<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/34685?offset=220</link>
	<atom:link href="https://bioinformaticsonline.com/related/34685?offset=220" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/34707/string-graph-based-genome-assembly-software-and-tools</guid>
	<pubDate>Tue, 19 Dec 2017 17:17:38 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/34707/string-graph-based-genome-assembly-software-and-tools</link>
	<title><![CDATA[String graph based genome assembly software and tools !]]></title>
	<description><![CDATA[<p>In&nbsp;<a href="https://en.wikipedia.org/wiki/Graph_theory" title="Graph theory">graph theory</a>, a&nbsp;<strong>string graph</strong>&nbsp;is an&nbsp;<a href="https://en.wikipedia.org/wiki/Intersection_graph" title="Intersection graph">intersection graph</a>&nbsp;of&nbsp;<a href="https://en.wikipedia.org/wiki/Curve" title="Curve">curves</a>&nbsp;in the plane; each curve is called a "string".&nbsp; String graphs were first proposed by E. W. Myers in a&nbsp;<a href="http://bioinformatics.oxfordjournals.org/content/21/suppl_2/ii79.full.pdf+html">2005 publication</a>.&nbsp;In&nbsp;recent&nbsp;<a href="http://genome.cshlp.org/content/early/2012/01/22/gr.126953.111">Genome Research paper</a>&nbsp;describing an innovative approach for assembling large genomes from NGS data caught our attention for several reasons. i) it give different "string graph" prospective of long lasting genome assembly problem ii) the&nbsp;paper is coauthored by Jared Simpson, the developer of&nbsp;<a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2694472/">ABySS assembler</a>&nbsp;and Richard Durbin. iii)&nbsp;Simpson-Durbin algorithm is that it does not rely on de Bruijn graphs, and instead employs a different graph construction approach called &lsquo;string graph&rsquo;.</p><p>Following are the genome assembly tools based on string graph:</p><p>1.SGA (String Graph Assembler)&nbsp;https://github.com/jts/sga</p><p>Assembles large genomes from high coverage short read data. SGA is designed as a modular set of programs, which are used to form an assembly pipeline. SGA implements a set of assembly algorithms based on the FM-index. As the FM-index is a compressed data structure, the algorithms are very memory efficient. The SGA assembly has three distinct phases. The first phase corrects base calling errors in the reads. The second phase assembles contigs from the corrected reads. The third phase uses paired end and/or mate pair data to build scaffolds from the contigs. The output of this software is a PDF report that allows the properties of the genome and data quality to be visually explored. By providing more information to the user at the start of an assembly project, this software will help increase awareness of the factors that make a given assembly easy or difficult, assist in the selection of software and parameters and help to troubleshoot an assembly if it runs into problems.</p><p>2.&nbsp;SAGE: String-overlap Assembly of GEnomes&nbsp;https://github.com/lucian-ilie/SAGE2</p><p>SAGE, for de novo genome assembly. As opposed to most assemblers, which are de Bruijn graph based, SAGE uses the string-overlap graph. SAGE builds upon great existing work on string-overlap graph and maximum likelihood assembly, bringing an important number of new ideas, such as the efficient computation of the transitive reduction of the string overlap graph, the use of (generalized) edge multiplicity statistics for more accurate estimation of read copy counts, and the improved use of mate pairs and min-cost flow for supporting edge merging. The assemblies produced by SAGE for several short and medium-size genomes compared favourably with those of existing leading assemblers.</p><p>3. FSG: Fast String Graph</p><p>The new integrated assembler has been assessed on a standard benchmark, showing that fast string graph (FSG) is significantly faster than SGA while maintaining a moderate use of main memory, and showing practical advantages in running FSG on multiple threads. Moreover, we have studied the effect of coverage rates on the running times.</p><p>4.&nbsp;&nbsp;BASE&nbsp;https://github.com/dhlbh/BASE</p><p>It enhances the classic seed-extension approach by indexing the reads efficiently to generate adaptive seeds that have high probability to appear uniquely in the genome. Such seeds form the basis for BASE to build extension trees and then to use reverse validation to remove the branches based on read coverage and paired-end information, resulting in high-quality consensus sequences of reads sharing the seeds. Such consensus sequences are then extended to contigs.