<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/34546?offset=80</link>
	<atom:link href="https://bioinformaticsonline.com/related/34546?offset=80" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/21150/webinar-on-an-integrated-rna-and-dna-approach-to-unravel-genetic-regulation-in-cancer</guid>
	<pubDate>Wed, 11 Feb 2015 04:59:57 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/21150/webinar-on-an-integrated-rna-and-dna-approach-to-unravel-genetic-regulation-in-cancer</link>
	<title><![CDATA[Webinar on 'An integrated RNA and DNA approach to unravel genetic regulation in cancer']]></title>
	<description><![CDATA[<div><p><strong>Webinar on 'An integrated RNA and DNA approach to unravel genetic regulation in cancer'</strong></p><p><strong>Abstract</strong></p><p>Whole exome DNA sequencing (WES) or whole genome DNA sequencing (WGS) allows detection of mutations and polymorphisms in all exonic and genomic regions, respectively, while messenger RNA sequencing (RNA-Seq) enables quantitative analysis of gene expression. Mutations in the genome result in diverse transcriptional aberrations that can be missed in a stand-alone WES/WGS analysis. An integration of DNA variant analysis and RNA-Seq analysis enables one to investigate the consequences of genomic changes in the RNA transcripts including germline and somatic changes, imprinting, RNA editing and allele specific expression (ASE). In this webinar, we will demonstrate this integrated approach using Strand NGS to identify high confidence mutations, RNA editing events and ASE in cancer.</p><p><strong>Webinar Details</strong></p><table width="100%" border="1" cellspacing="0" cellpadding="0">
<tbody>
<tr>
<td valign="top">
<p style="text-align: center;"><br /> <strong>Sessions</strong></p>
</td>
<td valign="top">
<p style="text-align: center;"><a href="http://www.strand-ngs.com/webinar_registration"><strong>San Francisco Time<br /> (PST)</strong></a></p>
</td>
<td valign="top">
<p style="text-align: center;"><a href="http://www.strand-ngs.com/webinar_registration"><strong>Tokyo Time<br /> (GMT+09:00)</strong></a></p>
</td>
<td valign="top">
<p style="text-align: center;"><a href="http://www.strand-ngs.com/webinar_registration"><strong>Berlin Time<br /> (GMT+01:00)</strong></a></p>
</td>
<td valign="top">
<p style="text-align: center;"><a href="http://www.strand-ngs.com/webinar_registration"><strong>Mumbai Time<br /> (GMT+05:30)</strong></a></p>
</td>
</tr>
<tr>
<td>
<p style="text-align: center;"><a href="http://www.strand-ngs.com/webinar_registration"><strong>Session 1</strong></a></p>
</td>
<td valign="top">
<p style="text-align: center;">25 Feb&nbsp;<br /> 12:30 AM</p>
</td>
<td>
<p style="text-align: center;">25 Feb&nbsp;<br /> 5:30 PM</p>
</td>
<td>
<p style="text-align: center;">25 Feb&nbsp;<br /> 9:30 AM</p>
</td>
<td>
<p style="text-align: center;">25 Feb&nbsp;<br /> 2:00 PM</p>
</td>
</tr>
<tr>
<td valign="top">
<p style="text-align: center;"><a href="http://www.strand-ngs.com/webinar_registration"><strong>Session 2</strong></a></p>
</td>
<td valign="top">
<p style="text-align: center;">25 Feb&nbsp;<br /> 9:00 AM</p>
</td>
<td>
<p style="text-align: center;">26 Feb<br /> 2:00 AM</p>
</td>
<td>
<p style="text-align: center;">25 Feb&nbsp;<br /> 6:00 PM</p>
</td>
<td>
<p style="text-align: center;">25 Feb&nbsp;<br /> 10:30 PM</p>
</td>
</tr>
</tbody>
</table><p><strong style="font-size: 12.8000001907349px;">Register here: </strong><a href="http://www.strand-ngs.com/webinar_registration">http://www.strand-ngs.com/webinar_registration</a></p><p><strong>About Speaker:</strong></p><p>Dr. Veena Hedatale, has a PhD in Plant Genetics from The Radboud University, Netherlands focused on meiosis and recombination. Her prior academic experience at Cornell University was on genetic mapping and gene transformation in Rice. She has worked with Monsanto, and contributed to data mining, database development as well as gene/promoter/pathway discovery for traits related to yield and stress in crop species. At Strand, Veena has worked on Pharmacogenomic analysis of targets and Gene family analysis projects. Currently, she is part of the Strand NGS Application Science team and is involved in the analysis of next generation sequencing data.</p><p>Please feel free to contact us 24/5, for availing free online training or if you have any questions.</p></div><div><p><strong style="font-size: 12.8000001907349px;">Email:</strong> sales@strandngs.com</p><p><strong>Phone (USA):</strong> 1-800-752-9122</p><p><strong>Phone (ROW):</strong> +1-650-353-5060</p><p>&nbsp;</p></div>]]></description>
	<dc:creator>Yeshodari</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36267/pspairwise-sequentially-markovian-coalescent-psmc-model</guid>
	<pubDate>Thu, 19 Apr 2018 05:29:23 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36267/pspairwise-sequentially-markovian-coalescent-psmc-model</link>
	<title><![CDATA[PSPairwise Sequentially Markovian Coalescent (PSMC) model]]></title>
