Again, running spades.py will show you the options:

spades.py

This produces:

SPAdes genome assembler v3.10.1

Usage: /usr/local/SPAdes-3.10.1-Linux/bin/spades.py [options] -o <output_dir>

Basic options:
-o      <output_dir>    directory to store all the resulting files (required)
--sc                    this flag is required for MDA (single-cell) data
--meta                  this flag is required for metagenomic sample data
--rna                   this flag is required for RNA-Seq data
--plasmid               runs plasmidSPAdes pipeline for plasmid detection
--iontorrent            this flag is required for IonTorrent data
--test                  runs SPAdes on toy dataset
-h/--help               prints this usage message
-v/--version            prints version

Input data:
--12    <filename>      file with interlaced forward and reverse paired-end reads
-1      <filename>      file with forward paired-end reads
-2      <filename>      file with reverse paired-end reads
-s      <filename>      file with unpaired reads
--pe<#>-12      <filename>      file with interlaced reads for paired-end library number <#> (<#> = 1,2,..,9)
--pe<#>-1       <filename>      file with forward reads for paired-end library number <#> (<#> = 1,2,..,9)
--pe<#>-2       <filename>      file with reverse reads for paired-end library number <#> (<#> = 1,2,..,9)
--pe<#>-s       <filename>      file with unpaired reads for paired-end library number <#> (<#> = 1,2,..,9)
--pe<#>-<or>    orientation of reads for paired-end library number <#> (<#> = 1,2,..,9; <or> = fr, rf, ff)
--s<#>          <filename>      file with unpaired reads for single reads library number <#> (<#> = 1,2,..,9)
--mp<#>-12      <filename>      file with interlaced reads for mate-pair library number <#> (<#> = 1,2,..,9)
--mp<#>-1       <filename>      file with forward reads for mate-pair library number <#> (<#> = 1,2,..,9)
--mp<#>-2       <filename>      file with reverse reads for mate-pair library number <#> (<#> = 1,2,..,9)
--mp<#>-s       <filename>      file with unpaired reads for mate-pair library number <#> (<#> = 1,2,..,9)
--mp<#>-<or>    orientation of reads for mate-pair library number <#> (<#> = 1,2,..,9; <or> = fr, rf, ff)
--hqmp<#>-12    <filename>      file with interlaced reads for high-quality mate-pair library number <#> (<#> = 1,2,..,9)
--hqmp<#>-1     <filename>      file with forward reads for high-quality mate-pair library number <#> (<#> = 1,2,..,9)
--hqmp<#>-2     <filename>      file with reverse reads for high-quality mate-pair library number <#> (<#> = 1,2,..,9)
--hqmp<#>-s     <filename>      file with unpaired reads for high-quality mate-pair library number <#> (<#> = 1,2,..,9)
--hqmp<#>-<or>  orientation of reads for high-quality mate-pair library number <#> (<#> = 1,2,..,9; <or> = fr, rf, ff)
--nxmate<#>-1   <filename>      file with forward reads for Lucigen NxMate library number <#> (<#> = 1,2,..,9)
--nxmate<#>-2   <filename>      file with reverse reads for Lucigen NxMate library number <#> (<#> = 1,2,..,9)
--sanger        <filename>      file with Sanger reads
--pacbio        <filename>      file with PacBio reads
--nanopore      <filename>      file with Nanopore reads
--tslr  <filename>      file with TSLR-contigs
--trusted-contigs       <filename>      file with trusted contigs
--untrusted-contigs     <filename>      file with untrusted contigs

Pipeline options:
--only-error-correction runs only read error correction (without assembling)
--only-assembler        runs only assembling (without read error correction)
--careful               tries to reduce number of mismatches and short indels
--continue              continue run from the last available check-point
--restart-from  <cp>    restart run with updated options and from the specified check-point ('ec', 'as', 'k<int>', 'mc')
--disable-gzip-output   forces error correction not to compress the corrected reads
--disable-rr            disables repeat resolution stage of assembling

Advanced options:
--dataset       <filename>      file with dataset description in YAML format
-t/--threads    <int>           number of threads
                                [default: 16]
-m/--memory     <int>           RAM limit for SPAdes in Gb (terminates if exceeded)
                                [default: 250]
--tmp-dir       <dirname>       directory for temporary files
                                [default: <output_dir>/tmp]
-k              <int,int,...>   comma-separated list of k-mer sizes (must be odd and
                                less than 128) [default: 'auto']
--cov-cutoff    <float>         coverage cutoff value (a positive float number, or 'auto', or 'off') [default: 'off']
--phred-offset  <33 or 64>      PHRED quality offset in the input reads (33 or 64)
                                [default: auto-detect]

