<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/34864?offset=50</link>
	<atom:link href="https://bioinformaticsonline.com/related/34864?offset=50" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38067/metaplotr-a-perlr-pipeline-for-plotting-metagenes-of-nucleotide-modifications-and-other-transcriptomic-sites</guid>
	<pubDate>Mon, 05 Nov 2018 08:12:45 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38067/metaplotr-a-perlr-pipeline-for-plotting-metagenes-of-nucleotide-modifications-and-other-transcriptomic-sites</link>
	<title><![CDATA[MetaPlotR: a Perl/R pipeline for plotting metagenes of nucleotide modifications and other transcriptomic sites]]></title>
	<description><![CDATA[<p><span>An increasing number of studies are mapping protein binding and nucleotide modifications sites throughout the transcriptome. Often, these sites cluster in certain regions of the transcript, giving clues to their function. Hence, it is informative to summarize where in the transcript these sites occur. A metagene is a simple and effective tool for visualizing the distribution of sites along a simplified transcript model. In this work, we introduce MetaPlotR, a Perl/R pipeline for creating metagene plots.</span></p><p>Address of the bookmark: <a href="https://github.com/olarerin/metaPlotR" rel="nofollow">https://github.com/olarerin/metaPlotR</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/42921/run-bash-script-in-perl-program</guid>
	<pubDate>Sat, 27 Feb 2021 01:42:23 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/42921/run-bash-script-in-perl-program</link>
	<title><![CDATA[Run bash script in Perl program !]]></title>
	<description><![CDATA[<p>BioPerl is a compilation of Perl modules that can be used to build bioinformatics-related Perl scripts. It is used, for example, in the development of source codes, standalone software/tools, and algorithms in bioinformatics programmes. Different modules are easy to instal and include, making it easier to perform different functions. Despite the fact that Python is commonly favoured over Perl, some bioinformatics software, such as the standalone version of 'alienomics', is written in Perl. Often it's a major problem for beginners to execute certain Unix/shell commands in Perl script, so it's hard to determine which feature is unique to a situation.</p><div style="background-color: white;">Perl provides various features and operators for the execution of external commands (described as follows), which are unique in their own way.</div><div style="background-color: white;">&nbsp;</div><div style="background-color: white;">They vary slightly from one another, making it difficult for Perl beginners to choose between them.</div><div style="background-color: white;">&nbsp;</div><div style="background-color: white;"><strong>1. IPC::Open2</strong></div><p>More at https://bioinformaticsonline.com/snippets/view/42919/perl-ipcopen2-module</p><p><strong>2. exec&rdquo;&rdquo;</strong></p><p><em>&nbsp;syntax:&nbsp;</em><code>exec "command";</code></p><div style="background-color: #edfbff;">It's a Perl function (perlfunc) that executes a command but never returns, similar to a function's return statement.</div><div style="background-color: white;">While running the command, it keeps processing the script and does not wait until it finishes first, returns false when the command is not found, but never returns true.</div><p><strong>3. Backticks &ldquo; or qx//</strong></p><p><em>syntax:&nbsp;</em><code>`command`;</code></p><p><em>syntax:&nbsp;</em><code>qx/command/;</code></p><div style="background-color: white;">It's a Perl operator (perlop) that executes a command and then resumes the Perl script once the command has ended, but the return value is the command's STDOUT.</div><p><strong>4. IPC::Open3</strong></p><p><em>syntax:&nbsp;</em><code>$output =&nbsp;open3(\*CHLD_IN, \*CHLD_OUT, \*CHLD_ERR,&nbsp;'command arg1 arg2', 'optarg',...);</code></p><p style="text-align: justify;"><code></code>It is very similar to <code>IPC::Open2</code> with the capability to capture all three file handles of the process, i.e., STDIN, STDOUT, and STDERR. It can also be used with or without the shell. You can read about it more in the documentation: <a href="https://perldoc.perl.org/IPC/Open3.html" target="_blank">IPC::Open3</a>.</p><p><code>$output = open3(my $o ut,&nbsp;my $in, 'command arg1 arg2');</code></p><p>OR without using the shell</p><p><code>$output = open3(my $out,&nbsp;my $in, 'command', 'arg1', 'arg2');</code></p><p><strong>5.a2p</strong></p><p><em>syntax:&nbsp;</em><code>a2p [options] [awkscript]</code></p><p>There is a Perl utility known as <code>a2p</code> which translates <code>awk</code> command to Perl. It takes awk script as input and generates a comparable Perl script as the output. Suppose, you want to execute the following <code>awk</code> statement</p><p><code>awk '{$1 = ""; $2 = ""; print}' f1.txt</code></p><p>This statement gives error sometimes even after escaping the variables (\$1, \$2) but by using <code>a2p</code> it can be easily converted to Perl script:</p><p>For further information, you can read it&rsquo;s documentation: <code><a href="https://perldoc.perl.org/a2p.html" target="_blank">a2p</a></code></p><p>More help at https://bioinformaticsonline.com/snippets/view/42920/perl-script-to-run-awk-inside-perl</p><p><strong>6. system()</strong></p><p><em>syntax:&nbsp;</em><code>system( "command" );</code></p><p>It is also a Perl function (<a href="https://perldoc.perl.org/functions/system.html" target="_blank">perlfunc</a>) that executes a command and waits for it to get finished first and then resume the Perl script. The return value is the exit status of the command. It can be called in two ways:</p><p><code>system( "command arg1 arg2" );</code></p><p>OR</p><p><code>system( "command", "arg1", "arg2" );</code></p><p>HELP</p><p>Here are some useful Perl cheat sheets that can be used as a quick reference guide.--&nbsp;<a href="https://www.pcwdld.com/perl-cheat-sheet" target="_blank">https://www.pcwdld.com/perl-cheat-sheet</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/33839/awesome-perl-frameworks-libraries-and-software-part-2</guid>
	<pubDate>Fri, 07 Jul 2017 04:09:04 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/33839/awesome-perl-frameworks-libraries-and-software-part-2</link>
	<title><![CDATA[Awesome perl frameworks, libraries and software - PART 2]]></title>
	<description><![CDATA[<ul>
<li><a href="https://github.com/licheng/gccfilter">licheng/gccfilter</a>&nbsp;- gccfilter is a perl filter to colorize and simplify (or expand) gcc diagnostic messages. gccfilter is particularly aimed at g++ (i.e. dealinging with C++) messages which can contain lot of template-related errors or warnings difficult to sort out.</li>
<li><a href="https://github.com/klenin/cats-main">klenin/cats-main</a>&nbsp;- Programming contest control system</li>
<li><a href="https://github.com/kazuho/p5-Net-DNS-Lite">kazuho/p5-Net-DNS-Lite</a>&nbsp;- pure-perl DNS resolver with support for timeout</li>
<li><a href="https://github.com/japhb/perl6-bench">japhb/perl6-bench</a>&nbsp;- Benchmark and compare Perl 6 implementations against perl5</li>
<li><a href="https://github.com/ingydotnet/pquery-pm">ingydotnet/pquery-pm</a>&nbsp;- Perl Port of jQuery</li>
<li><a href="https://github.com/grondilu/libbitcoin-perl">grondilu/libbitcoin-perl</a>&nbsp;- bitcoin perl library</li>
<li><a href="https://github.com/fayland/perl-git-store">fayland/perl-git-store</a>&nbsp;- Git as versioned data store in Perl</li>
<li><a href="https://github.com/dpavlin/perl-Mifare-MAD">dpavlin/perl-Mifare-MAD</a>&nbsp;- pretty print Mifare Classic MAD - Mifare Application Directory from dump files</li>
<li><a href="https://github.com/cpan-testers/CPAN-Reporter">cpan-testers/CPAN-Reporter</a>&nbsp;- (Perl) Adds CPAN Testers reporting to CPAN.pm</li>
<li><a href="https://github.com/cog/perlbaldoc">cog/perlbaldoc</a>&nbsp;- Perlbal documentation</li>
<li><a href="https://github.com/clbecker/perl-wiktionary-parser">clbecker/perl-wiktionary-parser</a>&nbsp;- Client and parser of documents pulled from the wiktionary api</li>
<li><a href="https://github.com/btrott/Crypt-OpenPGP">btrott/Crypt-OpenPGP</a>&nbsp;- Pure-Perl OpenPGP implementation</li>
<li><a href="https://github.com/briandfoy/git-github-creator">briandfoy/git-github-creator</a>&nbsp;- (Perl) Create a Github repository for your Perl module</li>
<li><a href="https://github.com/bradchoate/text-textile">bradchoate/text-textile</a>&nbsp;- Text::Textile -- Perl module for handling Textile format</li>
<li><a href="https://github.com/apache/mod_perl">apache/mod_perl</a>&nbsp;- Mirror of Apache mod_perl</li>
<li><a href="https://github.com/adrianh/test-class">adrianh/test-class</a>&nbsp;- Test::Class - an xUnit testing framework for Perl 5.x</li>
<li><a href="https://github.com/yannk/perl-avro">yannk/perl-avro</a>&nbsp;- Perl implementation Avro Data Serializer. See new official repo</li>
<li><a href="https://github.com/xme/known_hosts_bruteforcer">xme/known_hosts_bruteforcer</a>&nbsp;- Perl script to bruteforce SSH known_hosts files.</li>
<li><a href="https://github.com/Util/Blue_Tiger">Util/Blue_Tiger</a>&nbsp;- Perl 5 to Perl 6 Translator</li>
<li><a href="https://github.com/typester/anyevent-jsonrpc-lite-perl">typester/anyevent-jsonrpc-lite-perl</a>&nbsp;- AnyEvent::JSONRPC::Lite</li>
