Address of the bookmark: https://github.com/Magdoll/Cogent

At present, some people have posted articles about the analysis process of WGD. I searched for the keyword "wgd pipeline" and found the following:

GenoDup: https:// github.com/MaoYafei/GenoDup-Pipeline
https://peerj.com/articles/6303/
WGDdetector: https:// github.com/yongzhiyang2 012/WGDdetector
https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2670-3
wgd: https:// github.com/arzwa/wgd
https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1142-2#Sec1
https://bmcbiol.biomedcentral.com/articles/10.1186/s12915-017-0399-x
GeNoGAP https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1142-2
https://bmcbiol.biomedcentral.com/articles/10.1186/s12915-017-0399-x
https://github.com/dfguan/purge_dups
https://www.biorxiv.org/content/10.1101/2020.01.24.917997v1

This article introduces the usage of wgd.

Wgd cannot be installed directly with bioconda at present, so it is a little troublesome to install, because it depends on a lot of software. wgd depends on the following software

BLAST
MCL
MUSCLE/MAFFT/PRANK
PAML
PhyML/FastTree
i-ADHoRe

But the good news is that most of the software it depends on can be installed with bioconda

conda create -n wgd python=3.5 blast mcl muscle mafft prank paml fasttree cmake libpng mpi=1.0=mpich
conda activate wgd

Here mpi=1.0=mpich is selected, because i-adhore depends on mpich. If openmpi is installed, an error will appear while loading shared libraries: libmpi_cxx.so.40: cannot open shared object file: No such file or directory

After that, the installation is much simpler

git clone https://github.com/arzwa/wgd.git
cd wgd
pip install .
pip install git+https://github.com/arzwa/wgd.git
For i-ADHoRe, you need to register at http:// bioinformatics.psb.ugent.be /webtools/i-adhore/licensing/Agree to the license to download i-ADHoRe-3.0

Since my miniconda3 installed ~/opt/, the installation path is so~/opt/miniconda3/envs/wgd/

tar -zxvf i-adhore-3.0.01.tar.gz
cd i-adhore-3.0.01
mkdir -p build && cd build
cmake .. -DCMAKE_INSTALL_PREFIX=~/opt/miniconda3/envs/wgd/
make -j 4
make insatall

Take the sugarcane genome Saccharum spontaneum L as an example. The genome is 8-ploid with 32 chromosomes (2n = 4x8 = 32)

Download the tutorial for CDS and GFF annotation files

mkdir -p wgd_tutorial && cd wgd_tutorial
wget http://www.life.illinois.edu/ming/downloads/Spontaneum_genome/Sspon.v20190103.cds.fasta.gz
wget http://www.life.illinois.edu/ming/downloads/Spontaneum_genome/Sspon.v20190103.gff3.gz
gunzip *.gz

First conda activate wgdstart our analysis environment, and then start the analysis

Step 1 : Use to wgd mclidentify homologous genes in the genome

wgd mcl -n 20 --cds --mcl -s Sspon.v20190103.cds.fasta -o Sspon_cds.out

Step 2 : Use to wgd ksdbuild Ks distribution

wgd ksd --n_threads 80 Sspon_cds.out/Sspon.v20190103.cds.fasta.blast.tsv.mcl Sspon.v20190103.cds.fasta

Step 3 : If the quality of the genome is good, then wgd syncollinearity analysis can be used . It can help us find the collinearity block in the genome and the corresponding anchor point

wgd syn --feature gene --gene_attribute ID \
-ks wgd_ksd/Sspon.v20190103.cds.fasta.ks.tsv \
Sspon.v20190103.gff3 Sspon_cds.out/Sspon.v20190103.cds.fasta.blast.tsv.mcl

 For more reading - There are 9 sub-modules in WGD

• kde: KDE fitting to the Ks distribution
• ksd: Ks distribution construction
• mcl: BLASP comparison of All-vs-ALl + MCL classification analysis.
• mix: Hybrid modeling of Ks distribution.
• pre: preprocess the CDS file
• syn: Call I-ADHoRe 3.0 to use GFF files for collinearity analysis
• viz: draw histogram and density plot
• wf1: Ks standard analysis procedure of the whole genome paranome (paranome), call mcl, ksd and syn
• wf2: Ks standard analysis procedure of one-vs-one homologous gene (ortholog), call wcl and kSD

Once a query gene has been entered, it is displayed in its genomic context in parallel to the genomic context of all its orthologous and paralogous copies in all the other sequenced metazoan genomes. Moreover, Genomicus stores and displays the predicted ancestral genome structure in all the ancestral species within the phylogenetic range of interest.