	<description><![CDATA[<p><span>Implementation of the Pairwise Sequentially Markovian Coalescent (PSMC) model</span></p><p>Address of the bookmark: <a href="https://github.com/lh3/psmc" rel="nofollow">https://github.com/lh3/psmc</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/38649/ngs-platforms-launched-by-bgi%E2%80%99s-mgi-tech</guid>
	<pubDate>Thu, 10 Jan 2019 04:42:06 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/38649/ngs-platforms-launched-by-bgi%E2%80%99s-mgi-tech</link>
	<title><![CDATA[NGS Platforms launched by BGI’s MGI Tech]]></title>
	<description><![CDATA[<p>MGI Tech Co., Ltd. (MGI), a subsidiary of BGI Group, is committed to enabling effective and affordable healthcare solutions for all. Based on its proprietary technology, MGI produces sequencing devices, equipment, consumables and reagents to support life science research, medicine and healthcare. MGI's multi-omics platforms include genetic sequencing, mass spectrometry and medical imaging. Providing real-time, comprehensive, life-long solutions, its mission&nbsp;is to&nbsp;develop and promote advanced life science tools for future healthcare.</p><p>MGI, a subsidiary of global genomics leader BGI Group, announced pricing and its first early access customer for the new ultra high-throughput sequencer, MGISEQ-T7, saying it has driven down sequencing cost to&nbsp;$5&nbsp;per gigabyte, with exceptionally high accuracy. Such innovations are helping more people to realize the benefits of genomic information.</p><p>In October, MGI launched the MGISEQ-T7, a highly flexible production-scale platform that is the most powerful sequencer to date. It can produce as many as 60 whole human genomes in one day. The instrument sells for&nbsp;$1 million.</p><p>The T7 enables simultaneous but independent operation of up to four flow cells, which means different applications such as single-cell RNA sequencing, whole exome sequencing and whole genome sequencing can be run in different flow cells at the same time. This helps to reduce costs, allowing MGI to offer the most competitive sequencing price in the market.</p><p><span>Powered by DNBseq&trade;, MGISEQ delivers quality data with accuracy for SNP and Indel calling rate of 99.9% and 99%, respectively, along with decreased duplication rate down to less than 2 percent, and almost zero Index mis-assignment rate.</span></p><p><span><span>SOURCE MGI</span></span></p><p>https://www.bgi.com/global/company/news/bgis-mgi-tech-launches-two-new-ngs-platforms/</p><p>http://en.mgitech.cn/</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/41394/ngsymposium-in-computational-biology</guid>
  <pubDate>Mon, 09 Mar 2020 06:00:30 -0500</pubDate>
  <link></link>
  <title><![CDATA[NGSymposium in Computational Biology]]></title>
  <description><![CDATA[
<p>We have a great pleasure to invite you to the NGSymposium in Computational Biology to celebrate the 5th anniversary of the NGSchool Summer Schools. This international conference will make way for exchanging knowledge and experiences between experienced and early-stage researchers as well as bioinformaticians. The meeting will be held on 31.07 - 1.08.2020 in Warsaw. It will be a satellite event to the #NGSchool2020: Statistical Learning in Genomics. It will cover a wide range of topics from basic and applied biomedical sciences: bioinformatics, genomics, transcriptomics, computational biology, Machine Learning.</p>

<p>Registration of active participants will be open from February, 27 12 PM CET to April 17, 23:59 CET. In registration forms you will be asked for providing us with some basic information about yourself. You will also be able to submit your abstract. You can save your registration form after filling it partially and come back later to supply more data e.g. upload an abstract. Your registration will be completed only with the payment of the registration fee reaching our accounts - please make sure to transfer the money in advance!</p>

<p>Registration of passive participants will be open after closing of registration of active participants.</p>

<p>Details an registration: https://ngschool.eu/conference/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/45278/the-day-we-began-reading-the-dna-of-the-world</guid>
	<pubDate>Sat, 05 Sep 2026 01:43:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/45278/the-day-we-began-reading-the-dna-of-the-world</link>
	<title><![CDATA[The Day We Began Reading the DNA of the World]]></title>