<li><a href="https://github.com/tokuhirom/http-session">tokuhirom/http-session</a>&nbsp;- http session management library for perl</li>
<li><a href="https://github.com/test-class-moose/test-class-moose">test-class-moose/test-class-moose</a>&nbsp;- Serious testing for serious Perl</li>
<li><a href="https://github.com/schwern/Perl-Signatures-Common">schwern/Perl-Signatures-Common</a>&nbsp;- A common definition and test suite for Perl function signatures.</li>
<li><a href="https://github.com/pjcj/Gedcom.pm">pjcj/Gedcom.pm</a>&nbsp;- Gedcom - a Perl module to manipulate Gedcom genealogy files</li>
<li><a href="https://github.com/mj41/auto-unrar">mj41/auto-unrar</a>&nbsp;- Smart Perl scripts (for Linux) to auto unrar / extract a directory structure containing RAR archives.</li>
<li><a href="https://github.com/lukeross/MuttrcBuilder">lukeross/MuttrcBuilder</a>&nbsp;- A web-based builder for Mutt's .muttrc files.</li>
<li><a href="https://github.com/lstein/LibVM-EC2-Perl">lstein/LibVM-EC2-Perl</a>&nbsp;- Simple version of Perl Amazon EC2 modules that supports the tag API</li>
<li><a href="https://github.com/kappa/perl-httpd-benchmarks">kappa/perl-httpd-benchmarks</a>&nbsp;- Searching for fastest small Perl httpd</li>
<li><a href="https://github.com/jmlynesjr/wxPerl-wxBook-Examples">jmlynesjr/wxPerl-wxBook-Examples</a>&nbsp;- wxPerl examples ported from "Cross-Platform GUI Programming with wxWidgets" - "The wxBook"</li>
<li><a href="https://github.com/jmcnamara/spreadsheet-parseexcel">jmcnamara/spreadsheet-parseexcel</a>&nbsp;- Perl module to read Excel binary files</li>
<li><a href="https://github.com/Geo-omics/scripts">Geo-omics/scripts</a>&nbsp;- General scripts used in the lab. Almost all of them are in core perl, i.e require no modules that don't already come with a perl installation. These script are currently in use by the Lab, so expect full support. This material is based upon work supported by the National Science Foundation under Grant Number EAR-1035955. Any opinions, findings, and conclusions or recommendations expressed in this material are those of the author(s) and do not necessarily reflect the views of the National Science Foundation.</li>
<li><a href="https://github.com/garu/POD2-PT_BR">garu/POD2-PT_BR</a>&nbsp;- Brazilian portuguese translation of Perl core documentation</li>
<li><a href="https://github.com/DrHyde/perl-modules-Number-Phone">DrHyde/perl-modules-Number-Phone</a>&nbsp;- Number::Phone and friends</li>
<li><a href="https://github.com/daoswald/retester">daoswald/retester</a>&nbsp;- Perl and Mojolicious based web application for testing and debugging regular expressions.</li>
<li><a href="https://github.com/boumenot/p5-Net-Amazon">boumenot/p5-Net-Amazon</a>&nbsp;- Perl framework for accessing amazon.com using REST.</li>
<li><a href="https://github.com/book/HTTP-Proxy">book/HTTP-Proxy</a>&nbsp;- A pure Perl HTTP proxy</li>
<li><a href="https://github.com/bingos/devel-patchperl">bingos/devel-patchperl</a>&nbsp;- (perl) Patch perl source a la Devel::PPort's buildperl.pl</li>
<li><a href="https://github.com/zenogantner/PDL-ML">zenogantner/PDL-ML</a>&nbsp;- machine learning example code in PDL (Perl Data Language)</li>
<li><a href="https://github.com/zakame/perl-google-plus">zakame/perl-google-plus</a>&nbsp;- Simple Perl interface for Google+</li>
<li><a href="https://github.com/zag/ru-perl6-book">zag/ru-perl6-book</a>&nbsp;- Russian perl6 book</li>
<li><a href="https://github.com/typester/github-ircbot-perl">typester/github-ircbot-perl</a>&nbsp;- ircbot to broadcast github post-receive message to irc</li>
<li><a href="https://github.com/trinitum/RedisDB">trinitum/RedisDB</a>&nbsp;- Perl extension to access Redis</li>
<li><a href="https://github.com/trapd00r/pimpd2">trapd00r/pimpd2</a>&nbsp;- Perl Interface for the Music Player Daemon 2 |&nbsp;<a href="http://search.cpan.org/dist/App-Pimpd/">http://search.cpan.org/dist/App-Pimpd/</a></li>
<li><a href="https://github.com/tokuhirom/Tiffany">tokuhirom/Tiffany</a>&nbsp;- Template-For-All, Generic interface for perl template engines.</li>
<li><a href="https://github.com/toddr/perl-net-jabber-bot">toddr/perl-net-jabber-bot</a>&nbsp;- Net::Jabber::Bot module for Perl</li>
<li><a href="https://github.com/splitbrain/irclogger">splitbrain/irclogger</a>&nbsp;- A Perl/PHP tool to log an IRC channel and make it searchable on the Web</li>
<li><a href="https://github.com/SoylentNews/rehash">SoylentNews/rehash</a>&nbsp;- Forked from Slashcode, rehash is the codebase that powers SoylentNews.org, powered by mod_perl 2</li>
<li><a href="https://github.com/skaji/relocatable-perl">skaji/relocatable-perl</a>&nbsp;- self-contained, portable perl binaries</li>
<li><a href="https://github.com/simonwistow/Module-Pluggable">simonwistow/Module-Pluggable</a>&nbsp;- Automatically give your Perl module the ability to have plugins</li>
<li><a href="https://github.com/robinsmidsrod/unnamed-perl-cms-project">robinsmidsrod/unnamed-perl-cms-project</a>&nbsp;- Creating a newbie-deployable CMS framework for Perl</li>
<li><a href="https://github.com/rmayorga/fooberto">rmayorga/fooberto</a>&nbsp;- perl-ugly-home-made-bot</li>
<li><a href="https://github.com/RexOps/rex-apache-deploy">RexOps/rex-apache-deploy</a>&nbsp;- Manage Website deployments (for PHP, Perl, Tomcat, ...)</li>
<li><a href="https://github.com/polocky/p5-Polocky">polocky/p5-Polocky</a>&nbsp;- Web Application Framework with Perl</li>
<li><a href="https://github.com/perkinsms/Perl-GTFS">perkinsms/Perl-GTFS</a>&nbsp;- Perl modules for handling GTFS (transit) data</li>
<li><a href="https://github.com/perigrin/xml-toolkit">perigrin/xml-toolkit</a>&nbsp;- Framework for Marshaling XML to Perl (moose) Classes and back.</li>
<li><a href="https://github.com/nothingmuch/search-gin">nothingmuch/search-gin</a>&nbsp;- Generalized indexing for Perl</li>
<li><a href="https://github.com/msimerson/mail-dmarc">msimerson/mail-dmarc</a>&nbsp;- Mail::DMARC, a complete DMARC implementation in Perl</li>
<li><a href="https://github.com/mndrix/net-couchdb">mndrix/net-couchdb</a>&nbsp;- Perl interface for CouchDB</li>
<li><a href="https://github.com/melo/perl-anyevent-nsq">melo/perl-anyevent-nsq</a>&nbsp;- A AnyEvent-based client for NSQ.io</li>
<li><a href="https://github.com/mbarbon/language-p">mbarbon/language-p</a>&nbsp;- An experimental Perl 5 parser/compiler written in Perl 5</li>
<li><a href="https://github.com/masak/yarn">masak/yarn</a>&nbsp;- A proof-of-concept blogging application using Perl 6's Web.pm</li>
<li><a href="https://github.com/mariuz/perl-dbd-firebird">mariuz/perl-dbd-firebird</a>&nbsp;- Perl DBI driver for Firebird</li>
<li><a href="https://github.com/marioroy/mce-perl">marioroy/mce-perl</a>&nbsp;- Many-Core Engine for Perl - Module</li>
<li><a href="https://github.com/lyokato/p5-oauth-lite">lyokato/p5-oauth-lite</a>&nbsp;- Perl OAuth Library</li>
<li><a href="https://github.com/lstein/Perl-GD">lstein/Perl-GD</a>&nbsp;- Perl GD module for bitmap graphics</li>
<li><a href="https://github.com/keiya/KeiSpade-CMS">keiya/KeiSpade-CMS</a>&nbsp;- The contents management system that uses SQLite3. Written in Perl, HTML5.</li>
<li><a href="https://github.com/jquelin/games-pandemic">jquelin/games-pandemic</a>&nbsp;- a cooperative pandemic board game written in perl</li>
<li><a href="https://github.com/johntdyer/ftptail">johntdyer/ftptail</a>&nbsp;- Perl application written by Will Moffat which allows you to tail log files over FTP</li>
<li><a href="https://github.com/jjl/Spark-Form">jjl/Spark-Form</a>&nbsp;- The Spark::Form Perl module for effortlessly handling forms.</li>
<li><a href="https://github.com/HackerOrientado/BypassCF">HackerOrientado/BypassCF</a>&nbsp;- Script in Perl for Bypass CloudFlare</li>
<li><a href="https://github.com/gugod/railsish">gugod/railsish</a>&nbsp;- A perl webapp framework with rails-like convention-based coding style.</li>
<li><a href="https://github.com/Farow/hexchat-scripts">Farow/hexchat-scripts</a>&nbsp;- Perl scripts for HexChat</li>
<li><a href="https://github.com/exercism/xperl5">exercism/xperl5</a>&nbsp;- Exercism Exercises in Perl 5</li>
<li><a href="https://github.com/Ensembl/ensembl-variation">Ensembl/ensembl-variation</a>&nbsp;- The Ensembl Variation Perl API and SQL schema</li>
<li><a href="https://github.com/eiro/p5-perlude">eiro/p5-perlude</a>&nbsp;- Shell and Powershell pipes, haskell keywords mixed with the awesomeness of perl. forget shell scrpting now!</li>
<li><a href="https://github.com/edsu/www-wikipedia">edsu/www-wikipedia</a>&nbsp;- Simple Perl client for grabbing content out of Wikipedia</li>
<li><a href="https://github.com/domm/Game-PerlInvaders">domm/Game-PerlInvaders</a>&nbsp;- simple space invaders game implemented using Perl &amp; SDL</li>
<li><a href="https://github.com/davorg/xml-feed">davorg/xml-feed</a>&nbsp;- The CPAN module XML::Feed</li>
<li><a href="https://github.com/daoswald/Inline-CPP">daoswald/Inline-CPP</a>&nbsp;- Perl Module: Inline::CPP: Include C++ code inline within Perl code.</li>
<li><a href="https://github.com/cpan-testers/Test-Reporter">cpan-testers/Test-Reporter</a>&nbsp;- (Perl) Sends perl module test results to CPAN Testers</li>
<li><a href="https://github.com/CpanelInc/Custom-cPanel-Module">CpanelInc/Custom-cPanel-Module</a>&nbsp;- Example Perl module for extending the cPanel API</li>