As you can see this is also a “pipeline” of tools that can be switched on or off. SPAdes takes quite a long time, so for the purposes of this practical, something like this may suffice:

spades.py -t 4 \
          -m 32 \
          -k 31,51,71 \
          --only-assembler \
          -1 miseq.1.fastq -2 miseq.2.fastq \
          --nanopore minion.fastq \
          -o hybrid_assembly

In turn, these parameters mean

• use 4 threads
• max memory is 32Gb
• use 3 kmer values to build the de bruijn graph(s) - 31, 51 and 71
• only run the assembler, not the correction algorithm (for speed)
• read 1 and read 2 of the MiSeq data
• the nanopore data
• put the output in folder “hybrid_assembly”

Address of the bookmark: ftp://ftp.genomics.org.cn/pub/cope

Prokka – Standalone command line tool, takes just a few minutes per genome. This is the best way to get good quality annotation in a flash, which is particularly useful if you have loads of genomes or need to annotate a pangenome or metagenome. Note however that the quality of functional information is not as good as RAST, and you will need several extra steps if you want to do functional profiling and pathway analysis of your genome(s)… which is in-built in RAST.

NCBI Prokaryotic Genome Annotation Pipeline is designed to annotate bacterial and archaeal genomes (chromosomes and plasmids).

Genome annotation is a multi-level process that includes prediction of protein-coding genes, as well as other functional genome units such as structural RNAs, tRNAs, small RNAs, pseudogenes, control regions, direct and inverted repeats, insertion sequences, transposons and other mobile elements.

PGAP: NCBI has developed an automatic prokaryotic genome annotation pipeline that combines ab initio gene prediction algorithms with homology based methods. The first version of NCBI Prokaryotic Genome Automatic Annotation Pipeline (PGAAP; see Pubmed Article) developed in 2005 has been replaced with an upgraded version that is capable of processing a larger data volume.  NCBI's annotation pipeline depends on several internal databases and is not currently available for download or use outside of the NCBI environment.

BEACON (automated tool for Bacterial GEnome Annotation ComparisON), a fast tool for an automated and a systematic comparison of different annotations of single genomes. The extended annotation assigns putative functions to many genes with unknown functions. BEACON is available under GNU General Public License version 3.0 and is accessible at: http://www.cbrc.kaust.edu.sa/BEACON/.

BlastKOLA: Assigns K numbers to the user's sequence data by BLAST searches, respectively, against a nonredundant set of KEGG GENES. KOALA (KEGG Orthology And Links Annotation) is KEGG's internal annotation tool for K number assignment of KEGG GENES using SSEARCH computation. Annotate Sequence in KEGG Mapper and Pathogen Checker in KEGG Pathogen are special interfaces to this server and can be executed in an interactive mode. BlastKOALA is suitable for annotating fully sequenced genomes.

PAGIT: Provides a toolkit for improving the quality of genome assemblies created via an assembly software. PAGIT compiled four tools: (i) ABACAS which classifies and orientates contigs and estimates the sizes of gaps between them; (ii) IMAGE uses paired-end reads to extend contigs and close gaps within the scaffolds; (iii) ICORN for identifying and correcting small errors in consensus sequences and; (iv) RATT for help annotation. The software was mainly created to analyze parasite genomes of up to about 300 Mb.

MAKER: A portable and easily configurable genome annotation pipeline. MAKER allows smaller eukaryotic and prokaryotic genome projects to independently annotate their genomes and to create genome databases. It identifies repeats, aligns ESTs and proteins to a genome, produces ab-initio gene predictions and automatically synthesizes these data into gene annotations having evidence-based quality values. MAKER's inputs are minimal and its ouputs can be directly loaded into a Generic Model Organism Database (GMOD). They can also be viewed in the Apollo genome browser; this feature of MAKER provides an easy means to annotate, view and edit individual contigs and BACs without the overhead of a database. MAKER is available for download and can be tested online via the MAKER Web Annotation Service (MWAS).

MyPro is a software pipeline for high-quality prokaryotic genome assembly and annotation. It was validated on 18 oral streptococcal strains to produce submission-ready, annotated draft genomes. MyPro installed as a virtual machine and supported by updated databases will enable biologists to perform quality prokaryotic genome assembly and annotation with ease.

https://www.nature.com/articles/nmeth.4556

Address of the bookmark: https://github.com/ryanlayer/giggle

If you are interested in gene prediction, have a look at GenomeThreader.

Address of the bookmark: http://genometools.org/

Using AlignGraph

AlignGraph --read1 reads_1.fa --read2 reads_2.fa --contig contigs.fa --genome genome.fa --distanceLow distanceLow --distanceHigh distancehigh --extendedContig extendedContigs.fa --remainingContig remainingContigs.fa [--kMer k --insertVariation insertVariation --coverage coverage --part p --fastMap --ratioCheck --iterativeMap --misassemblyRemoval --resume]

Address of the bookmark: https://github.com/baoe/AlignGraph

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory

Address of the bookmark: http://gfinisher.sourceforge.net