Before you go down that path, consider this critical biological question:
Are you sequencing human cells—or bacterial contamination?

The Silent Saboteur: Mycoplasma in Cell Cultures

Mycoplasma contamination remains one of the most widespread and underdiagnosed issues in tissue culture work. Studies suggest that 15–35% of cell lines in use may be contaminated, often without visible signs. Unlike other microbial infections, Mycoplasma does not produce cloudiness, odor, or a change in pH. Many researchers won’t detect it unless they specifically test for it.

The consequences, however, are profound. Mycoplasma can significantly alter:

• Host gene expression patterns

• Cell proliferation rates

• Epigenetic profiles and chromatin accessibility

• Cytokine signaling and immune responses

In short, it can skew your results, compromise your biological conclusions, and invalidate weeks or months of research.

A Simple Diagnostic Step: Map Against Mycoplasma Genomes

If you encounter poor alignment rates to the human genome, consider mapping your reads to a Mycoplasma reference genome—or better yet, use a combined human + Mycoplasma reference. There have been cases where over half of all reads, initially assumed to be from human cells, were in fact bacterial in origin. This check is fast, easy, and could save your project.

How Contamination Happens—and Persists

Mycoplasma is small (0.1–0.3 μm), lacks a cell wall, and can pass through standard filters undetected. Common sources include:

• Contaminated reagents (e.g., FBS)

• Infected cell lines obtained from other labs

• Poor aseptic technique or shared equipment

Once present, it spreads quickly between cultures and can persist for months, silently affecting results.

Why Treatment Is Difficult

While antibiotics such as Plasmocin or BM-Cyclin are sometimes used, they often offer only partial resolution and may themselves alter cell behavior. In many cases, the best course of action is to discard the contaminated culture and start with a fresh, verified stock.

Practical Recommendations for Researchers

• Routinely test for Mycoplasma using PCR, qPCR, or fluorescence-based assays

• Incorporate contamination screens into your sequencing QC pipeline

• Use combined reference genomes when mapping ambiguous reads

• Practice strict aseptic technique and monitor all incoming cell lines

• Don’t ignore unexplained data anomalies—they might point to contamination

Closing Thought: Contamination Is a Biological Variable

It’s easy to view poor mapping as a technical issue, but sometimes the problem lies deeper—in the biology itself. Mycoplasma contamination doesn’t just interfere with sequencing; it interferes with science. As a research community, we must treat contamination not as an afterthought, but as a key variable to control.

So next time your reads won’t align, don’t just tune the aligner. Ask if your cells are telling the truth—or if they're hiding something.

Step 1: Install BLAST

1. Download BLAST:

   • Visit the NCBI BLAST+ download page to download the appropriate version for your operating system (Windows, macOS, or Linux).

2. Install BLAST:

   • Extract the downloaded archive. For Linux/Mac, use:

     tar -xvzf ncbi-blast-*.tar.gz
     cd ncbi-blast-*
     

   • Add the BLAST binary folder to your system PATH for easier access:

     export PATH=$PATH:/path/to/ncbi-blast-*/bin
     

3. Verify Installation:
   Run the following command to ensure BLAST is installed correctly:

   blastn -version
   

Step 2: Prepare a Local Database

To run BLAST offline, you’ll need a sequence database.

1. Download a Pre-Built Database (Optional):

   • NCBI provides ready-to-use databases such as nt, nr, and Swiss-Prot. Use the update_blastdb.pl script (bundled with BLAST) to download these:

     update_blastdb.pl --decompress nt
     

2. Create a Custom Database:
   If you have specific sequences to use as a database:

   • Prepare a FASTA file containing the sequences.
   • Use makeblastdb to create a database:

     makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
     

     Replace [nucl|prot] with nucl for nucleotide sequences or prot for protein sequences.

Step 3: Prepare the Query Sequence

• Save your query sequence(s) in FASTA format.
• Ensure the file is properly formatted, with a header line starting with > followed by the sequence name, and the sequence on subsequent lines.

