) calculating distances between trees of different size or including duplications, and </span></p>
<p><span>(iv) providing seamless integration with the NCBI taxonomy database. </span></p>
<p><span>ETE is freely available at&nbsp;</span><a href="http://etetoolkit.org/" target="">http://etetoolkit.org</a></p><p>Address of the bookmark: <a href="http://etetoolkit.org" rel="nofollow">http://etetoolkit.org</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37257/asar-advanced-metagenomic-sequence-analysis-in-r</guid>
	<pubDate>Mon, 09 Jul 2018 05:20:50 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37257/asar-advanced-metagenomic-sequence-analysis-in-r</link>
	<title><![CDATA[ASAR: Advanced metagenomic Sequence Analysis in R]]></title>
	<description><![CDATA[<p><span>An interactive data analysis tool for selection, aggregation and visualization of metagenomic data is presented. Functional analysis with a SEED hierarchy and pathway diagram based on KEGG orthology based upon MG-RAST annotation results is available.</span></p>
<p><span><span>To read the manual, please click the link&nbsp;</span><a href="https://askarbek-orakov.github.io/ASAR/">https://askarbek-orakov.github.io/ASAR/</a></span></p><p>Address of the bookmark: <a href="https://github.com/Askarbek-orakov/ASAR" rel="nofollow">https://github.com/Askarbek-orakov/ASAR</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39875/lrsday-long-read-sequencing-data-analysis-for-yeasts</guid>
	<pubDate>Mon, 26 Aug 2019 18:07:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39875/lrsday-long-read-sequencing-data-analysis-for-yeasts</link>
	<title><![CDATA[LRSDAY: Long-read Sequencing Data Analysis for Yeasts]]></title>
	<description><![CDATA[<p><span>Long-read sequencing technologies have become increasingly popular in genome projects due to their strengths in resolving complex genomic regions. As a leading model organism with small genome size and great biotechnological importance, the budding yeast,&nbsp;</span><em>Saccharomyces cerevisiae</em><span>, has many isolates currently being sequenced with long reads.&nbsp;</span></p><p>Address of the bookmark: <a href="https://github.com/yjx1217/LRSDAY" rel="nofollow">https://github.com/yjx1217/LRSDAY</a></p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42419/biojupies-automatically-generates-rna-seq-data-analysis-notebooks</guid>
	<pubDate>Sun, 20 Dec 2020 11:43:45 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42419/biojupies-automatically-generates-rna-seq-data-analysis-notebooks</link>
	<title><![CDATA[BioJupies: Automatically Generates RNA-seq Data Analysis Notebooks]]></title>
	<description><![CDATA[<p>With BioJupies you can produce in seconds a customized, reusable, and interactive report from your own raw or processed RNA-seq data through a simple user interface</p>
<p>BioJupies now supports user accounts! Sign in from the top right corner of the page for access to unlimited private notebooks, RNA-seq datasets and alignment jobs.</p><p>Address of the bookmark: <a href="https://amp.pharm.mssm.edu/biojupies/" rel="nofollow">https://amp.pharm.mssm.edu/biojupies/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44470/phyloherb-phylogenomic-analysis-pipeline-for-herbarium-specimens</guid>
	<pubDate>Wed, 21 Feb 2024 06:15:13 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44470/phyloherb-phylogenomic-analysis-pipeline-for-herbarium-specimens</link>
	<title><![CDATA[PhyloHerb: Phylogenomic Analysis Pipeline for Herbarium Specimens]]></title>
	<description><![CDATA[<p><span>What is PhyloHerb</span><span>: PhyloHerb is a wrapper program to process&nbsp;</span><span>genome skimming</span><span>&nbsp;data collected from plant materials. The outcomes include the plastid genome (plastome) assemblies, mitochondrial genome assemblies, nuclear ribosomal DNAs (NTS+ETS+18S+ITS1+5.8S+ITS2+28S), alignments of gene and intergenic regions, and a species tree. It is designed to be a high throughput program dealing with lower quality data. Examples include&nbsp;</span><span>low-coverage (5x cpDNA) plastome phylogeny, recycling plastid genes from target enrichment data, retrieving low-copy nuclear genes from medium coverage (5x nucDNA) genome skimming</span><span>.</span></p><p>Address of the bookmark: <a href="https://github.com/lmcai/PhyloHerb/" rel="nofollow">https://github.com/lmcai/PhyloHerb/</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</guid>
	<pubDate>Fri, 13 Dec 2024 11:41:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</link>
	<title><![CDATA[Step-by-Step Guide to Detect piRNAs Using Bioinformatics]]></title>
	<description><![CDATA[<p>Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNAs that play crucial roles in silencing transposable elements and regulating gene expression, particularly in germline cells. Detecting piRNAs involves identifying their unique characteristics, such as size, sequence motifs, and association with Piwi proteins, from high-throughput RNA sequencing data.</p><p>This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.</p><h4><strong>Step 1: Prepare Your Data</strong></h4><ol>
<li>
<p><strong>Obtain RNA Sequencing Data</strong><br />Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like <strong>NCBI SRA</strong>, <strong>EMBL-EBI</strong>, or specific small RNA sequencing projects.</p>
