Address of the bookmark: http://pacb.com/blog/the-hifi-difference-true-long-reads-vs-synthetic-long-reads/

Before you go down that path, consider this critical biological question:
Are you sequencing human cells—or bacterial contamination?

The Silent Saboteur: Mycoplasma in Cell Cultures

Mycoplasma contamination remains one of the most widespread and underdiagnosed issues in tissue culture work. Studies suggest that 15–35% of cell lines in use may be contaminated, often without visible signs. Unlike other microbial infections, Mycoplasma does not produce cloudiness, odor, or a change in pH. Many researchers won’t detect it unless they specifically test for it.

The consequences, however, are profound. Mycoplasma can significantly alter:

• Host gene expression patterns

• Cell proliferation rates

• Epigenetic profiles and chromatin accessibility

• Cytokine signaling and immune responses

In short, it can skew your results, compromise your biological conclusions, and invalidate weeks or months of research.

A Simple Diagnostic Step: Map Against Mycoplasma Genomes

If you encounter poor alignment rates to the human genome, consider mapping your reads to a Mycoplasma reference genome—or better yet, use a combined human + Mycoplasma reference. There have been cases where over half of all reads, initially assumed to be from human cells, were in fact bacterial in origin. This check is fast, easy, and could save your project.

How Contamination Happens—and Persists

Mycoplasma is small (0.1–0.3 μm), lacks a cell wall, and can pass through standard filters undetected. Common sources include:

• Contaminated reagents (e.g., FBS)

• Infected cell lines obtained from other labs

• Poor aseptic technique or shared equipment

Once present, it spreads quickly between cultures and can persist for months, silently affecting results.

Why Treatment Is Difficult

While antibiotics such as Plasmocin or BM-Cyclin are sometimes used, they often offer only partial resolution and may themselves alter cell behavior. In many cases, the best course of action is to discard the contaminated culture and start with a fresh, verified stock.

Practical Recommendations for Researchers

• Routinely test for Mycoplasma using PCR, qPCR, or fluorescence-based assays

• Incorporate contamination screens into your sequencing QC pipeline

• Use combined reference genomes when mapping ambiguous reads

• Practice strict aseptic technique and monitor all incoming cell lines

• Don’t ignore unexplained data anomalies—they might point to contamination

Closing Thought: Contamination Is a Biological Variable

It’s easy to view poor mapping as a technical issue, but sometimes the problem lies deeper—in the biology itself. Mycoplasma contamination doesn’t just interfere with sequencing; it interferes with science. As a research community, we must treat contamination not as an afterthought, but as a key variable to control.

So next time your reads won’t align, don’t just tune the aligner. Ask if your cells are telling the truth—or if they're hiding something.

1. ElasticBLAST can handle much LARGER queries! 

ElasticBLAST can search query sets that have hundreds to millions of sequences and against BLAST databases of all sizes.

2. ElasticBLAST is FASTER

ElasticBLAST distributes your searches across multiple cloud instances to process them simultaneously. The ability to scale resources in this way allows you to process large numbers of queries in a shorter time than you could with BLAST+.

3. ElasticBLAST is EASY to run on the cloud

ElasticBLAST is easy to set up using our step-by-step instructions (Amazon Web Services (AWS), Google Cloud Platform (GCP)) and allows you to leverage the power of the cloud. Once configured, it manages the software and database installation, handles partitioning of the BLAST workload among the various instances, and deallocates cloud resources when the searches are done.

ElasticBLAST also selects the instance (i.e., machine) type for you based on database size. Of course, you can also choose the instance type manually if you prefer. 

Address of the bookmark: https://blast.ncbi.nlm.nih.gov/doc/elastic-blast/

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

The latest version is 1.2.4.

To cite Platanus, please use the following:

Kajitani R, Toshimoto K, Noguchi H, Toyoda A, Ogura Y, Okuno M, Yabana M, Harada M, Nagayasu E, Maruyama H, Kohara Y, Fujiyama A, Hayashi T, Itoh T, “Efficient de novo assembly of highly heterozygous genomes from whole-genome shotgun short reads”. Genome Res. 2014 Aug;24(8):1384-95. doi: 10.1101/gr.170720.113. [abstract | full text]

Address of the bookmark: http://platanus.bio.titech.ac.jp/

Address of the bookmark: https://github.com/lh3/fermi

Computational methods used by the Shasta assembler include:

• Using a run-length representation of the read sequence. This makes the assembly process more resilient to errors in homopolymer repeat counts, which are the most common type of errors in Oxford Nanopore reads.
• Using in some phases of the computation a representation of the read sequence based on markers, a fixed subset of short k-mers (k ≈ 10).

More at https://chanzuckerberg.github.io/shasta/index.html

Address of the bookmark: https://github.com/chanzuckerberg/shasta