Address of the bookmark: https://github.com/alastair-droop/fqtools

• Speed: Prodigal is an extremely fast gene recognition tool (written in very vanilla C). It can analyze an entire microbial genome in 30 seconds or less.
• Accuracy: Prodigal is a highly accurate gene finder. It correctly locates the 3' end of every gene in the experimentally verified Ecogene data set (except those containing introns). It possesses a very sophisticated ribosomal binding site scoring system that enables it to locate the translation initiation site with great accuracy (96% of the 5' ends in the Ecogene data set are located correctly).
• Specificity: Prodigal's false positive rate compares favorably with other gene identification programs, and usually falls under 5%.
• GC-Content Indifferent: Prodigal performs well even in high GC genomes, with over a 90% perfect match (5'+3') to the Pseudomonas aeruginosa curated annotations.
• Metagenomic Version: Prodigal can run in metagenomic mode and analyze sequences even when the organism is unknown.
• Ease of Use: Prodigal can be run in one step on a single genomic sequence or on a draft genome containing many sequences. It does not need to be supplied with any knowledge of the organism, as it learns all the properties it needs to on its own.
• Open Source: Prodigal source code is freely available under the General Public License.

Address of the bookmark: http://prodigal.ornl.gov/

JSON is built on two structures:

• A collection of name/value pairs. In various languages, this is realized as an object, record, struct, dictionary, hash table, keyed list, or associative array.
• An ordered list of values. In most languages, this is realized as an array, vector, list, or sequence.

These are universal data structures. Virtually all modern programming languages support them in one form or another. It makes sense that a data format that is interchangeable with programming languages also be based on these structures.

Address of the bookmark: http://json.org/

Address of the bookmark: https://chunlab.wordpress.com/tetra-nucleotide-analysis/

Address of the bookmark: https://github.com/lmcai/PhyloHerb/

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

Address of the bookmark: https://pgapx.ybzhao.com/

The bpRNA code is written in perl and requires the Graph perl module. Several additional scripts for analysis are included. The source code is available at http://github.com/hendrixlab/bpRNA.

Address of the bookmark: http://github.com/hendrixlab/bpRNA

Other tools

https://github.com/shenwei356/taxonkit

• ETE, version: 3.1.1
• BioPython, version: 1.73
• taxadb, version: 0.10.1
• TaxonKit, version: 0.5.0

Address of the bookmark: https://pypi.org/project/ete3/3.1.1/

Currently, netGO supports analysis for four species (Human, Mouse, Arabidopsis thaliana,and Yeast)
These data are available from netGO-Data repository.

https://academic.oup.com/bioinformatics/advance-article/doi/10.1093/bioinformatics/btaa077/5728635

Address of the bookmark: https://github.com/unistbig/netGO