<li><a href="https://github.com/cosimo/perl5-net-statsd">cosimo/perl5-net-statsd</a>&nbsp;- Net::Statsd is a Perl client for Etsy's statsd metric collection daemon</li>
<li><a href="https://github.com/chromatic/Modern-Perl">chromatic/Modern-Perl</a>&nbsp;- The Modern::Perl CPAN Distribution</li>
<li><a href="https://github.com/cho45/Text-Xatena">cho45/Text-Xatena</a>&nbsp;- Perl module for parsing Xatena syntax (like Hatena syntax)</li>
<li><a href="https://github.com/chicks-net/megamap">chicks-net/megamap</a>&nbsp;- MegaRAID&reg; Linux drive map</li>
<li><a href="https://github.com/c9s/perldoc-zhtw-translation">c9s/perldoc-zhtw-translation</a>&nbsp;- Perldoc Translation in zh-tw</li>
<li><a href="https://github.com/aanoaa/p5-hubot">aanoaa/p5-hubot</a>&nbsp;- hubot perl port</li>
<li><a href="https://github.com/yanick/Perl-Achievements">yanick/Perl-Achievements</a>&nbsp;- Write some perl, gather some badges of merit.</li>
<li><a href="https://github.com/vti/text-caml">vti/text-caml</a>&nbsp;- A mustache-like template engine for Perl</li>
<li><a href="https://github.com/vti/perlresume.org">vti/perlresume.org</a>&nbsp;- perlresume.org</li>
<li><a href="https://github.com/vmaselli/PerlTools">vmaselli/PerlTools</a>&nbsp;- Perl scripts for several purpose</li>
<li><a href="https://github.com/vlet/iec104">vlet/iec104</a>&nbsp;- Perl implementation of IEC 60870-5-104 standard (server and client)</li>
<li><a href="https://github.com/theory/semver">theory/semver</a>&nbsp;- Semantic version object for Perl</li>
<li><a href="https://github.com/spencertipping/ni">spencertipping/ni</a>&nbsp;- A Perl script that says "ni" to data</li>
<li><a href="https://github.com/silnrsi/font-ttf">silnrsi/font-ttf</a>&nbsp;- Font::TTF Perl Module</li>
<li><a href="https://github.com/SFR-ZABBIX/Zabbix-API">SFR-ZABBIX/Zabbix-API</a>&nbsp;- Perl distribution to access the JSON-RPC API of a Zabbix server</li>
<li><a href="https://github.com/sendgrid/sendgrid-perl">sendgrid/sendgrid-perl</a>&nbsp;- Perl module for SendGrid's API</li>
<li><a href="https://github.com/rvosa/bio-phylo">rvosa/bio-phylo</a>&nbsp;- Bio::Phylo - Phyloinformatic analysis using Perl</li>
<li><a href="https://github.com/rafl/tpf-soc">rafl/tpf-soc</a>&nbsp;- Documents for organising a Google Summer of Code for The Perl Foundation</li>
<li><a href="https://github.com/pkrumins/youtube-uploader">pkrumins/youtube-uploader</a>&nbsp;- A Perl program that uploads videos to YouTube without any APIs.</li>
<li><a href="https://github.com/pjf/ipc-system-simple">pjf/ipc-system-simple</a>&nbsp;- Perl module to make running system commands and capturing errors as simple as possible.</li>
<li><a href="https://github.com/PerlGameDev/Box2D-perl">PerlGameDev/Box2D-perl</a>&nbsp;- Box2D for perl</li>
<li><a href="https://github.com/Ovid/Corinna">Ovid/Corinna</a>&nbsp;- Generate Perl classes from XML schemas</li>
<li><a href="https://github.com/osfameron/Foose">osfameron/Foose</a>&nbsp;- Functional Perl</li>
<li><a href="https://github.com/mpeters/html-template">mpeters/html-template</a>&nbsp;- Perl HTML::Template module</li>
<li><a href="https://github.com/modernistik/Nmap-Parser">modernistik/Nmap-Parser</a>&nbsp;- Parse nmap scan data with Perl (official repo)</li>
<li><a href="https://github.com/mjdominus/Linogram">mjdominus/Linogram</a>&nbsp;- Declarative constraint-based structured drawing system in Perl (as per chapter 9 of "Higher-Order Perl")</li>
<li><a href="https://github.com/mickeyn/PONAPI">mickeyn/PONAPI</a>&nbsp;- a Perl client/server implementation of {json:api} v1.0</li>
<li><a href="https://github.com/markusb/pdf-create">markusb/pdf-create</a>&nbsp;- Perl module to create PDF files</li>
<li><a href="https://github.com/libraryhackers/library-callnumber-lc">libraryhackers/library-callnumber-lc</a>&nbsp;- Perl and Python modules for normalizing Library of Congress call numbers</li>
<li><a href="https://github.com/kingpong/perl-PDF-WebKit">kingpong/perl-PDF-WebKit</a>&nbsp;- Convert HTML to PDF using WebKit (wkhtmltopdf)</li>
<li><a href="https://github.com/kensanata/hex-mapping">kensanata/hex-mapping</a>&nbsp;- Tools to work with hex maps for roleplaying games. Usually web applications written in Perl and producing SVG output.</li>
<li><a href="https://github.com/jzawodn/perl-Redis">jzawodn/perl-Redis</a>&nbsp;- Improved version of the Perl Redis client that's available on CPAN</li>
<li><a href="https://github.com/jirutka/apcupsd-snmp">jirutka/apcupsd-snmp</a>&nbsp;- Apcupsd module for Net-SNMP</li>
<li><a href="https://github.com/ingydotnet/inline-pm">ingydotnet/inline-pm</a>&nbsp;- Write Perl subroutines in other programming languages</li>
<li><a href="https://github.com/Htbaa/WebService-Rackspace-CloudFiles">Htbaa/WebService-Rackspace-CloudFiles</a>&nbsp;- Perl Interface to Rackspace Cloud Files service</li>
<li><a href="https://github.com/gugod/markapl">gugod/markapl</a>&nbsp;- (Perl) Markup as Perl</li>
<li><a href="https://github.com/gbarr/perl-beanstalk-client">gbarr/perl-beanstalk-client</a>&nbsp;- Perl client library for beanstalkd</li>
<li><a href="https://github.com/frodwith/Amazon-MWS">frodwith/Amazon-MWS</a>&nbsp;- Perl API bindings to Amazon Marketplace Web Services</li>
<li><a href="https://github.com/ess/citadel">ess/citadel</a>&nbsp;- Citadel is a replacement for dos-deflate (ddos.sh) implemented in Perl.</li>
<li><a href="https://github.com/damog/www-tumblr">damog/www-tumblr</a>&nbsp;- Perl interface for the Tumblr API</li>
<li><a href="https://github.com/cosimo/perl5-device-gsm">cosimo/perl5-device-gsm</a>&nbsp;- a Perl5 class to handle communication with a gsm modem or gsm cell phone, send sms, etc...</li>
<li><a href="https://github.com/clip9/adbren">clip9/adbren</a>&nbsp;- adbren - Rename and organize anime using this AniDB API client written in perl</li>
<li><a href="https://github.com/zostay/P6W">zostay/P6W</a>&nbsp;- The Web API for Perl 6 (P6W)</li>
<li><a href="https://github.com/zigorou/yokohama-pm-10">zigorou/yokohama-pm-10</a>&nbsp;- Presentation of Yokohama Perl Monger #10</li>
<li><a href="https://github.com/xaicron/p5-win32-unicode">xaicron/p5-win32-unicode</a>&nbsp;- perl unicode-friendly wrapper for win32api.</li>
<li><a href="https://github.com/VerbalExpressions/PerlVerbalExpressions">VerbalExpressions/PerlVerbalExpressions</a>&nbsp;- Perl Regular expressions made easy</li>
<li><a href="https://github.com/trizen/perl-scripts">trizen/perl-scripts</a>&nbsp;- A collection of day-to-day Perl scripts which prove some ideas or implement some useful practicability.</li>
<li><a href="https://github.com/swannman/pdf2gerb">swannman/pdf2gerb</a>&nbsp;- Perl script converts PDF files to Gerber format</li>
<li><a href="https://github.com/substack/dnode-perl">substack/dnode-perl</a>&nbsp;- Asynchronous remote method calls with transparently wrapped callbacks... in perl!</li>
<li><a href="https://github.com/silnrsi/font-ttf-scripts">silnrsi/font-ttf-scripts</a>&nbsp;- Font::TTF::Scripts perl module</li>
<li><a href="https://github.com/sanko/net-bittorrent">sanko/net-bittorrent</a>&nbsp;- Perl based BitTorrent module available on CPAN</li>
<li><a href="https://github.com/sanko/Finance-Robinhood">sanko/Finance-Robinhood</a>&nbsp;- Trade stocks and ETFs with free brokerage Robinhood and Perl</li>
<li><a href="https://github.com/rurban/illguts">rurban/illguts</a>&nbsp;- Perl illustrated guts</li>
<li><a href="https://github.com/rjbs/MIME-Lite">rjbs/MIME-Lite</a>&nbsp;- the perl library MIME::Lite</li>
<li><a href="https://github.com/rjbs/CPAN-Uploader">rjbs/CPAN-Uploader</a>&nbsp;- perl library (and program) to upload dists to the cpan</li>
<li><a href="https://github.com/rizen/Ouch">rizen/Ouch</a>&nbsp;- Perl exceptions that don't hurt.</li>
<li><a href="https://github.com/rafl/twigils">rafl/twigils</a>&nbsp;- Twigils for Perl 5</li>
<li><a href="https://github.com/pullingshots/Shipment">pullingshots/Shipment</a>&nbsp;- perl interface into various shipping web service API's - FedEx, UPS, Purolator, Temando</li>
<li><a href="https://github.com/portcullislabs/ssl-cipher-suite-enum">portcullislabs/ssl-cipher-suite-enum</a>&nbsp;- PERL script to enumerate supported SSL cipher suites supported by network services (principally HTTPS).</li>
<li><a href="https://github.com/PerlChina/advent.perlchina.org">PerlChina/advent.perlchina.org</a>&nbsp;- CN Perl Advent</li>
<li><a href="https://github.com/perl-catalyst/Catalyst-Components-Concepts-Cases">perl-catalyst/Catalyst-Components-Concepts-Cases</a>&nbsp;- A Perl Catalyst documentation project</li>
<li><a href="https://github.com/naoya/perl-hadoop">naoya/perl-hadoop</a>&nbsp;- A frontend framework of Hadoop-Streaming for perl without Moose</li>
<li><a href="https://github.com/mrihtar/Garmin-FIT">mrihtar/Garmin-FIT</a>&nbsp;- Perl code for reading and conversion of Garmin FIT binary files</li>
<li><a href="https://github.com/mbarbon/extutils-xspp">mbarbon/extutils-xspp</a>&nbsp;- Perl XS for C++</li>
<li><a href="https://github.com/masak/tardis">masak/tardis</a>&nbsp;- Time traveling debugger in Perl 6</li>
<li><a href="https://github.com/kthakore/TetrisPL">kthakore/TetrisPL</a>&nbsp;- Tetris in MVC SDL Modern Perl Style</li>
<li><a href="https://github.com/kjetilk/RDF-LinkedData">kjetilk/RDF-LinkedData</a>&nbsp;- RDF::LinkedData is a Perl module for setting up Linked Data server</li>
<li><a href="https://github.com/keeth/Net-OAuth">keeth/Net-OAuth</a>&nbsp;- OAuth 1.0 for Perl</li>
