<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/34812?offset=70</link>
	<atom:link href="https://bioinformaticsonline.com/related/34812?offset=70" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/1182/installing-perl-gd-module</guid>
	<pubDate>Mon, 22 Jul 2013 14:02:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/1182/installing-perl-gd-module</link>
	<title><![CDATA[Installing Perl GD Module]]></title>
	<description><![CDATA[<div><p>In comparative genome analysis work, we usually compare more than two genomes and looks for syntenic regions amongst them. In my research I used Evolution Highway (RH) <a href="http://eh-demo.ncsa.uiuc.edu/">http://eh-demo.ncsa.uiuc.edu/</a>, which is a collaborative project designed to provide a visual means for simultaneously comparing genomes of multiple amniote species. The tool removes the burden of manually aligning these maps and allows cognitive skills to be used toward something more valuable than preparation and transformation of data. In addition to EH, attractive Circos (<a href="http://circos.ca/">http://circos.ca/</a>) is also very popular for this kind of analysis.</p><p>The EH is available online, and can be easily access and use, whereas Circos installation is not entirely straightforward. One of the most difficult parts of the installation involves installing the GD library. Since there weren't good instructions for installing this library on the internet I decided to post instructions here in case they are useful to anyone else.</p><p><strong>Following are the steps to install GD modules in Mac OS</strong><br /><br />1. Setup<br /><br />Create a folder for the files:<br /><br />$ mkdir -p /SourceCache<br />$ cd /SourceCache<br /><br />Get and unpack the required Jpeg-6b and GD libraries:<br />Download Jpeg-6b (<a href="http://code.google.com/p/google-desktop-for-linux-mirror/downloads/detail?name=jpeg-6b.tar.gz&amp;can=2&amp;q">http://code.google.com/p/google-desktop-for-linux-mirror/downloads/detail?name=jpeg-6b.tar.gz&amp;can=2&amp;q</a>)<br />Download GD (<a href="http://search.cpan.org/%7Elds/GD-2.46/">http://search.cpan.org/~lds/GD-2.46/</a>)<br /><br />Place the "tar.gz" files in "/SourceCache" and double click to unpack.<br /><br />2. Install libjpeg<br /><br />Copy the "config.sub" and "config.guess" files to "/SourceCache". Note that your "config.sub" and ""config.guess" files may be in a slightly different location. The commands below show where they were on my machine:<br /><br />$ cd /SourceCache/jpeg-6b/src<br />$ cp /usr/share/libtool/config/config.sub .<br />$ cp /usr/share/libtool/config/config.guess .<br /><br />Configure libjpeg as follows. Note that this was installed on a 64 bit machine. However, this method may configure it in a 32 bit format. This may not be the best way to configure the installation but it works.<br /><br />$ .configure --enable-shared<br />$ make<br /><br />Check to see if the following directories exist on your machine. Create the missing directories in the following manner:<br /><br />$ mkdir -p /usr/local/include<br />$ mkdir -p /usr/local/bin<br />$ mkdir -p /usr/local/lib<br />$ mkdir -p /usr/local/man/man1<br /><br />Finish making and installing libjpeg:<br /><br />$ make install<br /><br />3. Install GD<br /><br />$ cd /SourceCache/GD-2.46/GD/<br />$ perl Makefile.PL<br />$ make<br />$ make test (optional)<br />$ make html (optional)<br />$ make install</p><p><strong>Other way for Mac OS</strong><br />The easiest way to get a lot of these is with a program called Fink, which is similar in nature to the CPAN installer, but installs common GNU utilities. Fink is available from &lt;<a href="http://sourceforge.net/projects/fink/%3E">http://sourceforge.net/projects/fink/&gt;</a>.<br /><br />Follow the instructions for setting up Fink. Once it's installed, you'll want to run the following as root: fink install gd<br /><br />It will prompt you for a number of dependencies, type 'y' and hit enter to install all of the dependencies. Then watch it work.