Example:

>query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA

Step 4: Run BLAST

1. Choose the Appropriate BLAST Tool:
   Depending on your data type:

   • blastn: For nucleotide-nucleotide searches.
   • blastp: For protein-protein searches.
   • blastx: Translates nucleotide sequences into proteins and compares them to a protein database.
   • tblastn: Compares protein sequences to a nucleotide database.
   • tblastx: Translates both nucleotide query and database sequences.

2. Run the Command:
   Example command for blastn:

   blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
   

   Explanation of Parameters:

   • -query: Specifies the query file.
   • -db: Points to the local database.
   • -out: Output file name.
   • -outfmt: Output format (e.g., 6 for tabular format).
   • -evalue: E-value cutoff for significance.

Step 5: Interpret Results

1. Output Formats:

   • Default (outfmt 0): Human-readable format.
   • Tabular (outfmt 6): Includes fields like query ID, subject ID, percent identity, alignment length, etc.

2. Analyze Results:
   Use tools like grep, Python, or R to parse and filter results for downstream analysis.

Step 6: Optimize Performance

For large datasets, BLAST can be resource-intensive. To improve performance:

1. Multithreading:
   Use the -num_threads option to leverage multiple CPU cores:

   blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
   

2. Database Subsetting:
   Split large databases into smaller chunks for faster searches.

3. Adjust Parameters:

   • Lower the -evalue threshold for stricter matches.
   • Use -max_target_seqs to limit the number of results per query.

Step 7: Update Databases (Optional)

If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:

update_blastdb.pl --decompress nt

Conclusion

Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.

For advanced use cases, explore BLAST’s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!

Why Remote Session Management is a Must-Have

In bioinformatics, tasks like genome assembly, RNA-seq analyses, and phylogenetic computations often take hours or days. A dropped SSH connection can result in:

• Lost Progress: Restarting a job from scratch wastes valuable time.
• Workflow Interruptions: Disruptions can derail your focus and productivity.
• Corrupted Data: Interrupted processes may lead to incomplete or corrupted outputs.

By integrating screen, tmux, or mosh into your workflow, you can avoid these setbacks and ensure a seamless experience.

Screen: The Classic Workhorse

Screen is a terminal multiplexer that comes pre-installed on most Linux systems. It allows you to manage multiple terminal sessions and reconnect to them even after being disconnected.

Getting Started with Screen:

1. Start a Session:
   screen
2. Detach from a Session:
   Press Ctrl+A, then D.
3. Reattach to a Session:
   screen -r

Pro Tip: Enhance your screen experience with a customized .screenrc configuration file. Download one here: Get .screenrc.

Tmux: A Modern Alternative

Tmux takes everything great about screen and adds modern features, including better key bindings and intuitive session management. It\u2019s perfect for bioinformaticians who want more control over their workflow.

Getting Started with Tmux:

1. Start a Session:
   tmux
2. Detach from a Session:
   Press Ctrl+B, then D.
3. Reattach to a Session:
   tmux attach

Customize Your Tmux Experience:
Use a .tmux.conf file to personalize your setup. Grab one here: Download .tmux.conf.

Mosh: The Mobile Shell for Unreliable Connections

SSH works well for stable networks, but it struggles in areas with spotty connectivity. Enter Mosh, the Mobile Shell. Designed for intermittent networks, Mosh keeps your session alive even when the connection drops temporarily.

Why Mosh is a Game-Changer:

• No lag over high-latency networks.
• Automatically reconnects when the network is restored.
• Ideal for working on the go, from cafes to trains.

Getting Started with Mosh:

1. Install Mosh:
   sudo apt install mosh # For Debian/Ubuntu
2. Connect to a Server:
   mosh username@server

Learn more at mosh.org.

Why This Matters for Bioinformatics

Every bioinformatician knows the value of time and data integrity. Tools like screen, tmux, and mosh provide a lifeline when running long analyses, enabling you to:

• Safeguard your work against disconnections.
• Easily manage multiple workflows in parallel.
• Stay productive, even in challenging environments.

Quickstart Cheat Sheet

• Screen:

  screen # Start a session Ctrl+A, D # Detach screen -r # Reattach

• Tmux:

  tmux # Start a session Ctrl+B, D # Detach tmux attach # Reattach

• Mosh:

  mosh username@server

Final Thoughts

As a bioinformatician, your time is too valuable to spend restarting analyses due to technical hiccups. With screen, tmux, and mosh in your toolkit, you can work smarter, protect your progress, and stay productive no matter where you are. Start using these tools today and transform the way you work with remote systems.