	<description><![CDATA[<div>Picture waking up and knowing that in one lab, a scientist is reading the DNA of a whale. In another, a team is sequencing a rare plant. Meanwhile, researchers in India are decoding the genomes of different human populations.</div><div>&nbsp;</div><div>Many organisms. Many countries. All share one remarkable goal: to understand the genetic story of life.</div><div>DNA is nature's instruction manual, written with just four letters: A, T, C, and G. For years, scientists could only read small sections of this huge book. Now, new sequencing technology lets us read entire genomes like never before.</div><div>&nbsp;</div><div>One of the most ambitious projects is the Earth BioGenome Project (EBP). Its goal is to create reference genomes for about 1.5 million known eukaryotic species. This project links genome research across continents, species, and scientific fields.</div><div>&nbsp;</div><div>But this story goes beyond just animals and plants.</div><div>&nbsp;</div><div><strong>A New Chapter in Human Genomics</strong></div><div>&nbsp;</div><div>Large human genome projects are changing how we understand our own genetic diversity.</div><div>India's GenomeIndia project has sequenced thousands of people from different populations. This work is uncovering genetic variation that global databases have often missed.</div><div>&nbsp;</div><div>Similar population-scale effSimilar large-scale projects are happening worldwide. The All of Us Research Program in the United States, Europe's 1+ Million Genomes initiative, South Korea's national genomic data program, and projects in Saudi Arabia, Australia, and Singapore are all building huge genomic resources.collect DNA.</div><div>&nbsp;</div><div>The real goal is to link genomes with health, disease, and other biological information. This creates a base for more accurate research and, in time, more personalized medicine.</div><div>&nbsp;</div><div><strong>A Race Against Time</strong></div><div>&nbsp;</div><div>There is also an important twist.</div><div>&nbsp;</div><div>We are sequencing Earth's biodiversity even as many species face growing environmental threats.</div><div>A genome alone cannot save a species, but it does keep important information about its biology, evolution, and genetic diversity. This knowledge helps scientists understand risks, guide conservation, and find traits that could help agriculture or medicine.</div><div>&nbsp;</div><div>Projects like the Darwin Tree of Life, which studies species in Britain and Ireland, and the African BioGenome Project, which is growing genomics work across Africa, are key parts of this worldwide effort.</div><div>&nbsp;</div><div>Projects to Watch</div><ol>
<li>Earth BioGenome Project (EBP) - A global effort to sequence and annotate roughly 1.5 million known eukaryotic species and create a comprehensive reference library of Earth's biodiversity.</li>
<li>Vertebrate Genomes Project (VGP) - Focuses on producing high-quality reference genomes for vertebrate species, providing a major foundation for the wider Tree of Life.</li>
<li>Darwin Tree of Life - A UK and Ireland initiative aiming to sequence approximately 70,000 species, creating a detailed genomic map of regional biodiversity.</li>
<li>African BioGenome Project (AfricaBP) - A pan-African initiative focused on sequencing Africa's biodiversity while strengthening genomics and bioinformatics capacity across the continent.</li>
<li>European Reference Genome Atlas (ERGA) - A European effort to generate high-quality reference genomes for Europe's biodiversity and connect national sequencing efforts.</li>
<li>Canada BioGenome Project - Building reference genomes for Canadian biodiversity, supporting conservation, research and the study of ecosystems.</li>
<li>California Conservation Genomics Project - Uses genomics to understand and protect California's biodiversity and help inform conservation decisions.</li>
<li>Bat1K - An ambitious global effort to sequence the genomes of all known bat species, helping scientists study their evolution, longevity, immunity and unique biology.</li>
<li>Bird 10,000 (B10K) - A global project aiming to create genome resources covering the world's bird diversity and reconstruct avian evolutionary history.</li>
<li>Global Invertebrate Genomics Alliance (GIGA) - Builds genomic resources for the enormous and genetically diverse world of invertebrates.</li>
<li>GenomeIndia - India's national human-genome initiative, designed to capture the country's extraordinary population diversity and create a reference resource for Indian genomics.</li>
<li>All of Us Research Program - A US national research program combining genomic information with health and lifestyle data at population scale.</li>
<li>1+ Million Genomes / Genome of Europe - A European effort to enable secure, cross-border use of genomic and health data and develop genome-scale resources involving more than one million people.</li>
<li>Korea National Integrated Bio Big Data Project - South Korea's large-scale national effort combining genomic and health information from a very large population cohort.</li>
<li>Saudi Genome Program - A national genomics initiative focused on genetic diseases, population genomics and precision medicine in Saudi Arabia.</li>
<li>Australian Genomics / Genomics Health Futures Mission - Australia's growing investment in genomic medicine, rare disease research and population-scale health genomics.</li>