<br /><br />To prevent creating conflicts with the software that Apple installs by default, Fink creates its own directory tree at /sw where it installs most of the software that it installs. This means your libraries and headers for libgd will be at /sw/lib and /sw/include instead of /usr/lib and /usr/local/include. Because of these changed locations for the libraries, the Perl GD module will not install directly via CPAN, because it looks for the specific paths instead of getting them from your environment. But there's a way around that :-)<br /><br />Instead of typing "install GD" at the cpan&gt; prompt, type look GD. This should go through the motions of downloading the latest version of the GD module, then it will open a shell and drop you into the build directory. Apply below patch to the Makefile.PL file (save the patch into a file and use the command patch &lt; patchfile.)<br /><br />Then, run these commands to finish the installation of the GD module:<br /><br />perl Makefile.PL<br />make<br />make test<br />make install<br />And don't forget to run exit to get back to CPAN.</p><p>&nbsp;</p><p><strong>Install on MS Window, using PPM</strong></p><p>C:\Documents and Settings\Owner&gt;ppm<br />PPM interactive shell (2.2.0) - type 'help' for available commands.<br />PPM&gt; install GD<br />Install package 'GD?' (y/N): y<br />Installing package 'GD'...<br />Downloading <a href="http://ppm.ActiveState.com/PPMPackages/5.6plus/MSW">http://ppm.ActiveState.com/PPMPackages/5.6plus/MSW</a>. ...<br />Installing C:\Perl\site\lib\auto\GD\GD.bs<br />Installing C:\Perl\site\lib\auto\GD\GD.dll<br />Installing C:\Perl\site\lib\auto\GD\GD.exp<br />Installing C:\Perl\site\lib\auto\GD\GD.lib<br />Installing C:\Perl\html\site\lib\GD.html<br />Installing C:\Perl\site\lib\GD.pm<br />Installing C:\Perl\site\lib\qd.pl<br />Installing C:\Perl\site\lib\auto\GD\autosplit.ix<br />PPM&gt;<br /><br /><br />If you can't install it from ppm. You can download it:<br /><a href="http://ppm.ActiveState.com/PPMPackages/5.6plus/MSW">http://ppm.ActiveState.com/PPMPackages/5.6plus/MSW</a>.<br /><br /><br />BTW,All Perl 5.6.1 Modules are located at:<br /><br /><a href="http://ppm.ActiveState.com/PPMPackages/5.6plus/MSW">http://ppm.ActiveState.com/PPMPackages/5.6plus/MSW</a>.</p><p>&nbsp;</p><p><strong>Install the Perl GD Module on Linux</strong><br /><br />$ sudo perl -MCPAN -e shell<br /><br />Since it was the first time I had run this command on this particular machine I had to answer a lot of questions but simply selected the defaults for everything as this usually works for me. Once in the CPAN shell I entered<br /><br />$ install Bundle::CPAN<br /><br />and selected all of the defaults again. Once the CPAN bundle had finished installing I tried to install GD::Graph by typing<br /><br />$ install GD::Graph<br /><br />but it failed with hundreds of errors &ndash; the first of which was<br /><br />GD.xs:7:16: error: gd.h: No such file or directory<br /><br />This was fixed with the following apt-get command (in the bash shell)<br /><br />$ sudo apt-get install libgd2-xpm-dev<br /><br />back in the CPAN shell I still couldn&rsquo;t get GD::Graph to build and I guessed this was because of some left over files from the failed build. I don&rsquo;t know the command to clean things up inside the CPAN shell and am too lazy to read the docs so I simply went into the .cpan/build directory in my home directory and deleted anything that started with GD &ndash; eg<br /><br />$ rm -rf GD-2.35-HC_vkB<br /><br />$ rm -rf GDGraph-1.44-Evfibe<br /><br />and so on. Those strings at the end (VkB and so on) look random so they might be different on your machine. Then I went back into the CPAN shell and ran<br /><br />$ install GD::Graph<br /><br />There were a few dependencies which the script fetched and installed for me but everything worked smoothly.</p><p>Manual and other Perl Module instalation are mentioned in my previous blog @ <a href="http://bioinformaticsonline.com/blog/view/710/how-to-install-perl-modules-manually-using-cpan-command-and-other-quick-ways">http://bioinformaticsonline.com/blog/view/710/how-to-install-perl-modules-manually-using-cpan-command-and-other-quick-ways</a></p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/2376/citrus-perl</guid>
	<pubDate>Wed, 14 Aug 2013 14:57:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/2376/citrus-perl</link>