<li><a href="https://github.com/kberov/PerlProgrammingCourse">kberov/PerlProgrammingCourse</a>&nbsp;- A relatively full beginner-to-intermediate Perl trainig course</li>
<li><a href="https://github.com/kazuho/p5-test-httpd-apache2">kazuho/p5-test-httpd-apache2</a>&nbsp;- Apache2 starter for testing perl modules</li>
<li><a href="https://github.com/kazuho/p5-Cache-LRU">kazuho/p5-Cache-LRU</a>&nbsp;- a simple, fast implementation of an LRU cache in pure perl</li>
<li><a href="https://github.com/juster/perl-cpanplus-dist-arch">juster/perl-cpanplus-dist-arch</a>&nbsp;- CPANPLUS backend for building Archlinux pacman packages</li>
<li><a href="https://github.com/Juniper/netconf-perl">Juniper/netconf-perl</a>&nbsp;- Perl library for Netconf</li>
<li><a href="https://github.com/jrockway/eventful">jrockway/eventful</a>&nbsp;- application framework for Perl</li>
<li><a href="https://github.com/jrockway/devel-repl">jrockway/devel-repl</a>&nbsp;- pluggable REPL for Perl that doesn't suck</li>
<li><a href="https://github.com/jquelin/games-risk">jquelin/games-risk</a>&nbsp;- classical 'risk' board game in perl</li>
<li><a href="https://github.com/ingydotnet/test-base-pm">ingydotnet/test-base-pm</a>&nbsp;- Extendable Perl Testing</li>
<li><a href="https://github.com/gisle/data-dump">gisle/data-dump</a>&nbsp;- A Perl module for pretty printing of data structures</li>
<li><a href="https://github.com/Getty/p5-facebook">Getty/p5-facebook</a>&nbsp;- Facebook SDL in Perl</li>
<li><a href="https://github.com/GeneDesign/GeneDesign">GeneDesign/GeneDesign</a>&nbsp;- Synthetic biology library in Perl</li>
<li><a href="https://github.com/FelipeSt4rk/FindSubDomain">FelipeSt4rk/FindSubDomain</a>&nbsp;- Find sub domains with Perl</li>
<li><a href="https://github.com/fayland/perl-javascript-beautifier">fayland/perl-javascript-beautifier</a>&nbsp;- Perl: Beautify Javascript (beautifier for javascript)</li>
<li><a href="https://github.com/ding-lab/hotspot3d">ding-lab/hotspot3d</a>&nbsp;- 3D hotspot mutation proximity analysis tool</li>
<li><a href="https://github.com/dermesser/fastcgi-wrappers">dermesser/fastcgi-wrappers</a>&nbsp;- This repository contains two FastCGI wrappers written in Perl. The first may execute any executable file in the same way CGI does, the second one does inline-eval of Perl scripts to avoid any forking.</li>
<li><a href="https://github.com/degtyarev-dm/mojolicious-lite-openshift">degtyarev-dm/mojolicious-lite-openshift</a>&nbsp;- Mojolicious::Lite Perl framework quickstart repo</li>
<li><a href="https://github.com/dave-theunsub/gtk3-perl-demos">dave-theunsub/gtk3-perl-demos</a>&nbsp;- This repository is intended to give perl-Gtk3 users some example programs. It's not rocket surgery, you know.</li>
<li><a href="https://github.com/CowboyTim/python-storable">CowboyTim/python-storable</a>&nbsp;- python module that will be able to read/write perl storable</li>
<li><a href="https://github.com/cosimo/perl5-net-statsd-server">cosimo/perl5-net-statsd-server</a>&nbsp;- A Perl port of Etsy's statsd server - Simple daemon for easy stats aggregation</li>
<li><a href="https://github.com/cooper/juno">cooper/juno</a>&nbsp;- a seriously modern IRC daemon written from scratch in Perl. designed to be ridiculously extensible, painlessly reloadable, and excessively configurable</li>
<li><a href="https://github.com/colinnewell/Jenkins-API">colinnewell/Jenkins-API</a>&nbsp;- Jenkins API Wrapper for Perl</li>
<li><a href="https://github.com/clintongormley/Elastic-Model">clintongormley/Elastic-Model</a>&nbsp;- Use ElasticSearch as a NoSQL database in Perl</li>
<li><a href="https://github.com/claesjac/javascript">claesjac/javascript</a>&nbsp;- The JavaScript module for Perl</li>
<li><a href="https://github.com/canada/PerlDocJp">canada/PerlDocJp</a>&nbsp;- This Web application let perldoc.jp Japanized pod document browsable and searchable just like search.cpan.org</li>
<li><a href="https://github.com/calid/zmq-ffi">calid/zmq-ffi</a>&nbsp;- version agnostic Perl bindings for zeromq</li>
<li><a href="https://github.com/avar/sendmail-pmilter">avar/sendmail-pmilter</a>&nbsp;- Perl binding of Sendmail Milter protocol</li>
<li><a href="https://github.com/aquaron/Business-Stripe">aquaron/Business-Stripe</a>&nbsp;- Perl bindings for Stripe payment system</li>
<li><a href="https://github.com/apparentlymart/libdanga-socket-anyevent-perl">apparentlymart/libdanga-socket-anyevent-perl</a>&nbsp;- Danga::Socket reimplementation in terms of AnyEvent</li>
<li><a href="https://github.com/agentzh/makefile-graphviz-pm">agentzh/makefile-graphviz-pm</a>&nbsp;- Perl CPAN module Makefile::GraphViz - Draw building flowcharts from Makefiles using GraphViz</li>
<li><a href="https://github.com/xoma/Russian-translate-of-Mojolicious-guides">xoma/Russian-translate-of-Mojolicious-guides</a>&nbsp;- Перевод документации и рецептов для Perl-фреймворка Mojolicious</li>
<li><a href="https://github.com/xaicron/p5-JSON-WebToken">xaicron/p5-JSON-WebToken</a>&nbsp;- JSON Web Token (JWT) implementation for Perl</li>
<li><a href="https://github.com/wickline/whack">wickline/whack</a>&nbsp;- find the perl sub most in need of refactoring</li>
<li><a href="https://github.com/vti/turnaround">vti/turnaround</a>&nbsp;- DEPRECATED: A Perl TIMTOWTDI web framework</li>
<li><a href="https://github.com/uzulla/pyazo">uzulla/pyazo</a>&nbsp;- Gyazo And Gifzo compatible server by perl</li>
<li><a href="https://github.com/ukautz/Net-Amazon-DynamoDB">ukautz/Net-Amazon-DynamoDB</a>&nbsp;- Simple perl interface for Amazon DynamoDB</li>
<li><a href="https://github.com/thedarkwinter/Net-DRI">thedarkwinter/Net-DRI</a>&nbsp;- Perl EPP Client: Net-DRI-0.X_tdw based on Net-DRI-0.96_05</li>
<li><a href="https://github.com/tadzik/neutro">tadzik/neutro</a>&nbsp;- Simple module installer for Perl 6</li>
<li><a href="https://github.com/stockholmuniversity/nagios-nrpe">stockholmuniversity/nagios-nrpe</a>&nbsp;- A pure perl implementation of the Nagios NRPE daemon and client</li>
<li><a href="https://github.com/skx/chronicle2">skx/chronicle2</a>&nbsp;- Chronicle is a simple blog compiler, written in Perl with minimal dependencies.</li>
<li><a href="https://github.com/sjdy521/Mojo-StrawberryPerl">sjdy521/Mojo-StrawberryPerl</a>&nbsp;- 基于StrawberryPerl打包而成的包含Perl-5.24+cpanm+Mojo-Webqq+Mojo-Weixin的完整Windows运行环境</li>
<li><a href="https://github.com/scrottie/WWW-Workflowy">scrottie/WWW-Workflowy</a>&nbsp;- Faked up Workflowy API for Perl using Workflowy's JSON protocol</li>
<li><a href="https://github.com/run4flat/C-TinyCompiler">run4flat/C-TinyCompiler</a>&nbsp;- Perl bindings for the Tiny C Compiler</li>
<li><a href="https://github.com/robkinyon/dbm-deep">robkinyon/dbm-deep</a>&nbsp;- DBM::Deep Perl module</li>
<li><a href="https://github.com/rjbs/Email-ARF">rjbs/Email-ARF</a>&nbsp;- Email::ARF perl module for parsing ARF</li>
<li><a href="https://github.com/rjbs/Config-INI">rjbs/Config-INI</a>&nbsp;- Config::INI perl module</li>
<li><a href="https://github.com/ranguard/svg-tt-graph">ranguard/svg-tt-graph</a>&nbsp;- Perl module for creating SVG graphs</li>
<li><a href="https://github.com/plainblack/JSON-RPC-Dispatcher">plainblack/JSON-RPC-Dispatcher</a>&nbsp;- A JSON-RPC 2.0 server for Perl.</li>
<li><a href="https://github.com/pjf/perl589delta">pjf/perl589delta</a>&nbsp;- The perl589delta.pod file for the 5.8.9 release of Perl</li>
<li><a href="https://github.com/perigrin/adam-bot-framework">perigrin/adam-bot-framework</a>&nbsp;- An IRC bot framework in Perl based on Moose &amp; POE</li>
<li><a href="https://github.com/ollyg/Net-Appliance-Session">ollyg/Net-Appliance-Session</a>&nbsp;- Development of Net::Appliance::Session Perl distribution</li>
<li><a href="https://github.com/ollyg/Catalyst-Plugin-AutoCRUD">ollyg/Catalyst-Plugin-AutoCRUD</a>&nbsp;- Development of Catalyst::Plugin::AutoCRUD Perl distribution</li>
<li><a href="https://github.com/nlewis/Net-ILO">nlewis/Net-ILO</a>&nbsp;- Perl interface to HP Integrated Lights-Out</li>
<li><a href="https://github.com/NET-A-PORTER/NAP-policy">NET-A-PORTER/NAP-policy</a>&nbsp;- Policy / pragma for Perl code written at NAP</li>
<li><a href="https://github.com/neevek/minerl">neevek/minerl</a>&nbsp;- A blog-aware static site generator written in perl.</li>
<li><a href="https://github.com/miyagawa/Perlbal-Plugin-PSGI">miyagawa/Perlbal-Plugin-PSGI</a>&nbsp;- Perlbal plugin to run PSGI applications</li>
<li><a href="https://github.com/metacpan/metacpan-client">metacpan/metacpan-client</a>&nbsp;- Home of the official MetaCPAN Perl API client.</li>
<li><a href="https://github.com/mattn/p5-Growl-GNTP">mattn/p5-Growl-GNTP</a>&nbsp;- Perl implementation of GNTP Protocol (Client Part)</li>
<li><a href="https://github.com/marcschwartz/WriteXLS">marcschwartz/WriteXLS</a>&nbsp;- CRAN Package WriteXLS: Cross-platform Perl based R function to create Excel 2003 (XLS) and Excel 2007 (XLSX) files from one or more data frames. Each data frame will be written to a separate named worksheet in the Excel spreadsheet. The worksheet name will be the name of the data frame it contains or can be specified by the user.</li>
<li><a href="https://github.com/Leont/file-map">Leont/file-map</a>&nbsp;- Memory mapping for Perl</li>
<li><a href="https://github.com/kuzuha/WWW-Pixiv">kuzuha/WWW-Pixiv</a>&nbsp;- Perl interface for&nbsp;<a href="http://www.pixiv.net/">www.pixiv.net</a></li>
<li><a href="https://github.com/jozef/Debian-Apt-PM">jozef/Debian-Apt-PM</a>&nbsp;- locate Perl Modules in Debian repositories</li>
