<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/34475?offset=350</link>
	<atom:link href="https://bioinformaticsonline.com/related/34475?offset=350" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40699/kevler-reference-free-variant-discovery-in-large-eukaryotic-genomes</guid>
	<pubDate>Tue, 28 Jan 2020 03:21:53 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40699/kevler-reference-free-variant-discovery-in-large-eukaryotic-genomes</link>
	<title><![CDATA[Kevler: Reference-free variant discovery in large eukaryotic genomes]]></title>
	<description><![CDATA[<p><span>Welcome to&nbsp;</span><span>kevlar</span><span>, software for predicting&nbsp;</span><em>de novo</em><span>&nbsp;genetic variants without mapping reads to a reference genome! kevlar's&nbsp;</span><em>k</em><span>-mer abundance based method calls single nucleotide variants (SNVs), multinucleotide variants (MNVs), insertion/deletion variants (indels), and structural variants (SVs) simultaneously with a single simple model.&nbsp;</span></p>
<p><span>More at&nbsp;<a href="https://kevlar.readthedocs.io/en/latest/">https://kevlar.readthedocs.io/en/latest/</a></span></p>
<p><span><a href="https://www.cell.com/iscience/pdf/S2589-0042(19)30259-7.pdf">https://www.cell.com/iscience/pdf/S2589-0042(19)30259-7.pdf</a></span></p><p>Address of the bookmark: <a href="https://github.com/kevlar-dev/kevlar" rel="nofollow">https://github.com/kevlar-dev/kevlar</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43826/tiara-deep-learning-based-classification-system-for-eukaryotic-sequences</guid>
	<pubDate>Mon, 14 Mar 2022 23:02:11 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43826/tiara-deep-learning-based-classification-system-for-eukaryotic-sequences</link>
	<title><![CDATA[Tiara: deep learning-based classification system for eukaryotic sequences]]></title>
	<description><![CDATA[<p><span>With a large number of metagenomic datasets becoming available, eukaryotic metagenomics emerged as a new challenge. The proper classification of eukaryotic nuclear and organellar genomes is an essential step toward a better understanding of eukaryotic diversity.</span></p><p>Address of the bookmark: <a href="https://academic.oup.com/bioinformatics/article/38/2/344/6375939" rel="nofollow">https://academic.oup.com/bioinformatics/article/38/2/344/6375939</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/33960/mgra-breakpoint-graphs-and-ancestral-genome-reconstructions</guid>
	<pubDate>Tue, 25 Jul 2017 08:48:25 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/33960/mgra-breakpoint-graphs-and-ancestral-genome-reconstructions</link>
	<title><![CDATA[MGRA: Breakpoint graphs and ancestral genome reconstructions]]></title>
	<description><![CDATA[<p>MGRA (Multiple Genome Rearrangements and Ancestors) is a tool for reconstruction of ancestor genomes and evolutionary history of extant genomes.</p>
<p>It takes as an input a set of genomes represented as sequences of genes (or synteny blocks) and produces such sequences for ancestral genomes at the internal nodes of the phylogenetic tree.</p>
<p>The phylogenetic tree may be also specified completely or partially, in the latter case MGRA can reconstruct conserved ancestral regions (CARs) of the ancestral genome of interest.</p>
<p>Since version 2 MGRA supports gene insertion and deletions in addition to genome rearrangements and allows the input genomes to have different gene content.</p>
<p>It also can reconstruct most plausible phylogenetic tree based on the rearrangement characters.</p><p>Address of the bookmark: <a href="http://mgra.cblab.org/" rel="nofollow">http://mgra.cblab.org/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34377/genomicus-genome-browser-that-enables-users-to-navigate-in-genomes-in-several-dimensions</guid>
	<pubDate>Sat, 18 Nov 2017 16:10:16 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34377/genomicus-genome-browser-that-enables-users-to-navigate-in-genomes-in-several-dimensions</link>
	<title><![CDATA[Genomicus: genome browser that enables users to navigate in genomes in several dimensions]]></title>
	<description><![CDATA[<p>Genomicus is a genome browser that enables users to navigate in genomes in several dimensions: linearly along chromosome axes, transversaly across different species, and chronologicaly along evolutionary time.</p>
<p>Once a query gene has been entered, it is displayed in its genomic context in parallel to the genomic context of all its orthologous and paralogous copies in all the other sequenced metazoan genomes. Moreover, Genomicus stores and displays the predicted ancestral genome structure in all the ancestral species within the phylogenetic range of interest.</p>
<p>All the data on extant species displayed in this browser are from&nbsp;<a href="http://www.ensembl.org/">Ensembl</a>.</p><p>Address of the bookmark: <a href="http://genomicus.biologie.ens.fr/genomicus-90.01/cgi-bin/search.pl" rel="nofollow">http://genomicus.biologie.ens.fr/genomicus-90.01/cgi-bin/search.pl</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34569/ksnp30-snp-detection-and-phylogenetic-analysis-of-genomes-without-genome-alignment-or-reference-genome</guid>
	<pubDate>Fri, 08 Dec 2017 16:48:40 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34569/ksnp30-snp-detection-and-phylogenetic-analysis-of-genomes-without-genome-alignment-or-reference-genome</link>
	<title><![CDATA[kSNP3.0: SNP detection and phylogenetic analysis of genomes without genome alignment or reference genome]]></title>