	<title><![CDATA[Citrus Perl]]></title>
	<description><![CDATA[<p>Citrus Perl is a binary distribution of Perl created for GUI application developers. The distribution includes <a href="http://wxperl.sourceforge.net">wxPerl</a>, the Perl wrapper for <a href="http://www.wxwidgets.org">wxWidgets</a>. Where supported by the operating system wxWidgets is available as a package for the 2.8.x stable branch and the 2.9.x development branch.</p><p>Address of the bookmark: <a href="http://www.citrusperl.com/" rel="nofollow">http://www.citrusperl.com/</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/4037/perl-and-bioperl-tutorials</guid>
	<pubDate>Wed, 28 Aug 2013 05:51:38 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/4037/perl-and-bioperl-tutorials</link>
	<title><![CDATA[Perl and BioPerl Tutorials]]></title>
	<description><![CDATA[<p>This bookmark is created to store the useful Perl and BioPerl tutorial links at one place. Feel free to share and add more useful tutorial links here ....&nbsp;</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="http://cbb.sjtu.edu.cn/course/database/beginning.pdf" rel="nofollow">http://cbb.sjtu.edu.cn/course/database/beginning.pdf</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/11181/perl-one-liner-for-bioinformatician</guid>
	<pubDate>Fri, 30 May 2014 05:49:07 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/11181/perl-one-liner-for-bioinformatician</link>
	<title><![CDATA[Perl one-liner for bioinformatician !!!]]></title>
	<description><![CDATA[<p>With the emergence of NGS technologies, and sequencing data most of the bioinformaticians mung and wrangle around massive amounts of genomics text. There are several "standardized" file formats (FASTQ, SAM, VCF, etc.) and some tools for manipulating them (fastx toolkit, samtools, vcftools, etc.), there are still times where knowing a little bit of Perl onliner is extremely helpful.</p><p>Perl one-liners are small and awesome Perl programs that fit in a single line of code and they do one thing really well. These things include changing line spacing, numbering lines, doing calculations, converting and substituting text, deleting and printing certain lines, parsing logs, editing files in-place, doing statistics, carrying out system administration tasks, updating a bunch of files at once, and many more. Perl one-liners will make you the shell warrior. Anything that took you minutes to solve, will now take you seconds!<br /><br />perl -pe '$\="\n"'&nbsp; &nbsp;<br />#double space a file<br /><br />perl -pe '$_ .= "\n" unless /^$/' <br />#double space a file except blank lines<br /><br />perl -pe '$_.="\n"x7' <br />#7 space in a line.<br /><br />perl -ne 'print unless /^$/' <br />#remove all blank lines<br /><br />perl -lne 'print if length($_) &lt; 20' <br />#print all lines with length less than 20.<br /><br />perl -00 -pe '' <br />#If there are multiple spaces, delete all leaving one(make the file a single spaced file).<br /><br />perl -00 -pe '$_.="\n"x4' <br />#Expand single blank lines into 4 consecutive blank lines<br /><br />perl -pe '$_ = "$. $_"'<br />#Number all lines in a file<br /><br />perl -pe '$_ = ++$a." $_" if /./' <br />#Number only non-empty lines in a file<br /><br />perl -ne 'print ++$a." $_" if /./' <br />#Number and print only non-empty lines in a file<br /><br />perl -pe '$_ = ++$a." $_" if /regex/' <br />#Number only lines that match a pattern<br /><br />perl -ne 'print ++$a." $_" if /regex/' <br />#Number and print only lines that match a pattern<br /><br />perl -ne 'printf "%-5d %s", $., $_ if /regex/' <br />#Left align lines with 5 white spaces if matches a pattern (perl -ne 'printf "%-5d %s", $., $_' : for all the lines)<br /><br />perl -le 'print scalar(grep{/./}&lt;&gt;)' <br />#prints the total number of non-empty lines in a file<br /><br />perl -lne '$a++ if /regex/; END {print $a+0}' <br />#print the total number of lines that matches the pattern<br /><br />perl -alne 'print scalar @F' <br />#print the total number fields(words) in each line.