<li><a href="https://github.com/jjn1056/Perl-Catalyst-AsyncExample">jjn1056/Perl-Catalyst-AsyncExample</a>&nbsp;- maybe some sort of async with catalyst</li>
<li><a href="https://github.com/hprose/hprose-perl">hprose/hprose-perl</a>&nbsp;- Hprose for Perl</li>
<li><a href="https://github.com/hoytech/Session-Token">hoytech/Session-Token</a>&nbsp;- Secure, efficient, simple random session token generation</li>
<li><a href="https://github.com/gunnarbeutner/linux-kstat">gunnarbeutner/linux-kstat</a>&nbsp;- Sun::Solaris::Kstat perl module for linux-zfs</li>
<li><a href="https://github.com/gshank/ravlog">gshank/ravlog</a>&nbsp;- Perl Catalyst blog</li>
<li><a href="https://github.com/fmgoncalves/p5-cassandra-simple">fmgoncalves/p5-cassandra-simple</a>&nbsp;- Cassandra::Simple Perl Module - Easy to use, Perl oriented client interface to Apache Cassandra.</li>
<li><a href="https://github.com/fayland/perl-app-github">fayland/perl-app-github</a>&nbsp;- App::GitHub CPAN module</li>
<li><a href="https://github.com/eserte/cpan-testers-matrix">eserte/cpan-testers-matrix</a>&nbsp;- the code behind matrix.cpantesters.org</li>
<li><a href="https://github.com/dnmfarrell/Stasis">dnmfarrell/Stasis</a>&nbsp;- an encrypting archive tool using tar, gpg and perl</li>
<li><a href="https://github.com/dk/Net-Eboks">dk/Net-Eboks</a>&nbsp;- perl API for eboks.dk</li>
<li><a href="https://github.com/dagolden/extutils-parsexs">dagolden/extutils-parsexs</a>&nbsp;- converts Perl XS code into C code</li>
<li><a href="https://github.com/chrisa/perl-Net-SAML2">chrisa/perl-Net-SAML2</a>&nbsp;- Perl Net::SAML2 module</li>
<li><a href="https://github.com/chorny/smart-comments">chorny/smart-comments</a>&nbsp;- Perl programming module for easier debugging</li>
<li><a href="https://github.com/chetanganatra/Excel-2-Elasticsearch">chetanganatra/Excel-2-Elasticsearch</a>&nbsp;- Small and quick Perl script to inject records from MS Excel (.xlsx as well as .xls) directly into Elasticsearch.</li>
<li><a href="https://github.com/cbowns/fitbit-oauth-perl">cbowns/fitbit-oauth-perl</a>&nbsp;- A couple of perl scripts to get a Fitbit OAuth token and to use that token to upload Weightbot CSV data to Fitbit</li>
<li><a href="https://github.com/bricas/statistics-r">bricas/statistics-r</a>&nbsp;- Controls the R (R-project) interpreter through Perl</li>
<li><a href="https://github.com/brianwrf/myPadBuster">brianwrf/myPadBuster</a>&nbsp;- It is a Python+Perl script to exploit ASP.net Padding Oracle vulnerability.</li>
<li><a href="https://github.com/briandfoy/mycpan-indexer">briandfoy/mycpan-indexer</a>&nbsp;- (Perl) Index a Perl distribution</li>
<li><a href="https://github.com/briandfoy/module-release">briandfoy/module-release</a>&nbsp;- (Perl) Automate software releases</li>
<li><a href="https://github.com/Brasil-Perl-Mongers/perl-pro">Brasil-Perl-Mongers/perl-pro</a>&nbsp;- Site de divulga&ccedil;&atilde;o de vagas de emprego para programadores Perl no Brasil.</li>
<li><a href="https://github.com/bostonaholic/test-more-behaviour">bostonaholic/test-more-behaviour</a>&nbsp;- Rspec-style tests in Perl</li>
<li><a href="https://github.com/borisdaeppen/EBook--MOBI">borisdaeppen/EBook--MOBI</a>&nbsp;- Ebook in MOBI format with Perl</li>
<li><a href="https://github.com/book/Test-Database">book/Test-Database</a>&nbsp;- Perl extension to provide database handles in a test environment</li>
<li><a href="https://github.com/beppu/pod-server">beppu/pod-server</a>&nbsp;- a web server for locally installed perl documentation -- think gem_server for perl</li>
<li><a href="https://github.com/awwaiid/continuity">awwaiid/continuity</a>&nbsp;- Stateful Web Apps in Perl</li>
<li><a href="https://github.com/apparentlymart/libnet-openid-perl">apparentlymart/libnet-openid-perl</a>&nbsp;- OpenID libraries for Perl</li>
<li><a href="https://github.com/ambs/Quiki">ambs/Quiki</a>&nbsp;- Quick Wiki in Perl</li>
<li><a href="https://github.com/alambike/eixo-docker">alambike/eixo-docker</a>&nbsp;- Suite of Perl modules to interact with Docker</li>
<li><a href="https://github.com/abw/Badger">abw/Badger</a>&nbsp;- Perl application programming toolkit</li>
<li><a href="https://github.com/abh/colobus">abh/colobus</a>&nbsp;- Perl NNTP server</li>
<li><a href="https://github.com/Zverik/gpxplanet-tools">Zverik/gpxplanet-tools</a>&nbsp;- Perl scripts for processing OpenStreetMap's GPX planet</li>
<li><a href="https://github.com/zipf/perldoc-es">zipf/perldoc-es</a>&nbsp;- Documentaci&oacute;n de Perl en Espa&ntilde;ol / Spanish translation of Perl core docs</li>
<li><a href="https://github.com/yusukebe/Shiori">yusukebe/Shiori</a>&nbsp;- Yet another Perl implementation of Shiori web-app.</li>
<li><a href="https://github.com/yoshiki/perl-app-waffy">yoshiki/perl-app-waffy</a>&nbsp;- Twitter proxy for iPhone, Mobile(jp) and IRC</li>
<li><a href="https://github.com/yoe/sreview">yoe/sreview</a>&nbsp;- sreview review system</li>
<li><a href="https://github.com/yappo/p5-Groonga">yappo/p5-Groonga</a>&nbsp;- Perl Module of Groonga</li>
<li><a href="https://github.com/yannk/perl-anyevent-xmpp">yannk/perl-anyevent-xmpp</a>&nbsp;- my patches to AnyEvent::XMPP</li>
<li><a href="https://github.com/woodpeck/osm-revert-scripts">woodpeck/osm-revert-scripts</a>&nbsp;- A collection of Perl scripts to handle reverts on OpenStreetMap</li>
<li><a href="https://github.com/wertarbyte/hetzner-robot-perl">wertarbyte/hetzner-robot-perl</a>&nbsp;- Perl module and command line tool for control over the Hetzner robot</li>
<li><a href="https://github.com/tokuhirom/cgi-extlib-perl">tokuhirom/cgi-extlib-perl</a>&nbsp;- General extlib/ for Perl CGI applications.</li>
<li><a href="https://github.com/tlily/tigerlily">tlily/tigerlily</a>&nbsp;- perl client for the lily chat server</li>
<li><a href="https://github.com/tima/perl-amazon-s3">tima/perl-amazon-s3</a>&nbsp;- A portable client library for working with and managing Amazon S3 buckets and keys.</li>
<li><a href="https://github.com/subogero/rename">subogero/rename</a>&nbsp;- Perl rename as a separate package</li>
<li><a href="https://github.com/sstrigler/chatbot">sstrigler/chatbot</a>&nbsp;- a jabber channel bot written in perl</li>
<li><a href="https://github.com/softlayer/softlayer-api-perl-client">softlayer/softlayer-api-perl-client</a>&nbsp;- A set of Perl libraries that assist in calling the SoftLayer API.</li>
<li><a href="https://github.com/singingfish/Citeproc-Markdown">singingfish/Citeproc-Markdown</a>&nbsp;- Perl module for integrating with CSL processor inside Zotero for plain text / markdown citation support</li>
<li><a href="https://github.com/scottp/extjs-direct-perl">scottp/extjs-direct-perl</a>&nbsp;- A minimal perl implementation of ExtJS 3.0 Ext.Direct serverside stack</li>
<li><a href="https://github.com/s-aska/markdown-binder">s-aska/markdown-binder</a>&nbsp;- Ajax Markdown Viewer written in Perl, to run under Plack.</li>
<li><a href="https://github.com/ruoso/games-perl">ruoso/games-perl</a>&nbsp;- Series of blog posts on how to write games in Perl</li>
<li><a href="https://github.com/Potatohead/local-lib-profiles">Potatohead/local-lib-profiles</a>&nbsp;- management scripts for perl's local lib</li>
<li><a href="https://github.com/petdance/html-lint">petdance/html-lint</a>&nbsp;- HTML::Lint, the Perl module for HTML checking</li>
<li><a href="https://github.com/patschbo/BaNG">patschbo/BaNG</a>&nbsp;- Backup Next Generation for Linux &amp; Mac (using rsync and btrfs snapshots, Web-Frontend, Statistics, History-Merger)</li>
<li><a href="https://github.com/NoodlesNZ/statsd-perl-mysql">NoodlesNZ/statsd-perl-mysql</a>&nbsp;- MySQL stats logging for Statsd/Graphite</li>
<li><a href="https://github.com/naoya/hadoop-streaming-frontend">naoya/hadoop-streaming-frontend</a>&nbsp;- A frontend framework of Hadoop-Streaming for perl</li>
<li><a href="https://github.com/nagios-plugins/nagios-plugin-perl">nagios-plugins/nagios-plugin-perl</a>&nbsp;- Perl module Nagios::Monitoring::Plugin</li>
<li><a href="https://github.com/masak/psyde">masak/psyde</a>&nbsp;- A static webpage manager (written in Perl 6)</li>
<li><a href="https://github.com/masak/p6cc2012">masak/p6cc2012</a>&nbsp;- The Perl 6 coding contest, 2012 edition</li>
<li><a href="https://github.com/MarkGannon/XBRL">MarkGannon/XBRL</a>&nbsp;- Perl Module for Reading XBRL</li>
<li><a href="https://github.com/makamaka/JSON-PP">makamaka/JSON-PP</a>&nbsp;- JSON::PP for perl core module</li>
<li><a href="https://github.com/MadsAlbertsen/miscperlscripts">MadsAlbertsen/miscperlscripts</a>&nbsp;- Small collection of random useful perl scripts</li>
<li><a href="https://github.com/lestrrat/Data-Localize">lestrrat/Data-Localize</a>&nbsp;- Object Oriented Localization Tool For Perl</li>
<li><a href="https://github.com/kasei/attean">kasei/attean</a>&nbsp;- A Perl Semantic Web Framework</li>
<li><a href="https://github.com/kablamo/git-ribbon">kablamo/git-ribbon</a>&nbsp;- A Perl script that helps you read through the latest changes on a project.</li>
<li><a href="https://github.com/ingydotnet/yaml-pm6">ingydotnet/yaml-pm6</a>&nbsp;- YAML Implementation for Perl 6</li>
<li><a href="https://github.com/ingydotnet/testml-pm6">ingydotnet/testml-pm6</a>&nbsp;- TestML for Perl 6</li>
<li><a href="https://github.com/ikruglov/HADaemon-Control">ikruglov/HADaemon-Control</a>&nbsp;- Create init scripts for Perl high-available (HA) daemons</li>