	<description><![CDATA[<p><span>Sept. 20, 2017 Version 3.1 released. Major upgrade. Version 3.1 fixes the problems with SNP annotation that arose when NCBI discontinued use of GI numbers. Please read carefully the Preface (page 3) and the File of annotated genomes section (pages 9-10) in the version 3.1 User Guide. Thanks to Tom Slezak for revsing the get_genbank_file3 script and to Tod Stuber (USDA) for testing version 3.1 even though he doesn't need the annotation feature. All users are encouraged to upgrade to version 3.1.&nbsp;<br></span></p><p>Address of the bookmark: <a href="https://sourceforge.net/projects/ksnp/files/" rel="nofollow">https://sourceforge.net/projects/ksnp/files/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34715/delta-a-new-web-based-3d-genome-visualization-and-analysis-platform</guid>
	<pubDate>Wed, 20 Dec 2017 08:49:55 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34715/delta-a-new-web-based-3d-genome-visualization-and-analysis-platform</link>
	<title><![CDATA[Delta: a new Web-based 3D genome visualization and analysis platform]]></title>
	<description><![CDATA[<p><em>Delta</em><span>&nbsp;is an integrative visualization and analysis platform to facilitate visually annotating and exploring the 3D physical architecture of genomes.&nbsp;</span><em>Delta</em><span>&nbsp;takes Hi-C or ChIA-PET contact matrix as input and predicts the topologically associating domains and chromatin loops in the genome. It then generates a physical 3D model which represents the plausible consensus 3D structure of the genome.&nbsp;</span><em>Delta</em><span>features a highly interactive visualization tool which enhances the integration of genome topology/physical structure with extensive genome annotation by juxtaposing the 3D model with diverse genomic assay outputs.</span></p>
<p>https://github.com/zhangzhwlab/delta</p><p>Address of the bookmark: <a href="https://github.com/zhangzhwlab/delta" rel="nofollow">https://github.com/zhangzhwlab/delta</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35384/mgcv-the-microbial-genomic-context-viewer-for-comparative-genome-analysis</guid>
	<pubDate>Mon, 29 Jan 2018 04:55:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35384/mgcv-the-microbial-genomic-context-viewer-for-comparative-genome-analysis</link>
	<title><![CDATA[MGcV: the microbial genomic context viewer for comparative genome analysis]]></title>
	<description><![CDATA[<p><span>MGcV is an interactive web-based visalization tool tailored to facilitate small scale genome analysis. To start using MGcV:</span></p>
<ol>
<li>Supply your genes/genomic segments/phylogenetic tree of interest in the input-box by
<ul>
<li>selecting the type of identifier and pasting identifiers (one per line)</li>
<li><em><strong>or</strong></em>&nbsp;by using the&nbsp;<a>gene ID search tool</a></li>
<li><em><strong>or</strong></em>&nbsp;with the&nbsp;<a>BLAST search tool</a></li>
</ul>
</li>
<li>Click "Visualize context".</li>
</ol>
<p><span>Consult the&nbsp;</span><a href="http://mgcv.cmbi.ru.nl/help.html" target="_blank">documentation</a><span>&nbsp;to learn more about MGcV.</span></p><p>Address of the bookmark: <a href="http://mgcv.cmbi.ru.nl/" rel="nofollow">http://mgcv.cmbi.ru.nl/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41158/carefully-opt-for-human-reference-genome</guid>
	<pubDate>Tue, 18 Feb 2020 07:43:32 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41158/carefully-opt-for-human-reference-genome</link>
	<title><![CDATA[Carefully opt for human reference genome]]></title>
	<description><![CDATA[<p><a href="http://lh3.github.io/2017/11/13/which-human-reference-genome-to-use" target="_blank">Heng Li posted several issues with the human reference genomes given in these resources</a> and suggests the following compressed FASTA file to be used as hg38/GRCh38 human reference genome.</p>
<p>if you map reads to GRCh38 or hg38, use the following:</p>
<div>
<div>
<pre><code>ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/405/GCA_000001405.15_GRCh38/seqs_for_alignment_pipelines.ucsc_ids/GCA_000001405.15_GRCh38_no_alt_analysis_set.fna.gz
</code></pre>
</div>
</div>
<p>There are several other versions of GRCh37/GRCh38. What&rsquo;s wrong with them? Here are a collection of potential issues:</p>
<p>More at http://lh3.github.io/2017/11/13/which-human-reference-genome-to-use</p><p>Address of the bookmark: <a href="http://lh3.github.io/2017/11/13/which-human-reference-genome-to-use" rel="nofollow">http://lh3.github.io/2017/11/13/which-human-reference-genome-to-use</a></p>]]></description>
	<dc:creator>biogeek</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</guid>
	<pubDate>Thu, 31 May 2018 06:00:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</link>
	<title><![CDATA[CrossMap: a program for convenient conversion of genome coordinates]]></title>
	<description><![CDATA[CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) &lt;&gt; hg19 (GRCh37), Mouse mm9 (MGSCv37) &lt;&gt; mm10 (GRCm38)).

It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF.

CrossMap is designed to liftover genome coordinates between assemblies. 

It’s not a program for aligning sequences to reference genome.

We do not recommend using CrossMap to convert genome coordinates between species.<p>Address of the bookmark: <a href="http://crossmap.sourceforge.net" rel="nofollow">http://crossmap.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>