Metagenomic simulators are a way of dealing with this issue; they produce artificial sequencing datasets in which both the composition of the microorganisms and the expected results are known. Researchers can then test a pipeline on such a controlled dataset and see precisely how well it functions. However, as metagenomic studies have become larger, more diverse, and more complex, simply generating artificial reads is no longer sufficient. The simulators now have to replicate community variation, sequencing errors, different sequencing platforms, massive data volumes, and even laboratory-based biases.

MIDASim (2024) was designed with a particular emphasis on microbial community dynamics. Unlike previous tools which regarded each simulated sample as individual, MIDASim is able to efficiently generate realistic multi-sample microbiome datasets, covering the cases where changes over time are being tracked. This feature is particularly useful when investigating how microbial communities vary between people, different experimental setups, or at various times. By overcoming the computational limitations of earlier simulation methods, MIDASim has made it easier to carry out large and complex microbiome simulation studies.

A major challenge is scale. Since modern metagenomic projects can involve millions or even billions of sequencing reads, generating such large synthetic datasets can become a significant computational problem. In order to tackle this issue, Izzy (2025) was developed. As a high-throughput metagenomic read simulator, Izzy is designed with speed in mind while still reproducing the typical patterns of sequencing errors. The people who developed it stated that it can be as much as 60 times faster than earlier tools, which makes large-scale simulations far more practical. Now, researchers can begin to ask not how long a simulation will take but rather what size dataset they want to test.

At the same time, the sequencing technology became more diverse. Researchers were not any longer restricted to using Illumina short reads since Oxford Nanopore and PacBio long-read sequencing also became important in the field of metagenomic research. In order to address these new requirements, MeSS (Metagenomic Sequence Simulator, 2025) was developed. The programme is based on a Snakemake framework and is therefore compatible with the Illumina, Oxford Nanopore and PacBio platforms. MeSS has also been designed to operate efficiently and to use less memory than earlier tools; it provides ready-made templates for the microbiomes of different sites in the human body, thus giving researchers a simple means of beginning to generate realistic simulated communities.

The simulation problem became even more specialized. Suppose that sequencing is not based on uniform sampling of DNA? In the case of targeted sequencing and hybridization-capture experiments, particular sequences are deliberately enriched, and the probability of capturing a target depends on both the probe and the target sequence. A standard model based on uniform sampling might fail to take into account this important feature of real experiments. That is why RAmpSim has been designed specifically to handle simulations for capture-based and targeted sequencing. Instead of depending solely on the assumption of uniform sampling, it includes a thermodynamic nearest-neighbor energy model to represent probe–target interactions and sequence-dependent enrichment. As a result, it is especially suitable for applications such as hybridization capture in metagenomics, where the efficiency of recovering a sequence can depend strongly on how it relates to the capture probes. RAmpSim thus reflects a wider trend towards simulations that aim not only to reproduce sequencing output but also key aspects of the experimental process itself.

MIDASim, Izzy, MeSS and RAmpSim all demonstrate how fast metagenomic simulation is evolving. MIDASim is able to deal with realistic variation within a large number of and changing microbial communities. Izzy overcomes the problem of generating very large datasets. MeSS provides support for a number of sequencing technologies in an efficient and repeatable manner. RAmpSim increases the experimental realism for capture-based sequencing. Although each of these tools addresses a separate issue, they all contribute to advancing the field.

Modern metagenomic simulation therefore aims not only at producing artificial FASTQ files. Researchers nowadays desire simulated datasets that reflect community changes, incorporate the characteristics of the sequencing platform, include real error patterns, take into account computational scale, and account for experimental biases. As metagenomic workflows become more advanced, the simulators have to keep up with this development. The tools are now going beyond that of simple data generators; they produce controlled versions of complex metagenomic experiments and thus provide researchers with something that ordinary sequencing data seldom does: a dataset in which the answer is known before any analysis takes place.

Step 1: Install BLAST

1. Download BLAST:

   • Visit the NCBI BLAST+ download page to download the appropriate version for your operating system (Windows, macOS, or Linux).

2. Install BLAST:

   • Extract the downloaded archive. For Linux/Mac, use:

     tar -xvzf ncbi-blast-*.tar.gz
     cd ncbi-blast-*
     

   • Add the BLAST binary folder to your system PATH for easier access:

     export PATH=$PATH:/path/to/ncbi-blast-*/bin
     

3. Verify Installation:
   Run the following command to ensure BLAST is installed correctly:

   blastn -version
   

Step 2: Prepare a Local Database

To run BLAST offline, you’ll need a sequence database.

1. Download a Pre-Built Database (Optional):

   • NCBI provides ready-to-use databases such as nt, nr, and Swiss-Prot. Use the update_blastdb.pl script (bundled with BLAST) to download these:

     update_blastdb.pl --decompress nt
     

2. Create a Custom Database:
   If you have specific sequences to use as a database:

   • Prepare a FASTA file containing the sequences.
   • Use makeblastdb to create a database:

     makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
     

     Replace [nucl|prot] with nucl for nucleotide sequences or prot for protein sequences.