<li><a href="https://github.com/ido50/Tenjin">ido50/Tenjin</a>&nbsp;- Fast templating engine with support for embedded Perl</li>
<li><a href="https://github.com/ICGC-TCGA-PanCancer/PCAP-core">ICGC-TCGA-PanCancer/PCAP-core</a>&nbsp;- NGS reference implementations and helper code for the IGCG/TCGA Pan-Cancer Analysis Project</li>
<li><a href="https://github.com/hiratara/p5-Data-Monad">hiratara/p5-Data-Monad</a>&nbsp;- A implementation of monads in Perl 5.</li>
<li><a href="https://github.com/hinrik/grok">hinrik/grok</a>&nbsp;- Perl 6 documentation reader</li>
<li><a href="https://github.com/hatena/perl5-test-apache-rewriterules">hatena/perl5-test-apache-rewriterules</a>&nbsp;- Test::Apache::RewriteRules - Testing Apache's Rewrite Rules</li>
<li><a href="https://github.com/gonzoua/book-tools">gonzoua/book-tools</a>&nbsp;- perl modules to work with ePUB and FB2 ebook formats</li>
<li><a href="https://github.com/fayland/dist-zilla-plugin-perltidy">fayland/dist-zilla-plugin-perltidy</a>&nbsp;- Dist::Zilla with Perl::Tidy</li>
<li><a href="https://github.com/ErinsMatthew/Import-IMDb-Ratings-Into-trakt.tv">ErinsMatthew/Import-IMDb-Ratings-Into-trakt.tv</a>&nbsp;- A Perl script that will load your IMDb ratings into trakt.tv</li>
<li><a href="https://github.com/dscho/dsstore">dscho/dsstore</a>&nbsp;- A remote-hg mirror of the Perl project to generate .DS_Store files (even on non-MacOSX), based on&nbsp;<a href="https://wiki.mozilla.org/DS_Store_File_Format">https://wiki.mozilla.org/DS_Store_File_Format</a></li>
<li><a href="https://github.com/dpavlin/Biblio-SIP2">dpavlin/Biblio-SIP2</a>&nbsp;- Simple 3M SIP2 Standard Interchange Protocol implementation in perl</li>
<li><a href="https://github.com/dinomite/Mac-iTunes-Library">dinomite/Mac-iTunes-Library</a>&nbsp;- Mac::iTunes::Library Perl module</li>
<li><a href="https://github.com/diegok/Gardel">diegok/Gardel</a>&nbsp;- Gardel is a very simple perl web framework that also has a hat. ( Inspired on sinatra.rb )</li>
<li><a href="https://github.com/demianriccardi/p5-HackaMol">demianriccardi/p5-HackaMol</a>&nbsp;- Object-Oriented Perl 5, Moose Library for Molecular Hacking</li>
<li><a href="https://github.com/daoswald/JSON-Tiny">daoswald/JSON-Tiny</a>&nbsp;- Perl module for encoding and decoding JSON in a minimalistic way, based on Mojo::JSON, adapted to stand alone.</li>
<li><a href="https://github.com/cryptostorm/cstorm_widget">cryptostorm/cstorm_widget</a>&nbsp;- The Perl source code to the Cryptostorm widget</li>
<li><a href="https://github.com/briandfoy/test-file">briandfoy/test-file</a>&nbsp;- (Perl) Check file attributes</li>
<li><a href="https://github.com/bingos/poe-component-irc">bingos/poe-component-irc</a>&nbsp;- A fully event-driven perl IRC client module</li>
<li><a href="https://github.com/bingos/gumbybrain">bingos/gumbybrain</a>&nbsp;- (perl) &lt; GumbyBRAIN&gt; when the kids had killed the man, i had the source now.</li>
<li><a href="https://github.com/beanz/anyevent-mqtt-perl">beanz/anyevent-mqtt-perl</a>&nbsp;- Perl modules for MQTT protocol (<a href="http://mqtt.org/">http://mqtt.org/</a>) using AnyEvent</li>
<li><a href="https://github.com/Akron/Sojolicious">Akron/Sojolicious</a>&nbsp;- OStatus for Perl - A social toolbox for Mojolicious</li>
<li><a href="https://github.com/achillean/shodan-perl">achillean/shodan-perl</a>&nbsp;- Perl library for SHODAN</li>
<li><a href="https://github.com/zzengineer/crawlpl">zzengineer/crawlpl</a>&nbsp;- compact crawling tools written in perl</li>
<li><a href="https://github.com/zigorou/perl-json-pointer">zigorou/perl-json-pointer</a>&nbsp;- A JSON Pointer implementation for Perl</li>
<li><a href="https://github.com/zakame/hashids.pm">zakame/hashids.pm</a>&nbsp;- Hashids, ported for Perl</li>
<li><a href="https://github.com/ysasaki/Text-Sass-XS">ysasaki/Text-Sass-XS</a>&nbsp;- Perl Binding for libsass</li>
<li><a href="https://github.com/yapceurope/perl-events">yapceurope/perl-events</a>&nbsp;- Information about all Perl conferences and workshops</li>
<li><a href="https://github.com/xing/perl-beetle">xing/perl-beetle</a>&nbsp;- High availability AMQP messaging with redundant queues</li>
<li><a href="https://github.com/wbuntine/text-bags">wbuntine/text-bags</a>&nbsp;- Perl scripts for massaging document collections in various ways to prepare them for topic modelling.</li>
<li><a href="https://github.com/victori/perlbal-plugin-mogilefs">victori/perlbal-plugin-mogilefs</a>&nbsp;- Perlbal Plugin to serve data from MogileFS</li>
<li><a href="https://github.com/UUPharmacometrics/PsN">UUPharmacometrics/PsN</a>&nbsp;- Perl-Speaks-NONMEM</li>
<li><a href="https://github.com/urandom/p2js">urandom/p2js</a>&nbsp;- IWL Perl To Javascript converter</li>
<li><a href="https://github.com/urandom/iwl">urandom/iwl</a>&nbsp;- IWL - perl web widget library</li>
<li><a href="https://github.com/unbit/unbit-bars">unbit/unbit-bars</a>&nbsp;- A Perl Curses::UI interface for uWSGI metrics subsystem</li>
<li><a href="https://github.com/typester/text-microtemplate-extended-perl">typester/text-microtemplate-extended-perl</a>&nbsp;- Template engine extended from Text::MicroTemplate</li>
<li><a href="https://github.com/troywill/foscam-zoneminder">troywill/foscam-zoneminder</a>&nbsp;- Zoneminder Perl control module for the Foscam FI8910W wireless IP Camera</li>
<li><a href="https://github.com/tominsam/bot-basicbot-pluggable">tominsam/bot-basicbot-pluggable</a>&nbsp;- Pluggable perl IRC bot</li>
<li><a href="https://github.com/tokuhirom/p5-fcgi-client">tokuhirom/p5-fcgi-client</a>&nbsp;- FCGI client library in pure perl</li>
<li><a href="https://github.com/tokuhirom/http-mobileattribute">tokuhirom/http-mobileattribute</a>&nbsp;- HTTP::MobileAttribute is a perl module for handle japanese mobile phones</li>
<li><a href="https://github.com/timbunce/Dist-Surveyor">timbunce/Dist-Surveyor</a>&nbsp;- Survey installed perl modules and determine the specific distribution versions they came from</li>
<li><a href="https://github.com/thoukydides/heatmiser-wifi">thoukydides/heatmiser-wifi</a>&nbsp;- Web interface, SiriProxy plugin and Perl libraries for Heatmiser Wi-Fi Thermostats</li>
<li><a href="https://github.com/tadzik/perl6-File-Tools">tadzik/perl6-File-Tools</a>&nbsp;- File::Tools &ndash; common shell commands replacements</li>
<li><a href="https://github.com/szabgab/PDE">szabgab/PDE</a>&nbsp;- Perl Development Environment</li>
<li><a href="https://github.com/sparky/perl-Net-Curl">sparky/perl-Net-Curl</a>&nbsp;- Object-oriented wrapper for libcurl</li>
<li><a href="https://github.com/sludin/http2-perl">sludin/http2-perl</a>&nbsp;- Perl implementation of the HTTP/2.0 protocol</li>
<li><a href="https://github.com/slimakuj/perl">slimakuj/perl</a>&nbsp;-&nbsp;<img src="https://assets-cdn.github.com/images/icons/emoji/unicode/1f42a.png" alt=":dromedary_camel:" width="20" height="20" style="border: 0px;">&nbsp;Materiały do warsztat&oacute;w z Perla</li>
<li><a href="https://github.com/reyjrar/Parse-Syslog-Line">reyjrar/Parse-Syslog-Line</a>&nbsp;- Flexible library for parsing syslog messages in Perl</li>
<li><a href="https://github.com/revmischa/av-streamer">revmischa/av-streamer</a>&nbsp;- Perl bindings for libav/ffmpeg</li>
<li><a href="https://github.com/pstuifzand/docker-perl">pstuifzand/docker-perl</a>&nbsp;- Perl library for Docker&nbsp;<a href="http://docker.io/">http://docker.io/</a></li>
<li><a href="https://github.com/potyl/perl-Gtk3-WebKit">potyl/perl-Gtk3-WebKit</a>&nbsp;- Perl bindings for the gtk3 port of WebKit</li>
<li><a href="https://github.com/petdance/perl-critic-bangs">petdance/perl-critic-bangs</a>&nbsp;- Perl::Critic::Bangs -- Extra policies for Perl::Critic</li>
<li><a href="https://github.com/Perl-Toolchain-Gang/local-lib">Perl-Toolchain-Gang/local-lib</a>&nbsp;- local::lib - create and use a local lib/ for perl modules with PERL5LIB</li>
<li><a href="https://github.com/Perl-Toolchain-Gang/File-chdir">Perl-Toolchain-Gang/File-chdir</a>&nbsp;- (Perl) a more sensible way to change directories</li>
<li><a href="https://github.com/PerlDancer/perldancer-book">PerlDancer/perldancer-book</a>&nbsp;- a book about the Perl Dancer micro framework</li>
<li><a href="https://github.com/pedros/WWW-Wordnik-API">pedros/WWW-Wordnik-API</a>&nbsp;- Wordnik API perl implementation</li>
<li><a href="https://github.com/PagerDuty/pagerduty-nagios-pl">PagerDuty/pagerduty-nagios-pl</a>&nbsp;- Nagios Integration for PagerDuty via Perl Wrapper</li>
<li><a href="https://github.com/osfameron/acme--monads">osfameron/acme--monads</a>&nbsp;- Monads in pure Perl, using Devel::Declare</li>
<li><a href="https://github.com/odyniec/Dancer-Plugin-DebugToolbar">odyniec/Dancer-Plugin-DebugToolbar</a>&nbsp;- Debugging toolbar for Perl Dancer web applications</li>
<li><a href="https://github.com/obuk/Cv-Olive">obuk/Cv-Olive</a>&nbsp;- Cv module is perl interface to OpenCV library.</li>
<li><a href="https://github.com/norm/p5-css-prepare">norm/p5-css-prepare</a>&nbsp;- Perl module to preprocess CSS files</li>
<li><a href="https://github.com/norbu09/Giovanni">norbu09/Giovanni</a>&nbsp;- a Perl based deployment system</li>
<li><a href="https://github.com/nigelm/html-scrubber">nigelm/html-scrubber</a>&nbsp;- Perl extension for scrubbing/sanitizing html</li>
<li><a href="https://github.com/neilb/WebService-HackerNews">neilb/WebService-HackerNews</a>&nbsp;- An interface to the official Hacker News API (for Perl 5)</li>