&nbsp;BASE is a practically efficient tool for constructing contig, with significant improvement in quality for long NGS reads. It is relatively easy to extend BASE to include scaffolding.</p><p>5.&nbsp;Fermi&nbsp;https://github.com/lh3/fermi/</p><p>Fermi is a de novo assembler with a particular focus on assembling Illumina&nbsp;short sequence reads from a mammal-sized genome. In addition to the role of a&nbsp;typical assembler, fermi also aims to preserve heterozygotes which are often&nbsp;collapsed by other assemblers. Its ultimate goal is to find a minimal set of&nbsp;unitigs to represent all the information in raw reads.</p><p>If you want to learn about String Graph assembler, please read the following papers -</p><p>i)&nbsp;<a href="http://bioinformatics.oxfordjournals.org/content/21/suppl_2/ii79.full.pdf+html">The Fragment Assembly String Graph - E. W. Myers</a></p><p>This paper describes the String Graph concept.</p><p>ii)&nbsp;<a href="http://bioinformatics.oxfordjournals.org/content/26/12/i367.full#ref-20">Efficient construction of an assembly string graph using the FM-index - Jared T. Simpson and Richard Durbin</a></p><p>This earlier paper from Simpson and Durbin</p><p>iii)&nbsp;<a href="http://genome.cshlp.org/content/early/2012/01/22/gr.126953.111">Efficient de novo assembly of large genomes using compressed data structures - Jared T. Simpson and Richard Durbin</a></p><p>&nbsp;</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35543/genometools-the-versatile-open-source-genome-analysis-software</guid>
	<pubDate>Wed, 07 Feb 2018 10:44:18 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35543/genometools-the-versatile-open-source-genome-analysis-software</link>
	<title><![CDATA[GenomeTools: The versatile open source genome analysis software]]></title>
	<description><![CDATA[<p>The&nbsp;<em>GenomeTools</em>&nbsp;genome analysis system is a&nbsp;<a href="http://genometools.org/license.html">free</a>&nbsp;collection of bioinformatics&nbsp;<a href="http://genometools.org/tools.html">tools</a>&nbsp;(in the realm of genome informatics) combined into a single binary named&nbsp;<em>gt</em>. It is based on a C library named &ldquo;libgenometools&rdquo; which consists of several modules.</p>
<p>If you are interested in gene prediction, have a look at&nbsp;<a href="http://genomethreader.org/" title="GenomeThreader gene prediction        software"><em>GenomeThreader</em></a>.</p><p>Address of the bookmark: <a href="http://genometools.org/" rel="nofollow">http://genometools.org/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36257/aligngraph-algorithm-for-secondary-de-novo-genome-assembly-guided-by-closely-related-references</guid>
	<pubDate>Tue, 17 Apr 2018 16:21:20 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36257/aligngraph-algorithm-for-secondary-de-novo-genome-assembly-guided-by-closely-related-references</link>
	<title><![CDATA[AlignGraph: algorithm for secondary de novo genome assembly guided by closely related references]]></title>
	<description><![CDATA[<p>AlignGraph is a software that extends and joins contigs or scaffolds by reassembling them with help provided by a reference genome of a closely related organism.</p>
<p>Using AlignGraph</p>
<pre><code>AlignGraph --read1 reads_1.fa --read2 reads_2.fa --contig contigs.fa --genome genome.fa --distanceLow distanceLow --distanceHigh distancehigh --extendedContig extendedContigs.fa --remainingContig remainingContigs.fa [--kMer k --insertVariation insertVariation --coverage coverage --part p --fastMap --ratioCheck --iterativeMap --misassemblyRemoval --resume]</code></pre>
<h3>&nbsp;</h3><p>Address of the bookmark: <a href="https://github.com/baoe/AlignGraph" rel="nofollow">https://github.com/baoe/AlignGraph</a></p>]]></description>
	<dc:creator>Manisha Mishra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</guid>
	<pubDate>Thu, 31 May 2018 06:00:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</link>
	<title><![CDATA[CrossMap: a program for convenient conversion of genome coordinates]]></title>
	<description><![CDATA[CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) &lt;&gt; hg19 (GRCh37), Mouse mm9 (MGSCv37) &lt;&gt; mm10 (GRCm38)).