<br /><br />perl -alne '$t += @F; END { print $t}' <br />#Find total number of words in the file<br /><br />perl -alne 'map { /regex/ &amp;&amp; $t++ } @F; END { print $t }' <br />#find total number of fields that match the pattern<br /><br />perl -lne '/regex/ &amp;&amp; $t++; END { print $t }' <br />#Find total number of lines that match a pattern<br /><br />perl -le '$n = 20; $m = 35; ($m,$n) = ($n,$m%$n) while $n; print $m' <br />#will calculate the GCD of two numbers.<br /><br />perl -le '$a = $n = 20; $b = $m = 35; ($m,$n) = ($n,$m%$n) while $n; print $a*$b/$m' <br />#will calculate lcd of 20 and 35.<br /><br />perl -le '$n=10; $min=5; $max=15; $, = " "; print map { int(rand($max-$min))+$min } 1..$n' <br />#Generates 10 random numbers between 5 and 15.<br /><br />perl -le 'print map { ("a".."z",&rdquo;0&rdquo;..&rdquo;9&rdquo;)[rand 36] } 1..8'<br />#Generates a 8 character password from a to z and number 0 &ndash; 9.<br /><br />perl -le 'print map { ("a",&rdquo;t&rdquo;,&rdquo;g&rdquo;,&rdquo;c&rdquo;)[rand 4] } 1..20'<br />#Generates a 20 nucleotide long random residue.<br /><br />perl -le 'print "a"x50'<br />#generate a string of &lsquo;x&rsquo; 50 character long<br /><br />perl -le 'print join ", ", map { ord } split //, "hello world"'<br />#Will print the ascii value of the string hello world.<br /><br />perl -le '@ascii = (99, 111, 100, 105, 110, 103); print pack("C*", @ascii)'<br />#converts ascii values into character strings.<br /><br />perl -le '@odd = grep {$_ % 2 == 1} 1..100; print "@odd"'<br />#Generates an array of odd numbers.<br /><br />perl -le '@even = grep {$_ % 2 == 0} 1..100; print "@even"'<br />#Generate an array of even numbers<br /><br />perl -lpe 'y/A-Za-z/N-ZA-Mn-za-m/' file <br />#Convert the entire file into 13 characters offset(ROT13)<br /><br />perl -nle 'print uc' <br />#Convert all text to uppercase:<br /><br />perl -nle 'print lc' <br />#Convert text to lowercase:<br /><br />perl -nle 'print ucfirst lc' <br />#Convert only first letter of first word to uppercas<br /><br />perl -ple 'y/A-Za-z/a-zA-Z/' <br />#Convert upper case to lower case and vice versa<br /><br />perl -ple 's/(\w+)/\u$1/g' <br />#Camel Casing<br /><br />perl -pe 's|\n|\r\n|' <br />#Convert unix new lines into DOS new lines:<br /><br />perl -pe 's|\r\n|\n|' <br />#Convert DOS newlines into unix new line<br /><br />perl -pe 's|\n|\r|' <br />#Convert unix newlines into MAC newlines:<br /><br />perl -pe '/regexp/ &amp;&amp; s/foo/bar/' <br />#Substitute a foo with a bar in a line with a regexp.</p><p>Reference/Sources:</p><p>http://genomics-array.blogspot.in/2010/11/some-unixperl-oneliners-for.html</p><p><a href="http://genomespot.blogspot.com/2013/08/a-selection-of-useful-bash-one-liners.html">http://genomespot.blogspot.com/2013/08/a-selection-of-useful-bash-one-liners.html</a></p><p><a href="http://biowize.wordpress.com/2012/06/15/command-line-magic-for-your-gene-annotations/">http://biowize.wordpress.com/2012/06/15/command-line-magic-for-your-gene-annotations/</a></p><p><a href="http://genomics-array.blogspot.com/2010/11/some-unixperl-oneliners-for.html">http://genomics-array.blogspot.com/2010/11/some-unixperl-oneliners-for.html</a></p><p><a href="http://bioexpressblog.wordpress.com/2013/04/05/split-multi-fasta-sequence-file/">http://bioexpressblog.wordpress.com/2013/04/05/split-multi-fasta-sequence-file/</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22571/pattern-matching-problem-solution-with-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:58:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22571/pattern-matching-problem-solution-with-perl</link>
	<title><![CDATA[Pattern Matching Problem Solution with Perl]]></title>
	<description><![CDATA[<p>Problem at http://rosalind.info/problems/1c/</p><p>#Find all occurrences of a pattern in a string.<br />#Given: Strings Pattern and Genome.<br />#Return: All starting positions in Genome where Pattern appears as a substring. Use 0-based indexing.<br /><br />use strict;<br />use warnings;<br /><br />my $string="GATATATGCATATACTT";<br />my $subStr="ATAT";<br />my $kmer=length($subStr);<br /><br />kmerMatch ($string, $subStr, $kmer);<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />for (my $aa=0; $aa&lt;=(length($string)-$kmer); $aa++) {<br />&nbsp;&nbsp;&nbsp; my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp;&nbsp; if ($myWin eq $myStr) {<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; #print "$myWin eq $myStr\n";<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; print $aa;<br />&nbsp;&nbsp;&nbsp; }<br />}<br />}</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/22961/bioscripts</guid>