<li><a href="https://github.com/naoya/perl-thrift-server">naoya/perl-thrift-server</a>&nbsp;- Thrift server implementation for perl</li>
<li><a href="https://github.com/mtve/bitcoin-pl">mtve/bitcoin-pl</a>&nbsp;- BitCoin perl implementation</li>
<li><a href="https://github.com/moritz/tufte">moritz/tufte</a>&nbsp;- SVG plotting library for Perl 6</li>
<li><a href="https://github.com/mndrix/Finance-MtGox">mndrix/Finance-MtGox</a>&nbsp;- MtGox API bindings for Perl</li>
<li><a href="https://github.com/masartz/p5-webservice-hatena-bookmark-lite">masartz/p5-webservice-hatena-bookmark-lite</a>&nbsp;- A Perl Interface for Hatena::Bookmark AtomPub API</li>
<li><a href="https://github.com/masak/farm">masak/farm</a>&nbsp;- Little Animal Farm, a WWII polish family game, implemented in Perl 6</li>
<li><a href="https://github.com/LiosK/Finance--Quote--YahooJapan">LiosK/Finance--Quote--YahooJapan</a>&nbsp;- Finance::Quote::YahooJapan - A Perl module that enables GnuCash to get quotes of Japanese stocks and mutual funds from Yahoo! Finance JAPAN.</li>
<li><a href="https://github.com/Leont/threads-lite">Leont/threads-lite</a>&nbsp;- An Erlang style threading library for perl</li>
<li><a href="https://github.com/khenn/Lacuna">khenn/Lacuna</a>&nbsp;- Perl API for accessing Lacuna webservices</li>
<li><a href="https://github.com/kevinbosak/Minecraft-Perl">kevinbosak/Minecraft-Perl</a>&nbsp;- Perl libs to manipulate Minecraft data files</li>
<li><a href="https://github.com/kentaro/perl-dbix-rico">kentaro/perl-dbix-rico</a>&nbsp;- Yet, yet, ... yet another ORM for Perl</li>
<li><a href="https://github.com/kentaro/perl-app-socialskk">kentaro/perl-app-socialskk</a>&nbsp;- SKK Goes Social</li>
<li><a href="https://github.com/jkahn/twitter-bot">jkahn/twitter-bot</a>&nbsp;- Perl library for writing simple bots for twitter</li>
<li><a href="https://github.com/jimbomorrison/git.generate-changelog">jimbomorrison/git.generate-changelog</a>&nbsp;- Small perl script for generating a pretty changelog from git commits</li>
<li><a href="https://github.com/jhthorsen/mojo-redis2">jhthorsen/mojo-redis2</a>&nbsp;- Pure-Perl non-blocking I/O Redis driver</li>
<li><a href="https://github.com/ironcamel/Net-OpenStack-Compute">ironcamel/Net-OpenStack-Compute</a>&nbsp;- Perl bindings for the OpenStack compute api.</li>
<li><a href="https://github.com/ingydotnet/testml-pm">ingydotnet/testml-pm</a>&nbsp;- TestML for Perl</li>
<li><a href="https://github.com/infobyte/isr-sqlget">infobyte/isr-sqlget</a>&nbsp;- ISR-sqlget It's a blind SQL injection tool developed in Perl.</li>
<li><a href="https://github.com/HariSekhon/lib">HariSekhon/lib</a>&nbsp;- Perl Utility Library for my other repos</li>
<li><a href="https://github.com/gugod/acme-cpanauthors-taiwanese">gugod/acme-cpanauthors-taiwanese</a>&nbsp;- (Perl) We are Taiwanese CPAN Authors!</li>
<li><a href="https://github.com/gphat/io-storm">gphat/io-storm</a>&nbsp;- Perl support for Twitter's Storm distributed computational system.</li>
<li><a href="https://github.com/goccy/p5-Test-AutoGenerator">goccy/p5-Test-AutoGenerator</a>&nbsp;- automatically generate perl test code.</li>
<li><a href="https://github.com/gisle/mozilla-ca">gisle/mozilla-ca</a>&nbsp;- Perl module that provides Mozilla's CA cert bundle in PEM format</li>
<li><a href="https://github.com/ghedo/p5-LLVM">ghedo/p5-LLVM</a>&nbsp;- Perl bindings to the Low Level Virtual Machine</li>
<li><a href="https://github.com/gfx/Perl-Module-Install-XSUtil">gfx/Perl-Module-Install-XSUtil</a>&nbsp;- Support XS-based modules in the term of Module::Install</li>
<li><a href="https://github.com/gfx/Acme-Perl-VM">gfx/Acme-Perl-VM</a>&nbsp;- A Perl5 Virtual Machine in Pure Perl</li>
<li><a href="https://github.com/getsentry/perl-raven">getsentry/perl-raven</a>&nbsp;- A perl sentry client</li>
<li><a href="https://github.com/gbarr/AnyEvent-MongoDB">gbarr/AnyEvent-MongoDB</a>&nbsp;- perl AnyEvent MongoDB client driver</li>
<li><a href="https://github.com/gaal/app-csv">gaal/app-csv</a>&nbsp;- App::CSV Perl module, csv command line tool</li>
<li><a href="https://github.com/fukawi2/boxcutter">fukawi2/boxcutter</a>&nbsp;- Perl parser for converting iTunes playlists to a more useful format (eg, m3u)</li>
<li><a href="https://github.com/exodist/Child">exodist/Child</a>&nbsp;- (perl) Object oriented simple interface to fork()</li>
<li><a href="https://github.com/dwimperl/dwimperl-linux">dwimperl/dwimperl-linux</a>&nbsp;- Batteries included Perl distribution for Linux</li>
<li><a href="https://github.com/dwery/hue-perl">dwery/hue-perl</a>&nbsp;- A Perl module for the Philips Hue light system</li>
<li><a href="https://github.com/dpirotte/perl-mail-chimp">dpirotte/perl-mail-chimp</a>&nbsp;- MailChimp API wrapper for Perl</li>
<li><a href="https://github.com/dnorman/perl-DBR">dnorman/perl-DBR</a>&nbsp;- A different approach to ORM for perl</li>
<li><a href="https://github.com/dnmfarrell/perltricks-static">dnmfarrell/perltricks-static</a>&nbsp;- PerlTricks.com is a website dedicated to Perl programming code and community news.</li>
<li><a href="https://github.com/dluxhu/perl-parallel-forkmanager">dluxhu/perl-parallel-forkmanager</a>&nbsp;- Parallel::ForkManager</li>
<li><a href="https://github.com/dams/riak-client">dams/riak-client</a>&nbsp;- Perl Riak Client</li>
<li><a href="https://github.com/damil/DBIx-DataModel">damil/DBIx-DataModel</a>&nbsp;- UML-based Object-Relational Mapping (ORM) framework for Perl</li>
<li><a href="https://github.com/cowholio4/log4perl_gelf">cowholio4/log4perl_gelf</a>&nbsp;- Log::Log4perl::Layout::GELF</li>
<li><a href="https://github.com/cowens/perlopref">cowens/perlopref</a>&nbsp;- A quick reference guide for Perl 5 operators</li>
<li><a href="https://github.com/bunk3r/perlbackdoor">bunk3r/perlbackdoor</a>&nbsp;- advanced Perl Backdoor</li>
<li><a href="https://github.com/bokkypoobah/TheDAOVoter">bokkypoobah/TheDAOVoter</a>&nbsp;- Perl script to list and vote on The DAO proposals</li>
<li><a href="https://github.com/alexei/silverstripe-unidecode">alexei/silverstripe-unidecode</a>&nbsp;- Unidecode is a PHP version of the perl module Text::Unicode. It takes UTF-8 data and tries to represent it in US-ASCII characters.</li>
<li><a href="https://github.com/aleimba/bac-genomics-scripts">aleimba/bac-genomics-scripts</a>&nbsp;- Collection of scripts for bacterial genomics</li>
<li><a href="https://github.com/aichaos/rivescript-perl">aichaos/rivescript-perl</a>&nbsp;- A RiveScript interpreter for Perl. RiveScript is a scripting language for chatterbots.</li>
<li><a href="https://github.com/adamziaja/perl">adamziaja/perl</a>&nbsp;- my simple&nbsp;<img src="https://assets-cdn.github.com/images/icons/emoji/unicode/1f42a.png" alt=":dromedary_camel:" width="20" height="20" style="border: 0px;">&nbsp;perl5 scripts</li>
<li><a href="https://github.com/aallan/perl-modules-for-astronomy">aallan/perl-modules-for-astronomy</a>&nbsp;- Astronomy related Perl Modules.</li>
<li><a href="https://github.com/yannk/perl-anyevent-superfeedr">yannk/perl-anyevent-superfeedr</a>&nbsp;- Perl5 Interface to superfeedr.com - RT notifications of feed updates</li>
<li><a href="https://github.com/vti/perltuts.com-tutorials">vti/perltuts.com-tutorials</a>&nbsp;- Tutorials for perltuts.com</li>
<li><a href="https://github.com/typepad/perl-typepad-api">typepad/perl-typepad-api</a>&nbsp;- WWW::TypePad</li>
<li><a href="https://github.com/tune-it/jplbot">tune-it/jplbot</a>&nbsp;- Simple jabber and telegram bot written in perl</li>
<li><a href="https://github.com/tociyuki/libtext-tepl-runtime-perl">tociyuki/libtext-tepl-runtime-perl</a>&nbsp;- Text::Tepl::Runtime - Basic runtime filters for Text::Tepl</li>
<li><a href="https://github.com/theory/pod-site">theory/pod-site</a>&nbsp;- Build browsable HTML documentation for your Perl app</li>
<li><a href="https://github.com/syndicut/virt-backup">syndicut/virt-backup</a>&nbsp;- Perl script to backup qemu machines by Daniel Berteaud&nbsp;<a href="mailto:daniel@firewall-services.com">daniel@firewall-services.com</a></li>
<li><a href="https://github.com/Starlink/ORAC-DR">Starlink/ORAC-DR</a>&nbsp;- The ORAC-DR astronomy data reduction pipeline</li>
<li><a href="https://github.com/soh335/p5-Data-Wheren">soh335/p5-Data-Wheren</a>&nbsp;- wheren module for perl</li>
<li><a href="https://github.com/skx/predis">skx/predis</a>&nbsp;- A redis-server written in Perl.</li>
<li><a href="https://github.com/shadowcat-mst/pumpkin-perl-staging">shadowcat-mst/pumpkin-perl-staging</a>&nbsp;- Staging repostiory for the Pumpkin Perl patchset</li>
<li><a href="https://github.com/sekia/Algorithm-LibLinear">sekia/Algorithm-LibLinear</a>&nbsp;- A Perl binding for LIBLINEAR, a library for classification/regression using linear SVM and logistic regression.</li>
<li><a href="https://github.com/sebthebert/WWW-PushBullet">sebthebert/WWW-PushBullet</a>&nbsp;- PushBullet Perl module</li>
<li><a href="https://github.com/russoz/DataFlow">russoz/DataFlow</a>&nbsp;- Data-flow framework for Perl</li>
<li><a href="https://github.com/run4flat/perl_nvcc">run4flat/perl_nvcc</a>&nbsp;- A CUDA compiler and linker wrapper for Perl's toolchain.</li>
<li><a href="https://github.com/run4flat/Alien-Cairo">run4flat/Alien-Cairo</a>&nbsp;- Perl Alien package for libCairo</li>
<li><a href="https://github.com/rs/net-server-mail">rs/net-server-mail</a>&nbsp;- Extensible Perl implementation of the STMP protocol and its different evolutions (ie: ESMTP, LMTP)</li>