All the data on extant species displayed in this browser are from Ensembl.

Summary statistics of Genomicus version 105.01: (view species tree in pdf or newick)

Address of the bookmark: https://www.genomicus.bio.ens.psl.eu/genomicus-105.01/cgi-bin/search.pl

With Single Molecule, Real-Time (SMRT) Sequencing, you can access structural variations having a broad range of sizes, types, and GC content with the ability to:

• Uncover missing heritability linked to structural variation
• Unambiguously identify genomic context and variant breakpoints at the sequence level to unravel the genetic etiology of disease
• Resolve structural variation across the complete size spectrum with basepair resolution

Following are the SV tools, which can assist you to achieve your goal.

Sniffles: Structural variation caller using third generation sequencing

Sniffles is a structural variation caller using third generation sequencing (PacBio or Oxford Nanopore). It detects all types of SVs using evidence from split-read alignments, high-mismatch regions, and coverage analysis. Please note the current version of Sniffles requires sorted output from BWA-MEM (use -M and -x parameter) or NGM-LR with the optional SAM attributes enabled! 

More at https://github.com/fritzsedlazeck/Sniffles

MultiBreak-SV: It identifies structural variants from next-generation paired end data, third-generation long read data, or data from a combination of sequencing platforms.

There are two pieces of software in this release: (1) a pre-processor that takes machineformat (.m5) BLASR files, and (2) MultiBreak-SV. For installation and usage instructions, see doc/MultiBreakSV-Manual.txt.

More at https://github.com/raphael-group/multibreak-sv

Parliament: A Structural Variation Tool. Why ask a single sv-detection approach to find every variant when you can have a parliament of tools deciding?

Publication about the algorithm and “…the first long-read characterization of structural variation in a diploid human personal genome…” (HS1011) - “Assessing structural variation in a personal genome—towards a human reference diploid genome”

More at https://sourceforge.net/projects/parliamentsv/

https://www.dnanexus.com/papers/Parliament_Info_Sheet.pdf

PBHoney: the structural variation discovery tool 

PBHoney is an implementation of two variant-identification approaches designed to exploit the high mappability of long reads (i.e., greater than 10,000 bp). PBHoney considers both intra-read discordance and soft-clipped tails of long reads to identify structural variants.

Read The Paper http://www.biomedcentral.com/1471-2105/15/180/abstract

More at https://sourceforge.net/projects/pb-jelly/

SMRT-SV: Structural variant and indel caller for PacBio reads

Structural variant (SV) and indel caller for PacBio reads based on methods from Chaisson et al. 2014.

SMRT-SV provides an official software package for tools described in Chaisson et al. 2014 and adds several key features including the following.

• Unified variant calling user interface with built-in cluster compute support
• Small indel calling (2-49 bp)
• Improved inversion calling (screenInversions)
• Quality metric for SV calls based on number of local assemblies supporting each call
• Higher sensitivity for SV calls using tiled local assemblies across the entire genome instead of "signature" regions
• Genotyping of SVs with Illumina paired-end reads from WGS samples

More at https://github.com/EichlerLab/pacbio_variant_caller

Address of the bookmark: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4783527/

Features

• Circular and linear views of genomes

• Capable of drawing genomes up to 10 Mbp with 1000's of features and 100's contigs

• Smooth zooming down to the sequence level

• Easily generate features and plots directly form the sequence (e.g. ORFs, GC-content and GC-Skew)

• Save high resolution PNG maps up to 8000x8000px

• Fully documented API for interacting with CGView.js maps

Address of the bookmark: https://js.cgview.ca/

GoJS offers many advanced features for user interactivity such as drag-and-drop, copy-and-paste, in-place text editing, tooltips, context menus, automatic layouts, templates, data binding and models, transactional state and undo management, palettes, overviews, event handlers, commands, and an extensible tool system for custom operations.

GoJS is pure JavaScript, so users get interactivity without requiring round-trips to servers and without plugins. GoJS normally runs completely in the browser, rendering to an HTML5 Canvas element or SVG without any server-side requirements. GoJS does not depend on any JavaScript libraries or frameworks, so it should work with any HTML or JavaScript framework or with no framework at all.          

More at http://gojs.net/latest/index.html

Address of the bookmark: http://gojs.net/latest/index.html

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

More at https://github.com/AntonBankevich/jumboDB

Address of the bookmark: https://github.com/AntonBankevich/jumboDB

Address of the bookmark: https://github.com/codialab/GFAffix