http://ritg.med.harvard.edu/training/perl/RC_Perl_Intro.pdf

I google it and found that Strawberry comes with additional dev tools to compile CPAN modules if necessary. Whereas ActivePerl has a lot of prepackaged modules which are easier to install with PPM. In addition, DWIM Perl contains the standard Perl and a lot of extension and Citrus Perl is a binary distribution of Perl created for GUI application developers. 

Now, I wonder what should I pick to get started? 

Note: I am going to use BioPerl in near future.

http://dwimperl.com/

http://www.activestate.com/activeperl

http://www.citrusperl.com/

http://strawberryperl.com/

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

ICRISAT is headquartered in Patancheru near Hyderabad, India, with two regional hubs and five country offices in sub-Saharan Africa. ICRISAT, established in 1972, is a member of the CGIAR Consortium. For more details, see www.icrisat.org.

Responsibilities:Design efficient SQL queries for pulling large sequencing projects.
Serve as a technical adviser to the project leadership and provide computational perspective on product design and deliverability.
Develop and oversee a rapid and incremental software development and release schedule.
Design the software architecture, oversee the implementation and evolution of the design on appropriate hardware platforms.
Working collaboratively in a team environment to design, code, test, debug, and document programs for an integrated genomic analysis pipeline in a rapid and incremental software development and release schedule.
Supervise and review code development and ensure that software products meet project objectives in terms of functionality, scalability, robustness and user experience.
Implement and oversee the QA/QC practices to ensure the development team is adhering to quality standards.
Work closely with the application specialist to integrate feedbacks from teams in each CGIAR center into software customization and improvement.
Assist in training of breeders in the CGIAR centers to use software developed.
Personal Profile:

The applicant should have:

Understanding of genomics data and advanced knowledge of Java, and C/C++ as the programming languages and any of the scripting language like perl and/or Python, SQL
High Performance Computing, data architecture, database platforms and QA/QC practices in software engineering.
She/he should have solid experience in software development projects, preferably as a senior programmer or in the software project management role, and in projects involving big data.
Excellent communication skills are needed to work in this multi-disciplinary, multi-location and multi-cultural team.
Ability to mentor colleagues in quality software development practices is desired.
Educational Qualification : Ph. D or Masters Degree in Computational Biology / Computational Genomics or Equivalent with Research Experience in Mentioned Areas.

More at http://www.icrisat.org/careers/

Address of the bookmark: https://github.com/hugheslab/snpgenie

Mojolicious aims to provide a complete web development experience. It thus has no hard dependencies, comes with a built-in development and production server and many other features one needs to build a web application. It's easy to install, has an applciation generator script and many plugins and extensions.

Libraries for developing Web applications

• Amon2
• Catalyst - Overflowing with features. Very popular.
• Dancer (Official site)
• Dancer2
• Gantry - Web application framework for mod_perl, cgi, etc.
• Kossy - A Web framework with simple interface.
• Mojolicious - An all in one framework.
• Poet - a modern Perl web framework for Mason developers

Address of the bookmark: https://www.ynonperek.com/2017/09/28/perl-mojolicious-web-development/