It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF.

CrossMap is designed to liftover genome coordinates between assemblies. 

It’s not a program for aligning sequences to reference genome.

We do not recommend using CrossMap to convert genome coordinates between species.<p>Address of the bookmark: <a href="http://crossmap.sourceforge.net" rel="nofollow">http://crossmap.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</guid>
	<pubDate>Fri, 20 Jul 2018 10:03:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</link>
	<title><![CDATA[Converting a VCF into a FASTA given some reference !]]></title>
	<description><![CDATA[<p>Samtools/BCFtools (Heng Li) provides a Perl script&nbsp;<a href="https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl"><code>vcfutils.pl</code></a>&nbsp;which does this, the function&nbsp;<code>vcf2fq</code>&nbsp;(lines 469-528)</p><p>This script has been modified by others to convert InDels as well, e.g.&nbsp;<a href="https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl">this</a>&nbsp;by David Eccles</p><pre><code><span>./</span><span>vcf2fq</span><span>.</span><span>pl </span><span>-</span><span>f </span><span>&lt;</span><span>input</span><span>.</span><span>fasta</span><span>&gt;</span><span> </span><span>&lt;</span><span>all</span><span>-</span><span>site</span><span>.</span><span>vcf</span><span>&gt;</span><span> </span><span>&gt;</span><span> </span><span>&lt;</span><span>output</span><span>.</span><span>fastq</span><span>&gt;</span></code></pre><p>https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl</p><p>https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37650/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</guid>
	<pubDate>Fri, 07 Sep 2018 05:19:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37650/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</link>
	<title><![CDATA[P_RNA_scaffolder: a fast and accurate genome scaffolder using paired-end RNA-sequencing reads]]></title>
	<description><![CDATA[<p><span>P_RNA_scaffolder is a novel scaffolding tool using Pair-end RNA-seq to scaffold genome fragments. The method is suitable for most genomes. The program could utilize Illumina Paired-end RNA-sequencing reads from target speciesies. Our method provides another practical alternative to existing mate-pair_based approaches or other Protein-based approaches (for instance,&nbsp;</span><a href="http://www.fishbrowser.org/software/PEP_scaffolder/">PEP_scaffolder&nbsp;</a><span>) for scaffolding genome sequences. The most important feature of this method is to improve the completeness of gene regions and long-coding gene regions (for instance,&nbsp;</span><a href="http://circrna.org/">circRNA</a><span>).</span></p><p>Address of the bookmark: <a href="http://www.fishbrowser.org/software/P_RNA_scaffolder/#" rel="nofollow">http://www.fishbrowser.org/software/P_RNA_scaffolder/#</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</guid>
	<pubDate>Thu, 25 Oct 2018 09:38:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</link>
	<title><![CDATA[Scribl : HTML5 canvas genomics graphic library]]></title>
	<description><![CDATA[<p>Scribl is a javascript, Canvas-based graphics library that easily generates biological visuals of genomic regions, alignments, and assembly data. Scribl can also be used in conventional offline pipelines, since everything needed to generate charts can be contained in a single html file.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="http://chmille4.github.io/Scribl/" rel="nofollow">http://chmille4.github.io/Scribl/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38166/pygenometracks-standalone-program-and-library-to-plot-beautiful-genome-browser-tracks</guid>
	<pubDate>Fri, 09 Nov 2018 12:34:23 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38166/pygenometracks-standalone-program-and-library-to-plot-beautiful-genome-browser-tracks</link>
	<title><![CDATA[pyGenomeTracks: Standalone program and library to plot beautiful genome browser tracks]]></title>
	<description><![CDATA[<p>pyGenomeTracks aims to produce high-quality genome browser tracks that are highly customizable. Currently, it is possible to plot:</p>
<ul>
<li>bigwig</li>
<li>bed (many options)</li>
<li>bedgraph</li>
<li>links (represented as arcs)</li>
<li>Hi-C matrices (if&nbsp;<a href="http://hicexplorer.readthedocs.io/">HiCExplorer</a>&nbsp;is installed)</li>
</ul><p>Address of the bookmark: <a href="https://github.com/deeptools/pyGenomeTracks" rel="nofollow">https://github.com/deeptools/pyGenomeTracks</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

</channel>
</rss>