BOL: Related items

List of cancer genomics research web resources !

biogeek — Wed, 27 Dec 2017 20:33:09 -0600

Major web resources for cancer genomics research

CGHub
https://cghub.ucsc.edu/
Comprehensive data repository; huge data size

EGA
https://www.ebi.ac.uk/ega/
Comprehensive data repository; huge data size

COSMIC
http://cancer.sanger.ac.uk
Largest somatic mutation database; genome sequencing paper curation

CPRG
http://www.broadinstitute.org/software/cprg
Interface for cancer program resources

GDAC
http://gdac.broadinstitute.org/
Data analysis; automatic pipelines; user-friendly reports

SNP500Cancer
http://snp500cancer.nci.nih.gov
Sequence and genotype verification of SNPs

canEvolve
www.canevolve.org/
Comprehensive analysis of tumor profile; Data from 90 studies involving more than 10,000 patients

MethyCancer
http://methycancer.psych.ac.cn
Relationship among DNA methylation, gene expression and cancer

SomamiR
http://compbio.uthsc.edu/SomamiR/
Correlation between somatic mutation and microRNA; genome-wide displaying

cBioPortal
http://www.cbioportal.org/public-portal/
Graphical summaries; gene alteration; processed data; visualization

UCSC Cancer Genomics Browser
https://genome-cancer.soe.ucsc.edu/
Clinical information; gene expression; copy number variation; visualization

CGWB
https://cgwb.nci.nih.gov/
Visualization; gene mutation and variation; automated analysis pipeline

GDSC
http://www.cancerrxgene.org
Drug sensitivity information; drug response information

canSAR
https://cansar.icr.ac.uk/
Multidisciplinary information; drug discovery

NONCODE
http://www.noncode.org/ ncRNAs;
lncRNAs; up-to-date and comprehensive resource

GenoViz: Visualization software for genomics

Rahul Nayak — Wed, 02 Jan 2019 04:07:57 -0600

GenoViz provides software applications and re-usable components for data visualization and data sharing in genomics. Our flagship product is Integrated Genome Browser (IGB).

For more information about IGB, visit http://bioviz.org.

Source code for the project was hosted here for many years. In 2014, we moved to a new git repository at http://www.bitbucket.org/lorainelab/integrated-genome-browser. We are still using SourceForge to distribute new releases of IGB as compiled code (igb.zip) you can use to run IGB on your computer.

If you have questions, feel free to get in touch. Contact project head Ann Loraine (aloraine@uncc.edu) or lead developer David Norris (dcnorris@uncc.edu>).

Address of the bookmark: https://sourceforge.net/projects/genoviz/

genomics public data links !

Jit — Thu, 13 Feb 2020 00:20:00 -0600

List of publically available databases on google server.

More at https://software.broadinstitute.org/gatk/download/bundle

ftp://ftp.ncbi.nlm.nih.gov/snp/organisms/human_9606/VCF/GATK/.

ftp://ftp.broadinstitute.org/bundle/hg38/hg38bundle/

Address of the bookmark: https://console.cloud.google.com/storage/browser/genomics-public-data/resources/broad/hg38/v0?pli=1

Project Associate-I | Project Associate-II | Senior Project Associate @ IGIB

Thu, 05 Aug 2021 16:11:32 -0500

Experience in Next Generation Sequencing (NGS) application and interest in Genomics/ Clinical / Translational Applications. OR Good computational programming skills and deep interest in working on interface of Genomics and Clinical application.

Project Scientist-I
Experimental / Computation analysis experience in highthroughput genomics/ clinical application.

Project Manager
Experience in handling large biological projects involving high-throughput genomics/ clinical application.

Scientific Administrative Assistant
Lab Work.

More at https://vinodscaria.genomes.in/positionsopen

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

Advanced Bash-Scripting Guide

Jit — Thu, 18 Feb 2016 04:50:51 -0600

This tutorial assumes no previous knowledge of scripting or programming, yet progresses rapidly toward an intermediate/advanced level of instruction . . . all the while sneaking in little nuggets of UNIX® wisdom and lore. It serves as a textbook, a manual for self-study, and as a reference and source of knowledge on shell scripting techniques. The exercises and heavily-commented examples invite active reader participation, under the premise that the only way to really learn scripting is to write scripts.

This book is suitable for classroom use as a general introduction to programming concepts.

More at http://tldp.org/LDP/abs/html/

Address of the bookmark: http://tldp.org/LDP/abs/html/

fineSTRUCTURE v2 & GLOBETROTTER

Shruti Paniwala — Mon, 13 Feb 2017 08:40:23 -0600

Software available at this site

FineSTRUCTURE version 2, a pipeline for running ChromoPainter and FineSTRUCTURE for population inference. A GUI is available for interpretation. Download from the Downloads page.
FineSTRUCTURE R scripts, a facility for exploring the results when the GUI is unavailable.
GLOBETROTTER, the admixture dating method based on ChromoPainter. Download from the Downloads page.
AdmixturePainting, A set of R tools to inmterpret the results of ADMIXTURE and STRUCTURE-like mixture models.
RADpainter, finestructure and ChromoPainter for RAD tag data used for non-model organisms.
Scripts to perform many types of conversion. Included in the main software download from the Downloads page.

What this page is This page provides information about and downloads for methodology for Chromosome Painting. It is not a facility to analyse your genome. Sorry if you were misled by the punchy name!
About Chromosome Painting Painting is an efficient way of identifying important haplotype information from dense genotype data. It describes ancestry in an efficient way suitable for a range of further analyses, including population identification and admixture dating.

Address of the bookmark: http://paintmychromosomes.com/

MinION_GC: An R script to do some QC on MinION data

Radha Agarkar — Sun, 03 Dec 2017 15:19:18 -0600

Other tools focus on getting data out of the fastq or fast5 files, which is slow and computationally intensive. The benefit of this approach is that it works on a single, small, .txt summary file. So it's a lot quicker than most other things out there: it takes about a minute to analyse a 4GB flowcell on my laptop.

https://github.com/roblanf/minion_qc

Address of the bookmark: https://github.com/roblanf/minion_qc

MUM&Co is a simple bash script that uses Whole Genome Alignment information provided by MUMmer (v4) to detect variants.

Rahul Nayak — Wed, 27 Apr 2022 04:34:12 -0500

MUM&Co is able to detect:
Deletions, insertions, tandem duplications and tandem contractions (>=50bp & <=150kb)
Inversions (>=1kb) and translocations (>=10kb)

Address of the bookmark: https://github.com/SAMtoBAM/MUMandCo