	<pubDate>Sun, 28 Jun 2015 07:46:14 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/22961/bioscripts</link>
	<title><![CDATA[BioScripts]]></title>
	<description><![CDATA[<p>You are requested to please bookmark collection of bioinformatics tools, scripts, codes that can be pieced together in a very easy and flexible manner to perform both simple and complex bioinformatics tasks.</p>
<p>The next-generation sequencing included whole genome sequencing(WGS), transcriptome sequencing (whole cDNA sequencing, RNA-seq), digital gene expression sequencing (Tag-Seq), ChIP-Seq, and so on. And there are many sequencing platform to generate sequece, as well know Sanger/ABi(the frist generation), Solexa/illumina, SOLiD/ABi, 454/Roche. But thier sequence format is different, also they have different error type. High quality data is very important for further analysis or data mining. There are many pipeline for raw sequence quality analysis and control with few of process for reporting reads quality statistical details, trimming, filtering, and error correction. Please bookmarks them for the benefits of bioinformatics community.</p>
<p>https://code.google.com/p/biowiki/</p>
<p>https://code.google.com/p/ngs-pipeline/source/browse/#svn%2Ftrunk</p>
<p>NGSand Perl scripts https://code.google.com/hosting/search?q=NGS+perl&amp;projectsearch=Search+projects</p>
<p>NGS and Python scripts https://code.google.com/hosting/search?q=NGS+Python&amp;projectsearch=Search+projects</p><p>Address of the bookmark: <a href="https://code.google.com/hosting/search?q=bioinformatics&amp;sa=Search" rel="nofollow">https://code.google.com/hosting/search?q=bioinformatics&amp;sa=Search</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/29479/how-to-install-perl-modules-on-mac-os-x-in-easy-steps</guid>
	<pubDate>Thu, 20 Oct 2016 07:26:29 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/29479/how-to-install-perl-modules-on-mac-os-x-in-easy-steps</link>
	<title><![CDATA[How to install Perl modules on Mac OS X in easy steps !!]]></title>
	<description><![CDATA[<p>Today at work, I learned how to install Perl modules using&nbsp;<a href="http://en.wikipedia.org/wiki/CPAN">CPAN</a>. It&rsquo;s a lot easier than I thought.</p><p>You see, for the past couple of years, I&rsquo;ve been a bit frustrated because OS X does not come with a whole lot of Perl modules pre-installed, and for all I googled, I couldn&rsquo;t find an &ldquo;idiot&rsquo;s&rdquo; guide for moderately-savvy-but-not-expert users like myself to install modules and dependencies on demand.</p><p>The only instructions I could find point to&nbsp;<a href="http://fink.sourceforge.net/">Fink</a>, which basically installs modules in a path that isn&rsquo;t included in the Perl @INC variable, meaning you have to manually specify the full path to the modules in every script &mdash; which is not a lot of fun if you&rsquo;re developing on OS X and deploying on Red Hat, for instance.</p><p>Moreover, Fink doesn&rsquo;t seem to make every module available, and it&rsquo;s not very easy to determine which Fink package you need to install if you need a particular module.</p><p>So, with a script that called on several apparently unavailable modules, and a deadline looming, I finally decided to suck it up and figure out how to use CPAN to install them:</p><h4>1) Make sure you have the Apple Developer Tools (XCode) installed.</h4><p>These are on one of your install discs, or available as a huge but free download from the&nbsp;<a href="https://developer.apple.com/xcode/">Apple Developer Connection</a>&nbsp;[free registration required] or the Mac App Store. I thought I had them, but apparently when we upgraded that computer to Tiger, they went missing.</p><p>If you don&rsquo;t have this stuff installed, your installation will fail with errors about unavailable commands.