Step 3: Prepare the Query Sequence

• Save your query sequence(s) in FASTA format.
• Ensure the file is properly formatted, with a header line starting with > followed by the sequence name, and the sequence on subsequent lines.

Example:

>query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA

Step 4: Run BLAST

1. Choose the Appropriate BLAST Tool:
   Depending on your data type:

   • blastn: For nucleotide-nucleotide searches.
   • blastp: For protein-protein searches.
   • blastx: Translates nucleotide sequences into proteins and compares them to a protein database.
   • tblastn: Compares protein sequences to a nucleotide database.
   • tblastx: Translates both nucleotide query and database sequences.

2. Run the Command:
   Example command for blastn:

   blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
   

   Explanation of Parameters:

   • -query: Specifies the query file.
   • -db: Points to the local database.
   • -out: Output file name.
   • -outfmt: Output format (e.g., 6 for tabular format).
   • -evalue: E-value cutoff for significance.

Step 5: Interpret Results

1. Output Formats:

   • Default (outfmt 0): Human-readable format.
   • Tabular (outfmt 6): Includes fields like query ID, subject ID, percent identity, alignment length, etc.

2. Analyze Results:
   Use tools like grep, Python, or R to parse and filter results for downstream analysis.

Step 6: Optimize Performance

For large datasets, BLAST can be resource-intensive. To improve performance:

1. Multithreading:
   Use the -num_threads option to leverage multiple CPU cores:

   blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
   

2. Database Subsetting:
   Split large databases into smaller chunks for faster searches.

3. Adjust Parameters:

   • Lower the -evalue threshold for stricter matches.
   • Use -max_target_seqs to limit the number of results per query.

Step 7: Update Databases (Optional)

If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:

update_blastdb.pl --decompress nt

Conclusion

Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.

For advanced use cases, explore BLAST’s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!

Why Remote Session Management is a Must-Have

In bioinformatics, tasks like genome assembly, RNA-seq analyses, and phylogenetic computations often take hours or days. A dropped SSH connection can result in:

• Lost Progress: Restarting a job from scratch wastes valuable time.
• Workflow Interruptions: Disruptions can derail your focus and productivity.
• Corrupted Data: Interrupted processes may lead to incomplete or corrupted outputs.

By integrating screen, tmux, or mosh into your workflow, you can avoid these setbacks and ensure a seamless experience.

Screen: The Classic Workhorse

Screen is a terminal multiplexer that comes pre-installed on most Linux systems. It allows you to manage multiple terminal sessions and reconnect to them even after being disconnected.

Getting Started with Screen:

1. Start a Session:
   screen
2. Detach from a Session:
   Press Ctrl+A, then D.
3. Reattach to a Session:
   screen -r

Pro Tip: Enhance your screen experience with a customized .screenrc configuration file. Download one here: Get .screenrc.

Tmux: A Modern Alternative

Tmux takes everything great about screen and adds modern features, including better key bindings and intuitive session management. It\u2019s perfect for bioinformaticians who want more control over their workflow.

Getting Started with Tmux:

1. Start a Session:
   tmux
2. Detach from a Session:
   Press Ctrl+B, then D.
3. Reattach to a Session:
   tmux attach

Customize Your Tmux Experience:
Use a .tmux.conf file to personalize your setup. Grab one here: Download .tmux.conf.

Mosh: The Mobile Shell for Unreliable Connections

SSH works well for stable networks, but it struggles in areas with spotty connectivity. Enter Mosh, the Mobile Shell. Designed for intermittent networks, Mosh keeps your session alive even when the connection drops temporarily.

Why Mosh is a Game-Changer:

• No lag over high-latency networks.
• Automatically reconnects when the network is restored.
• Ideal for working on the go, from cafes to trains.

Getting Started with Mosh:

1. Install Mosh:
   sudo apt install mosh # For Debian/Ubuntu
2. Connect to a Server:
   mosh username@server

Learn more at mosh.org.

Why This Matters for Bioinformatics

Every bioinformatician knows the value of time and data integrity. Tools like screen, tmux, and mosh provide a lifeline when running long analyses, enabling you to:

• Safeguard your work against disconnections.
• Easily manage multiple workflows in parallel.
• Stay productive, even in challenging environments.

Quickstart Cheat Sheet

• Screen:

  screen # Start a session Ctrl+A, D # Detach screen -r # Reattach

• Tmux:

  tmux # Start a session Ctrl+B, D # Detach tmux attach # Reattach

• Mosh:

  mosh username@server

Final Thoughts

As a bioinformatician, your time is too valuable to spend restarting analyses due to technical hiccups. With screen, tmux, and mosh in your toolkit, you can work smarter, protect your progress, and stay productive no matter where you are. Start using these tools today and transform the way you work with remote systems.

Let me know how these tools work for you, and don\u2019t forget to follow for more bioinformatics tips!