</li>
<li>
<p><strong>Quality Control (QC)</strong><br />Use <strong>FastQC</strong> to assess the quality of raw reads:</p>
<div>
<div dir="ltr"><code>fastqc reads.fastq </code></div>
</div>
<p>Evaluate the per-base quality, adapter content, and overrepresented sequences.</p>
</li>
<li>
<p><strong>Trimming and Adapter Removal</strong><br />Use tools like <strong>Cutadapt</strong> or <strong>Trim Galore!</strong> to remove adapters and low-quality bases:</p>
<div>
<div dir="ltr"><code>cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq </code></div>
</div>
<p>Ensure the remaining reads are of high quality for downstream analysis.</p>
</li>
</ol><h4><strong>Step 2: Map Reads to the Genome</strong></h4><p>Mapping reads to the reference genome is crucial for identifying piRNA loci.</p><ol>
<li>
<p><strong>Reference Genome Preparation</strong><br />Download the genome assembly of your organism from databases like <strong>Ensembl</strong>, <strong>UCSC Genome Browser</strong>, or <strong>NCBI</strong>.</p>
</li>
<li>
<p><strong>Align Reads</strong><br />Use <strong>Bowtie</strong> or <strong>STAR</strong> for small RNA alignment:</p>
<div>
<div dir="ltr"><code>bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam </code></div>
</div>
<ul>
<li><code>-v 1</code>: Allows one mismatch.</li>
<li><code>-k 1</code>: Reports the best alignment.</li>
</ul>
</li>
<li>
<p><strong>Convert SAM to BAM</strong><br />Convert and sort alignments using <strong>SAMtools</strong>:</p>
<div>
<div dir="ltr"><code>samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam </code></div>
</div>
</li>
</ol><h4><strong>Step 3: Identify Small RNAs</strong></h4><p>piRNAs are characterized by their size (24&ndash;32 nt) and strand bias.</p><ol>
<li>
<p><strong>Extract Reads by Size</strong><br />Use tools like <strong>BEDtools</strong> or custom scripts to filter reads between 24 and 32 nt:</p>
<div>
<div dir="ltr"><code>bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq &gt; piRNA_size_reads.fastq </code></div>
</div>
</li>
<li>
<p><strong>Check for Sequence Bias</strong><br />piRNAs often have a strong bias for a uridine at the 5&rsquo; end (1U bias). Use tools like <strong>WebLogo</strong> to visualize sequence motifs.</p>
</li>
</ol><h4><strong>Step 4: Detect Ping-Pong Signature</strong></h4><p>The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.</p><ol>
<li>
<p><strong>Generate Overlap Statistics</strong><br />Use the <strong>piPipes</strong> tool or custom scripts to calculate overlap:</p>
<div>
<div dir="ltr"><code>python ping_pong_overlap.py sorted_reads.bam </code></div>
</div>
</li>
<li>
<p><strong>Visualize Overlap Distribution</strong><br />Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.</p>
</li>
</ol><h4><strong>Step 5: Annotate piRNA Clusters</strong></h4><p>piRNAs are often generated from genomic clusters.</p><ol>
<li>
<p><strong>Cluster Identification</strong><br />Use tools like <strong>proTRAC</strong> or <strong>PIRANHA</strong> to identify piRNA-producing clusters:</p>
<div>
<div dir="ltr"><code>proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters </code></div>
</div>
</li>
<li>
<p><strong>Annotate Genomic Regions</strong><br />Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like <strong>BEDtools intersect</strong> can help associate piRNA clusters with genes or transposable elements:</p>
<div>
<div dir="ltr"><code>bedtools intersect -a clusters.bed -b genome_annotation.gtf &gt; annotated_clusters.bed </code></div>
</div>
</li>
</ol><h4><strong>Step 6: Functional Analysis</strong></h4><p>Functional analysis of piRNAs can uncover their targets and regulatory roles.</p><ol>
<li>
<p><strong>Predict piRNA Targets</strong><br />Use tools like <strong>IntaRNA</strong> or <strong>RNAhybrid</strong> to predict interactions between piRNAs and potential target mRNAs:</p>
<div>
<div dir="ltr"><code>RNAhybrid -t target_transcripts.fa -q piRNAs.fa &gt; piRNA_targets.txt </code></div>
</div>
</li>
<li>
<p><strong>Enrichment Analysis</strong><br />Perform GO or KEGG enrichment analysis of target genes using tools like <strong>g:Profiler</strong> or <strong>DAVID</strong>.</p>
</li>
</ol><h4><strong>Step 7: Validation and Visualization</strong></h4><ol>
<li>
<p><strong>Validate piRNA Candidates</strong><br />Cross-check the identified piRNAs against known piRNA databases, such as <strong>piRBase</strong> or <strong>piRNAdb</strong>.</p>
</li>
<li>
<p><strong>Visualize Results</strong></p>
<ul>
<li>Use <strong>IGV</strong> (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.</li>
<li>Generate heatmaps or circos plots to present piRNA distributions.</li>
</ul>
</li>
</ol><h4><strong>Step 8: Share and Publish Findings</strong></h4><ol>
<li>
<p><strong>Archive Data</strong><br />Submit sequencing data to public repositories like <strong>SRA</strong> or <strong>GEO</strong> with metadata specifying piRNA-related experiments.</p>
</li>
<li>
<p><strong>Publish Results</strong><br />Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.</p>
</li>
</ol><h4><strong>Conclusion</strong></h4><p>Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.</p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>

</channel>
</rss>