</p><h4>1.5) Install Command Line Tools (Recent XCode versions only)</h4><p>(Thank you to Tom Marchioro for informing me about this step.)</p><p>Older versions of XCode installed the command line tools (which are required to properly install CPAN modules) by default, but apparently newer ones do not. To check whether you have the command line tools already installed, run the following from the Terminal:</p><p><code>$ which make</code></p><p>This command checks the system for the &ldquo;<code>make</code>&rdquo; tool. If it spits out something like&nbsp;<code>/usr/bin/make</code>&nbsp;you&rsquo;re golden and can skip ahead to Step 2. If you just get a new prompt and no output, you&rsquo;ll need to install the tools:</p><ol>
<li>Launch XCode and bring up the Preferences panel.</li>
<li>Click on the Downloads tab</li>
<li>Click to install the Command Line Tools</li>
</ol><p>If you like, you can run&nbsp;<code>which make</code>&nbsp;again to confirm that everything&rsquo;s installed correctly.</p><h4>2) Configure CPAN.</h4><p><code>$ sudo perl -MCPAN -e shell</code></p><p><code>perl&gt; o conf init</code></p><p>This will prompt you for some settings. You can accept the defaults for almost everything (just hit &ldquo;return&rdquo;). The two things you must fill in are the path to&nbsp;<code>make</code>&nbsp;(which should be&nbsp;<code>/usr/bin/make</code>&nbsp;or the value returned when you run&nbsp;<code>which make</code>&nbsp;from the command line) and your choice of CPAN mirrors (which you actually choose don&rsquo;t really matter, but it won&rsquo;t let you finish until you select at least one). If you use a proxy or a very restrictive firewall, you may have to configure those settings as well.</p><p>If you skip Step 2, you may get errors about&nbsp;<code>make</code>&nbsp;being unavailable.</p><h4>3) Upgrade CPAN</h4><p><code>$ sudo perl -MCPAN -e 'install Bundle::CPAN'</code></p><p>Don&rsquo;t forget the&nbsp;<code>sudo</code>, or it&rsquo;ll fail with permissions errors, probably when doing something relatively unimportant like installing&nbsp;<code>man</code>&nbsp;files.</p><p>This will spend a long time downloading, testing, and compiling various files and dependencies. Bear with it. It will prompt you a few times about dependencies. You probably want to enter &ldquo;yes&rdquo;. I agreed to everything it asked me, and everything turned out fine. YMMV of course. If everything installs properly, it&rsquo;ll give you an &ldquo;OK&rdquo; at the end.</p><h4>4) Install your modules. For each module&hellip;.</h4><p><code>$ sudo perl -MCPAN -e 'install Bundle::Name'</code></p><p>or</p><p><code>$ sudo perl -MCPAN -e 'install Module::Name'</code></p><p>This will install the module&nbsp;<em>and</em>&nbsp;its dependencies. Nice, eh? Again, don&rsquo;t forget the&nbsp;<code>sudo</code>.</p><p>The first time you run this after upgrading CPAN, it may prompt you to configure again (see Step 2). If you accept its offer to try to configure itself automatically, it may just run through everything without a problem.</p><p>There are a couple of potential pitfalls with specific modules (such as the<code>LWP::UserAgent</code>&nbsp;/&nbsp;<code>HEAD</code>&nbsp;issue), but most have workarounds, and I haven&rsquo;t run into anything that wasn&rsquo;t easily recoverable.</p><p>And that&rsquo;s it!</p><p>Did you find this useful? Is there anything I missed?</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/33586/genetic-mapper-svg-genetic-map-drawer</guid>
	<pubDate>Sun, 18 Jun 2017 14:11:10 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/33586/genetic-mapper-svg-genetic-map-drawer</link>
	<title><![CDATA[Genetic-mapper: SVG Genetic Map Drawer]]></title>
	<description><![CDATA[<p><span>Genetic-mapper is a perl script able to draw publication-ready vectorial genetic maps.</span></p>
<p>Perl script for creating a publication-ready vectorial genetic/linkage map in Scalable Vector Graphics (SVG) format. The resulting file can either be submitted for publication and edited with any vectorial drawing software like&nbsp;<a href="https://inkscape.org/">Inkscape</a>&nbsp;and&nbsp;<a href="http://www.adobe.com/uk/products/illustrator.html">Abobe Illustrator(R)</a>.</p>