</ol><div><strong>The Library of Life</strong></div><div>&nbsp;</div><div>The fuThe future of genomics is not just about sequencing one genome at a time. Now, it is about creating a worldwide network of genomes&mdash;human and non-human, individual and species&mdash;linked by powerful databases and advanced computational tools.ine a library without shelves.</div><div>&nbsp;</div><div>In this library, the books are genomes. The pages are made of DNA. Scientists and machines are the readers. And this library is still being written. Each genome sequenced today adds a new page to the story of life and helps us better understand our place in it.</div>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/26414/advanced-bash-scripting-guide</guid>
	<pubDate>Thu, 18 Feb 2016 04:50:51 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/26414/advanced-bash-scripting-guide</link>
	<title><![CDATA[Advanced Bash-Scripting Guide]]></title>
	<description><![CDATA[<p>This tutorial assumes no previous knowledge of scripting or programming, yet progresses rapidly toward an intermediate/advanced level of instruction <em>. . . all the while sneaking in little nuggets of <span>UNIX</span>&reg; wisdom and lore</em>. It serves as a textbook, a manual for self-study, and as a reference and source of knowledge on shell scripting techniques. The exercises and heavily-commented examples invite active reader participation, under the premise that <tt><strong>the only way to really learn scripting is to write scripts</strong></tt>.</p>
<p>This book is suitable for classroom use as a general introduction to programming concepts.</p>
<p>More at http://tldp.org/LDP/abs/html/</p><p>Address of the bookmark: <a href="http://tldp.org/LDP/abs/html/" rel="nofollow">http://tldp.org/LDP/abs/html/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/30897/finestructure-v2-globetrotter</guid>
	<pubDate>Mon, 13 Feb 2017 08:40:23 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/30897/finestructure-v2-globetrotter</link>
	<title><![CDATA[fineSTRUCTURE v2 &amp; GLOBETROTTER]]></title>
	<description><![CDATA[<p>Software available at this site</p>
<div>
<ul>
<li><a href="https://people.maths.bris.ac.uk/%7Emadjl/finestructure/finestructure_info.html">FineSTRUCTURE version 2</a>, a pipeline for running ChromoPainter and FineSTRUCTURE for population inference. A GUI is available for interpretation. Download from the <a href="https://people.maths.bris.ac.uk/%7Emadjl/finestructure/finestructure.html">Downloads</a> page.</li>
<li><a href="https://people.maths.bris.ac.uk/%7Emadjl/finestructure/finestructureR.html">FineSTRUCTURE R scripts</a>, a facility for exploring the results when the GUI is unavailable.</li>
<li><a href="https://people.maths.bris.ac.uk/%7Emadjl/finestructure/globetrotter.html">GLOBETROTTER</a>, the admixture dating method based on ChromoPainter. Download from the <a href="https://people.maths.bris.ac.uk/%7Emadjl/finestructure/finestructure.html">Downloads</a> page.</li>
<li><a href="https://people.maths.bris.ac.uk/%7Emadjl/finestructure/admixture.html">AdmixturePainting</a>, A set of R tools to inmterpret the results of ADMIXTURE and STRUCTURE-like mixture models.</li>
<li><a href="https://people.maths.bris.ac.uk/%7Emadjl/finestructure/radpainter.html">RADpainter</a>, finestructure and ChromoPainter for RAD tag data used for non-model organisms.</li>
<li>Scripts to perform many types of conversion. Included in the main software download from the <a href="https://people.maths.bris.ac.uk/%7Emadjl/finestructure/finestructure.html">Downloads</a> page.</li>
</ul>
What this page is This page provides information about and downloads for <strong>methodology for Chromosome Painting</strong>. It is not a facility to analyse your genome. Sorry if you were misled by the punchy name!<br> About Chromosome Painting Painting is an efficient way of identifying important haplotype information from dense genotype data. It describes ancestry in an efficient way suitable for a range of further analyses, including population identification and admixture dating.</div><p>Address of the bookmark: <a href="http://paintmychromosomes.com/" rel="nofollow">http://paintmychromosomes.com/</a></p>]]></description>
	<dc:creator>Shruti Paniwala</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34504/minion-gc-an-r-script-to-do-some-qc-on-minion-data</guid>
	<pubDate>Sun, 03 Dec 2017 15:19:18 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34504/minion-gc-an-r-script-to-do-some-qc-on-minion-data</link>
	<title><![CDATA[MinION_GC: An R script to do some QC on MinION data]]></title>
	<description><![CDATA[<p><span>Other tools focus on getting data out of the fastq or fast5 files, which is slow and computationally intensive. The benefit of this approach is that it works on a single, small, .txt summary file. So it's a lot quicker than most other things out there: it takes about a minute to analyse a 4GB flowcell on my laptop.</span></p>
<p>https://github.com/roblanf/minion_qc</p><p>Address of the bookmark: <a href="https://github.com/roblanf/minion_qc" rel="nofollow">https://github.com/roblanf/minion_qc</a></p>]]></description>
	<dc:creator>Radha Agarkar</dc:creator>
</item>

</channel>
</rss>