BOL: Related items

‘dockr’: the R container

Jit — Mon, 23 Dec 2019 09:56:49 -0600

dockr 0.8.6 is now available on CRAN. dockr is a minimal toolkit to build a lightweight Docker container image for your R package, in which the package itself is available. The Docker image seeks to mirror your R session as close as possible with respect to R specific dependencies. Both dependencies on CRAN R packages as well as local non-CRAN R packages will be included in the Docker container image.

If you want to know, how Docker works, and why you should consider using Docker, please take a look at the Docker website.

Address of the bookmark: https://www.docker.com/why-docker

Post Doc Computational Biology, Bioinformatics - Network Biology & Data Science, NGS (m/f/d)

Sat, 15 Feb 2020 06:13:35 -0600

https://www.jobvector.de/jobs-stellenangebote/biologie-life-sciences/forschung-entwicklung/post-doc-computational-biology-bioinformatics-network-biology-data-science-ngs-129867.html?suid=e522e9793b41817e52ac58d6963b94e2519920df

Requirements
Doctoral degree in Bioinformatics, Computational Biology, (Bio)physics/-mathematics, Biochemistry/Biology or similar with strong quantitative and numeric focus
Ability to numerically process complex and large data sets
Good programming skills (R/Bioconductor and/or Python preferred, Linux is a plus)
Experience in analyzing next-generation sequencing data sets using network biology
Scientific publication record in applied bioinformatics
Familiarity with single cell NGS analyses and other –omics techniques is a plus, but not essential

GeneMates: an R package for Detecting Horizontal Gene Co-transfer between Bacteria Using Gene-gene Associations Controlled for Population Structure

Rahul Nayak — Sat, 07 Mar 2020 05:52:20 -0600

GeneMates is an R package implementing a network approach to identify horizontal gene co-transfer (HGcoT) between bacteria using whole-genome sequencing (WGS) data. It is particularly useful for investigating intra-species HGcoT, where presence-absence status of acquired genes is usually confounded by bacterial population structure due to clonal reproduction.

https://www.biorxiv.org/content/10.1101/2020.02.29.970970v1

Address of the bookmark: https://github.com/wanyuac/GeneMates

CRBHits: From Conditional Reciprocal Best Hits to Codon Alignments and Ka/Ks in R

Shruti Paniwala — Wed, 11 Nov 2020 23:06:03 -0600

CRBHits is a coding sequence (CDS) analysis pipeline in R (R Core Team, 2019). It reimplements the Conditional Reciprocal Best Hit (CRBH) algorithm crb-blast and covers all necessary steps from sequence similarity searches, codon alignments to Ka/Ks calculations and synteny. The new R package targets ecology, population and evolutionary biologists working in the field of comparative genomics.

Address of the bookmark: https://gitlab.gwdg.de/mpievolbio-it/crbhits

Biostats book !

Abhi — Mon, 14 Aug 2023 03:11:39 -0500

https://practical-stats-med-r.netlify.app/

Address of the bookmark: https://practical-stats-med-r.netlify.app/

SVbyEye: R Package to visualize alignments between two or multiple DNA sequences

LEGE — Tue, 17 Sep 2024 02:34:57 -0500

R Package to visualize alignments between two or multiple DNA sequences including
a number of functionalities to facilitate processing of alignments in PAF format.

SVbyEye, an open-source R package to visualize and annotate sequence-to-sequence alignments along with various functionalities to process alignments in PAF format. The tool facilitates the characterization of complex SVs in the context of sequence homology helping resolve the mechanisms underlying their formation. Availability and implementation SVbyEye is available at https://github.com/daewoooo/SVbyEye.

Author: David Porubsky

Address of the bookmark: https://github.com/daewoooo/SVbyEye

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

BioToolbox

Jit — Fri, 19 Feb 2016 09:14:44 -0600

This is a collection of libraries and high-quality end-user scripts for bioinformatic analysis, including working with gene annotation, collecting data scores from a variety of modern file formats, and conversion between file formats. The Bio::ToolBox libraries provide a unified, abstracted interface to multiple common gene annotation formats and the collection of data from multiple data files. They rely on BioPerl SeqFeature libraries and related adaptors to access binary file formats including Bam, BigWig, BigBed, and USeq. The Bio::ToolBox package includes scripts for setting up databases of annotation, collecting annotated features, collecting genomic data relative to features, manipulating and analyzing data, and data format conversion.

More at http://cpansearch.perl.org/src/TJPARNELL/

Address of the bookmark: http://cpansearch.perl.org/src/TJPARNELL/

Run bash script in Perl program !

Neel — Sat, 27 Feb 2021 01:42:23 -0600

BioPerl is a compilation of Perl modules that can be used to build bioinformatics-related Perl scripts. It is used, for example, in the development of source codes, standalone software/tools, and algorithms in bioinformatics programmes. Different modules are easy to instal and include, making it easier to perform different functions. Despite the fact that Python is commonly favoured over Perl, some bioinformatics software, such as the standalone version of 'alienomics', is written in Perl. Often it's a major problem for beginners to execute certain Unix/shell commands in Perl script, so it's hard to determine which feature is unique to a situation.

Perl provides various features and operators for the execution of external commands (described as follows), which are unique in their own way.

They vary slightly from one another, making it difficult for Perl beginners to choose between them.

1. IPC::Open2

More at https://bioinformaticsonline.com/snippets/view/42919/perl-ipcopen2-module

2. exec””

syntax: exec "command";

It's a Perl function (perlfunc) that executes a command but never returns, similar to a function's return statement.

While running the command, it keeps processing the script and does not wait until it finishes first, returns false when the command is not found, but never returns true.

3. Backticks “ or qx//

syntax: `command`;

syntax: qx/command/;

It's a Perl operator (perlop) that executes a command and then resumes the Perl script once the command has ended, but the return value is the command's STDOUT.

4. IPC::Open3

syntax: $output = open3(\*CHLD_IN, \*CHLD_OUT, \*CHLD_ERR, 'command arg1 arg2', 'optarg',...);

It is very similar to IPC::Open2 with the capability to capture all three file handles of the process, i.e., STDIN, STDOUT, and STDERR. It can also be used with or without the shell. You can read about it more in the documentation: IPC::Open3.

$output = open3(my $o ut, my $in, 'command arg1 arg2');

OR without using the shell

$output = open3(my $out, my $in, 'command', 'arg1', 'arg2');

5.a2p

syntax: a2p [options] [awkscript]

There is a Perl utility known as a2p which translates awk command to Perl. It takes awk script as input and generates a comparable Perl script as the output. Suppose, you want to execute the following awk statement

awk '{$1 = ""; $2 = ""; print}' f1.txt

This statement gives error sometimes even after escaping the variables (\$1, \$2) but by using a2p it can be easily converted to Perl script:

For further information, you can read it’s documentation: a2p

More help at https://bioinformaticsonline.com/snippets/view/42920/perl-script-to-run-awk-inside-perl

6. system()

syntax: system( "command" );

It is also a Perl function (perlfunc) that executes a command and waits for it to get finished first and then resume the Perl script. The return value is the exit status of the command. It can be called in two ways:

system( "command arg1 arg2" );

system( "command", "arg1", "arg2" );

HELP

Here are some useful Perl cheat sheets that can be used as a quick reference guide.-- https://www.pcwdld.com/perl-cheat-sheet