<p>The input file must be a text file with at least the marker name (ID), linkage group (LG) and the position (POS) separeted by tabulations. Additionally a logarithm of odds (LOD score) can be provided. Any extra parameter will be ignored.</p>
<pre><code>map.tsv

ID&lt;tab&gt;LG&lt;tab&gt;POS&lt;tab&gt;LOD
13519  12     0       0.250840894
2718   12     1.0     0.250840893
11040  12     1.6     0.252843341
...</code></pre>
<p>https://github.com/pseudogene/genetic-mapper</p><p>Address of the bookmark: <a href="https://github.com/pseudogene/genetic-mapper" rel="nofollow">https://github.com/pseudogene/genetic-mapper</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/34864/installing-perl-environment-on-linux</guid>
	<pubDate>Tue, 26 Dec 2017 21:21:50 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/34864/installing-perl-environment-on-linux</link>
	<title><![CDATA[Installing Perl environment on Linux]]></title>
	<description><![CDATA[<p>By using&nbsp;<code>plenv</code>, you can easily install and switch among different version of Perl. This will be installed under your home directory in<code>~/.plenv</code>.</p><h4>Install latest Perl (with supporting multithreading) and CPANMinus.</h4><pre><code> $ cd
 $ git clone git://github.com/tokuhirom/plenv.git ~/.plenv
 $ git clone git://github.com/tokuhirom/Perl-Build.git ~/.plenv/plugins/perl-build/
 $ echo 'export PATH="$HOME/.plenv/bin:$PATH"' &gt;&gt; ~/.bashrc
 $ echo 'eval "$(plenv init -)"' &gt;&gt; ~/.bashrc
 $ source ~/.bashrc
 $ plenv install 5.18.1 -Dusethreads
 $ plenv rehash
 $ plenv global 5.18.1
 $ plenv install-cpanm
</code></pre><ul>
<li><code>git</code>&nbsp;is a distributed revision control and source code management software which can help you to download files from GitHub server.</li>
<li><code>echo</code>&nbsp;means "print".</li>
<li><code>&gt;&gt;</code>&nbsp;means adding the output into the end of the file, while&nbsp;<code>&gt;</code>&nbsp;means adding the output by overwriting the whole file. Please use<code>&gt;</code>&nbsp;with additional cares.</li>
<li>In Linux system, there are two types of outputs when you execute a command. One is called standard output (or sometimes STDOUT for short), and the other is a standard error (STDERR).&nbsp;<code>1&gt;</code>&nbsp;is for STDOUT only,&nbsp;<code>2&gt;</code>&nbsp;is for STDERR only, and&nbsp;<code>&amp;&gt;</code>means for both. In default&nbsp;<code>&gt;</code>&nbsp;is the same to&nbsp;<code>1&gt;</code>.</li>
<li><code>exec</code>&nbsp;is execution.</li>
<li>Remember to install Perl in supporting multithreading (with option&nbsp;<code>-Dusethreads</code>), which is important for many NGS analysis packages (e.g. Trinity). In this setting, you can use multiple CPU for Perl software.</li>
<li>Install the CPAN (Comprehensive Perl Archive Network) manager software, CPANMinus, by&nbsp;<code>install-cpanm</code>.</li>
</ul><p>You can use&nbsp;<code>plenv global</code>&nbsp;and&nbsp;<code>plenv local</code>&nbsp;to change the different version of Perl to fulfil different needs of your Perl software.</p><p>For example, if the&nbsp;specific version of Perl is not compatible with your script, you can switch to the different version by:</p><pre><code> $ plenv local 
</code></pre><ul>
<li>It is similar to set the local version of your script language when you use&nbsp;<code>pyenv</code>&nbsp;and&nbsp;<code>rbenv</code>&nbsp;as the following.</li>
</ul><p>Put the following path into&nbsp;<code>~/.bashrc file</code>.</p><pre><code>export PERL5LIB="$HOME/.plenv/build/perl-5.18.1/lib"
</code></pre><h4>Install BioPerl and PerlIO::gzip</h4><p>CPANMinus is a very good Perl module manager, use&nbsp;<code>cpanm</code>&nbsp;to install BioPerl can save you a lot of time. Here are some useful modules:</p><pre><code>$ cpanm Bio::Perl
$ cpanm Bio::SearchIO
$ cpanm PerlIO::gzip<br /></code></pre><p><span>For more information, please visit:&nbsp;</span><a href="https://github.com/tokuhirom/plenv">https://github.com/tokuhirom/plenv</a></p><pre><code>&nbsp;</code></pre>]]></description>
	<dc:creator>biogeek</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>