Let me know how these tools work for you, and don\u2019t forget to follow for more bioinformatics tips!

The latest version is 1.2.4.

To cite Platanus, please use the following:

Kajitani R, Toshimoto K, Noguchi H, Toyoda A, Ogura Y, Okuno M, Yabana M, Harada M, Nagayasu E, Maruyama H, Kohara Y, Fujiyama A, Hayashi T, Itoh T, “Efficient de novo assembly of highly heterozygous genomes from whole-genome shotgun short reads”. Genome Res. 2014 Aug;24(8):1384-95. doi: 10.1101/gr.170720.113. [abstract | full text]

Address of the bookmark: http://platanus.bio.titech.ac.jp/

Address of the bookmark: https://github.com/lh3/fermi

Computational methods used by the Shasta assembler include:

• Using a run-length representation of the read sequence. This makes the assembly process more resilient to errors in homopolymer repeat counts, which are the most common type of errors in Oxford Nanopore reads.
• Using in some phases of the computation a representation of the read sequence based on markers, a fixed subset of short k-mers (k ≈ 10).

More at https://chanzuckerberg.github.io/shasta/index.html

Address of the bookmark: https://github.com/chanzuckerberg/shasta

List of analysis tools developed for Oxford Nanopore data

BWA
Fast nanopore data tuned alignment tool
https://github.com/lh3/bwa

GraphMap
Mapper for long and error-prone reads
https://github.com/isovic/graphmap

LAST
Nanopore tuned alignment tool
http://last.cbrc.jp/

LINKS
Software tool for long read scaffolding
https://github.com/warrenlr/LINKS/

marginAlign
Tools to align nanopore reads to a reference
https://github.com/benedictpaten/marginAlign

minoTour
Real time analysis tools
http://minotour.nottingham.ac.uk/

nanoCORR
Error-correction tool for nanopore sequence data
https://github.com/jgurtowski/nanocorr

NanoOK
Software for nanopore data, quality and error profiles
https://documentation.tgac.ac.uk/display/NANOOK/NanoOK

Nanopolish
Nanopore analysis and genome assembly software
https://github.com/jts/nanopolish

nanopore
Variant-detection tool for nanopore sequence data
https://github.com/mitenjain/nanopore

Nanocorrect
Error-correction tool for nanopore sequence data
https://github.com/jts/nanocorrect/

npReader
Real-time conversion and analysis of nanopore reads
https://github.com/mdcao/npReader

poRe
Tool for analyzing and visualizing nanopore data
https://sourceforge.net/p/rpore/wiki/Home/

PoreSeq
Error-correction and variant-calling software
https://github.com/tszalay/poreseq

Poretools
Nanopore sequence analysis and visualization software
https://github.com/arq5x/poretools

SSPACE-LongRead
Genome scaffolding tool
http://www.baseclear.com/genomics/bioinformatics/basetools/SSPACE-longread

SMIS
Genome scaffolding tool
https://sourceforge.net/projects/phusion2/files/smis/

List of assemblers for Oxford Nanopore MinION long reads

LQS
DALIGNER, Celera OLC Nanocorrect,
Nanopolish corrector
https://github.com/jts/nanopolish

PBcR
HGAP or BLASR, Celera OLC
PBcR corrector
http://wgs-assembler.sourceforge.net/wiki/index.php/PBcR
–
Canu
MHAP, Celera OLC
Canu corrector
https://github.com/marbl/canu

Falcon
String graph, Celera OLC
Falcon corrector
https://github.com/PacificBiosciences/falcon

Miniasm
OLC
https://github.com/lh3/miniasm

ra-integrate
OLC
https://github.com/mariokostelac/ra-integrate/

ALLPATHS-LG
de Bruijn graph
ALLPATHS-L corrector
https://www.broadinstitute.org/software/allpaths-lg/blog/?page_id=12

SPAdes
de Bruijn graph
SPAdes corrector
http://bioinf.spbau.ru/spades