Prokka – Standalone command line tool, takes just a few minutes per genome. This is the best way to get good quality annotation in a flash, which is particularly useful if you have loads of genomes or need to annotate a pangenome or metagenome. Note however that the quality of functional information is not as good as RAST, and you will need several extra steps if you want to do functional profiling and pathway analysis of your genome(s)… which is in-built in RAST.

NCBI Prokaryotic Genome Annotation Pipeline is designed to annotate bacterial and archaeal genomes (chromosomes and plasmids).

Genome annotation is a multi-level process that includes prediction of protein-coding genes, as well as other functional genome units such as structural RNAs, tRNAs, small RNAs, pseudogenes, control regions, direct and inverted repeats, insertion sequences, transposons and other mobile elements.

PGAP: NCBI has developed an automatic prokaryotic genome annotation pipeline that combines ab initio gene prediction algorithms with homology based methods. The first version of NCBI Prokaryotic Genome Automatic Annotation Pipeline (PGAAP; see Pubmed Article) developed in 2005 has been replaced with an upgraded version that is capable of processing a larger data volume.  NCBI's annotation pipeline depends on several internal databases and is not currently available for download or use outside of the NCBI environment.

BEACON (automated tool for Bacterial GEnome Annotation ComparisON), a fast tool for an automated and a systematic comparison of different annotations of single genomes. The extended annotation assigns putative functions to many genes with unknown functions. BEACON is available under GNU General Public License version 3.0 and is accessible at: http://www.cbrc.kaust.edu.sa/BEACON/.

BlastKOLA: Assigns K numbers to the user's sequence data by BLAST searches, respectively, against a nonredundant set of KEGG GENES. KOALA (KEGG Orthology And Links Annotation) is KEGG's internal annotation tool for K number assignment of KEGG GENES using SSEARCH computation. Annotate Sequence in KEGG Mapper and Pathogen Checker in KEGG Pathogen are special interfaces to this server and can be executed in an interactive mode. BlastKOALA is suitable for annotating fully sequenced genomes.

PAGIT: Provides a toolkit for improving the quality of genome assemblies created via an assembly software. PAGIT compiled four tools: (i) ABACAS which classifies and orientates contigs and estimates the sizes of gaps between them; (ii) IMAGE uses paired-end reads to extend contigs and close gaps within the scaffolds; (iii) ICORN for identifying and correcting small errors in consensus sequences and; (iv) RATT for help annotation. The software was mainly created to analyze parasite genomes of up to about 300 Mb.

MAKER: A portable and easily configurable genome annotation pipeline. MAKER allows smaller eukaryotic and prokaryotic genome projects to independently annotate their genomes and to create genome databases. It identifies repeats, aligns ESTs and proteins to a genome, produces ab-initio gene predictions and automatically synthesizes these data into gene annotations having evidence-based quality values. MAKER's inputs are minimal and its ouputs can be directly loaded into a Generic Model Organism Database (GMOD). They can also be viewed in the Apollo genome browser; this feature of MAKER provides an easy means to annotate, view and edit individual contigs and BACs without the overhead of a database. MAKER is available for download and can be tested online via the MAKER Web Annotation Service (MWAS).

MyPro is a software pipeline for high-quality prokaryotic genome assembly and annotation. It was validated on 18 oral streptococcal strains to produce submission-ready, annotated draft genomes. MyPro installed as a virtual machine and supported by updated databases will enable biologists to perform quality prokaryotic genome assembly and annotation with ease.

https://www.nature.com/articles/nmeth.4556

Address of the bookmark: https://github.com/ryanlayer/giggle

Address of the bookmark: https://mummer4.github.io/

Address of the bookmark: http://www.h-invitational.jp/g-compass/

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

minimap -t 24 assembly.fasta long_reads.fastq.gz | racon -t 24 long_reads.fastq.gz - assembly.fasta racon_assembly.fasta
nucmer -p nucmer assembly.fasta racon_assembly.fasta
show-snps -C -T -r nucmer.delta

This reports Racon's changes in a table. You can exclude indels with the -I option in show-snps. 

This process (Racon -> MUMmer -> SNP table) solves the problem I originally raised in this issue. So as far as I'm concerned, you can close this issue (or keep it open if you still want to implement some kind of variant table).

Address of the bookmark: http://mitos.bioinf.uni-leipzig.de/index.py

Since ASCIIGenome does not require a graphical interface it is particularly useful for quickly visualizing genomic data on remote servers while offering flexibility similar to popular GUI viewers like IGV.

Documentation is at readthedocs/asciigenome.

Address of the bookmark: https://github.com/dariober/ASCIIGenome

Features

• Linear representation of several segments of DNA
• Comparisons represented by areas between the segments (like Artemis, for example)
• Reads from common formats: Genbank, EMBL, blast, Mauve, and from user-generated tab files
• Plot several subsegments of the same segment on the same line, separated by a //
• Automatic or manual placement of the segments on the plot
• Add annotations to all the lines
• Create smart, automatic annotations for genomes, based on gene names
• Add a user-generated tree
• Add a global scale or a scale to each line
• Use user-defined graphical functions to represent genes

Address of the bookmark: http://genoplotr.r-forge.r-project.org/