<li><a href="https://github.com/rramsden/TCP-IP-Stack">rramsden/TCP-IP-Stack</a>&nbsp;- computer science 460 group project written in perl</li>
<li><a href="https://github.com/rjbs/Sub-Exporter">rjbs/Sub-Exporter</a>&nbsp;- a sophisticated, customizable code exporter for Perl</li>
<li><a href="https://github.com/rjbs/Email-MIME-Kit">rjbs/Email-MIME-Kit</a>&nbsp;- (Perl) build messages from templates</li>
<li><a href="https://github.com/rjbs/Data-Section">rjbs/Data-Section</a>&nbsp;- perl library read data from parts of the&nbsp;<span>DATA</span>&nbsp;section</li>
<li><a href="https://github.com/riusksk/StrutScan">riusksk/StrutScan</a>&nbsp;- Struts2 Vuls Scanner base perl script</li>
<li><a href="https://github.com/renormalist/data-dpath">renormalist/data-dpath</a>&nbsp;- A perl lib to provide access to data structures inspired by XPath</li>
<li><a href="https://github.com/rafl/nanomsg-raw">rafl/nanomsg-raw</a>&nbsp;- nanomsg bindings for Perl</li>
<li><a href="https://github.com/pkrumins/youtube-video-downloader-in-perl">pkrumins/youtube-video-downloader-in-perl</a>&nbsp;- Wrote this real quick as I needed to get some vids</li>
<li><a href="https://github.com/pjlsergeant/perl6status">pjlsergeant/perl6status</a>&nbsp;- Perl 6 Status document</li>
<li><a href="https://github.com/perlbot/perlbuut">perlbot/perlbuut</a>&nbsp;- new version of perlbot, based on buubot</li>
<li><a href="https://github.com/p5-shorten/www-shorten">p5-shorten/www-shorten</a>&nbsp;- Perl interface to various URL-shortening sites</li>
<li><a href="https://github.com/Ovid/test--most">Ovid/test--most</a>&nbsp;- Test::Most -- The most commonly needed testing functionality in Perl</li>
<li><a href="https://github.com/openerserver/openerserver_perl">openerserver/openerserver_perl</a>&nbsp;- Http Container for run any code with http server.</li>
<li><a href="https://github.com/nwellnhof/Net-Google-Analytics">nwellnhof/Net-Google-Analytics</a>&nbsp;- Perl interface to the Google Analytics Core Reporting API</li>
<li><a href="https://github.com/nferraz/Perl-Data-Warehouse-Toolkit">nferraz/Perl-Data-Warehouse-Toolkit</a>&nbsp;- Make simple ETL and Data Warehouse tasks easy, and complex tasks possible.</li>
<li><a href="https://github.com/mpdehaan/Elevator">mpdehaan/Elevator</a>&nbsp;- A pluggable object-oriented data layer for Perl and Moose</li>
<li><a href="https://github.com/moznion/Perl-PrereqScanner-Lite">moznion/Perl-PrereqScanner-Lite</a>&nbsp;- Lightweight Prereqs Scanner for Perl</li>
<li><a href="https://github.com/miki/Hoppy">miki/Hoppy</a>&nbsp;- Flash XMLSocket Server ( perl implementation )</li>
<li><a href="https://github.com/melo/amqp-tools">melo/amqp-tools</a>&nbsp;- An AMQP stack for Perl</li>
<li><a href="https://github.com/maio/perl-Koans">maio/perl-Koans</a>&nbsp;- Perl Koans</li>
<li><a href="https://github.com/lestrrat/Orochi">lestrrat/Orochi</a>&nbsp;- A DI Container For Perl</li>
<li><a href="https://github.com/lestrrat/Algorithm-ConsistentHash-Ketama">lestrrat/Algorithm-ConsistentHash-Ketama</a>&nbsp;- Ketama Consistent Hashing for Perl (XS)</li>
<li><a href="https://github.com/klenin/cats-judge">klenin/cats-judge</a>&nbsp;- Automated judging system for programming contests</li>
<li><a href="https://github.com/kazeburo/Apache-LogFormat-Compiler">kazeburo/Apache-LogFormat-Compiler</a>&nbsp;- Compile LogFormat to perl-code</li>
<li><a href="https://github.com/jmcnamara/pod-simple-wiki">jmcnamara/pod-simple-wiki</a>&nbsp;- A Perl Module for creating Pod to Wiki filters.</li>
<li><a href="https://github.com/jimdigriz/freeradius-oauth2-perl">jimdigriz/freeradius-oauth2-perl</a>&nbsp;- FreeRADIUS OAuth2 (OpenID Connect) using rlm_perl</li>
<li><a href="https://github.com/jhthorsen/net-isc-dhcpd">jhthorsen/net-isc-dhcpd</a>&nbsp;- Perl module that interacts with ISC DHCPd</li>
<li><a href="https://github.com/jatimon/ThumbScanner">jatimon/ThumbScanner</a>&nbsp;- WDTV Perl based movie sheet generator</li>
<li><a href="https://github.com/ikegami/perl-LWP-Protocol-AnyEvent-http">ikegami/perl-LWP-Protocol-AnyEvent-http</a>&nbsp;- Event loop friendly HTTP and HTTPS backend for Perl's LWP</li>
<li><a href="https://github.com/ihh/gfftools">ihh/gfftools</a>&nbsp;- Perl scripts for working with the GFF format</li>
<li><a href="https://github.com/iamcal/perl-Flickr-API">iamcal/perl-Flickr-API</a>&nbsp;- Perl interface to the Flickr API</li>
<li><a href="https://github.com/hoytech/Thrust">hoytech/Thrust</a>&nbsp;- Perl language bindings for Thrust&nbsp;<a href="https://github.com/breach/thrust">https://github.com/breach/thrust</a></li>
<li><a href="https://github.com/hotwolf/HSW12">hotwolf/HSW12</a>&nbsp;- Assembler and IDE for NXP/Freescale/Motorola's HC11, HC12, S12, S12X, and XGATE CPUs</li>
<li><a href="https://github.com/hakobe/pig">hakobe/pig</a>&nbsp;- Perl IRC Gateway</li>
<li><a href="https://github.com/gugod/rubyish-perl">gugod/rubyish-perl</a>&nbsp;- For writting perl code with some ruby feeling.</li>
<li><a href="https://github.com/gisle/tkx">gisle/tkx</a>&nbsp;- A Tk interface for Perl</li>
<li><a href="https://github.com/gisle/digest-md5">gisle/digest-md5</a>&nbsp;- The Digest::MD5 Perl module</li>
<li><a href="https://github.com/gbarr/perl-TimeDate">gbarr/perl-TimeDate</a>&nbsp;- time &amp; date parsing and formatting perl library</li>
<li><a href="https://github.com/gbarr/perl-IO">gbarr/perl-IO</a>&nbsp;- Perl IO modules -- THESE MODULES ARE NO LONGER MAINTAINED OUTSIDE THE perl5 DISTRIBUTION. Send all patched to&nbsp;</li></ul>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35176/perloneliner-for-bioinformatician</guid>
	<pubDate>Mon, 15 Jan 2018 04:57:40 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35176/perloneliner-for-bioinformatician</link>
	<title><![CDATA[PerlOneLiner for Bioinformatician]]></title>
	<description><![CDATA[<p>FILE SPACING<br />------------</p><p># Double space a file<br />perl -pe '$\="\n"'<br />perl -pe 'BEGIN { $\="\n" }'<br />perl -pe '$_ .= "\n"'<br />perl -pe 's/$/\n/'<br />perl -nE 'say'</p><p># Double space a file, except the blank lines<br />perl -pe '$_ .= "\n" unless /^$/'<br />perl -pe '$_ .= "\n" if /\S/'</p><p># Triple space a file<br />perl -pe '$\="\n\n"'<br />perl -pe '$_.="\n\n"'</p><p># N-space a file<br />perl -pe '$_.="\n"x7'</p><p># Add a blank line before every line<br />perl -pe 's//\n/'</p><p># Remove all blank lines<br />perl -ne 'print unless /^$/'<br />perl -lne 'print if length'<br />perl -ne 'print if /\S/'</p><p># Remove all consecutive blank lines, leaving just one<br />perl -00 -pe ''<br />perl -00pe0</p><p># Compress/expand all blank lines into N consecutive ones<br />perl -00 -pe '$_.="\n"x4'</p><p># Fold a file so that every set of 10 lines becomes one tab-separated line<br />perl -lpe '$\ = $. % 10 ? "\t" : "\n"'</p><p><br />LINE NUMBERING<br />--------------</p><p># Number all lines in a file<br />perl -pe '$_ = "$. $_"'</p><p># Number only non-empty lines in a file<br />perl -pe '$_ = ++$a." $_" if /./'</p><p># Number and print only non-empty lines in a file (drop empty lines)<br />perl -ne 'print ++$a." $_" if /./'</p><p># Number all lines but print line numbers only non-empty lines<br />perl -pe '$_ = "$. $_" if /./'</p><p># Number only lines that match a pattern, print others unmodified<br />perl -pe '$_ = ++$a." $_" if /regex/'</p><p># Number and print only lines that match a pattern<br />perl -ne 'print ++$a." $_" if /regex/'</p><p># Number all lines, but print line numbers only for lines that match a pattern<br />perl -pe '$_ = "$. $_" if /regex/'</p><p># Number all lines in a file using a custom format (emulate cat -n)<br />perl -ne 'printf "%-5d %s", $., $_'</p><p># Print the total number of lines in a file (emulate wc -l)<br />perl -lne 'END { print $. }'<br />perl -le 'print $n=()=&lt;&gt;'<br />perl -le 'print scalar(()=&lt;&gt;)'<br />perl -le 'print scalar(@foo=&lt;&gt;)'<br />perl -ne '}{print $.'<br />perl -nE '}{say $.'</p><p># Print the number of non-empty lines in a file<br />perl -le 'print scalar(grep{/./}&lt;&gt;)'<br />perl -le 'print ~~grep{/./}&lt;&gt;'<br />perl -le 'print~~grep/./,&lt;&gt;'<br />perl -E 'say~~grep/./,&lt;&gt;'</p><p># Print the number of empty lines in a file<br />perl -lne '$a++ if /^$/; END {print $a+0}'<br />perl -le 'print scalar(grep{/^$/}&lt;&gt;)'<br />perl -le 'print ~~grep{/^$/}&lt;&gt;'<br />perl -E 'say~~grep{/^$/}&lt;&gt;'</p><p># Print the number of lines in a file that match a pattern (emulate grep -c)<br />perl -lne '$a++ if /regex/; END {print $a+0}'<br />perl -nE '$a++ if /regex/; END {say $a+0}'</p><p><br />CALCULATIONS<br />------------</p><p># Check if a number is a prime<br />perl -lne '(1x$_) !~ /^1?$|^(11+?)\1+$/ &amp;&amp; print "$_ is prime"'</p><p># Print the sum of all the fields on a line<br />perl -MList::Util=sum -alne 'print sum @F'</p><p># Print the sum of all the fields on all lines<br />perl -MList::Util=sum -alne 'push @S,@F; END { print sum @S }'<br />perl -MList::Util=sum -alne '$s += sum @F; END { print $s }'</p><p># Shuffle all fields on a line<br />perl -MList::Util=shuffle -alne 'print "@{[shuffle @F]}"'<br />perl -MList::Util=shuffle -alne 'print join " ", shuffle @F'</p><p># Find the minimum element on a line<br />perl -MList::Util=min -alne 'print min @F'</p><p># Find the minimum element over all the lines<br />perl -MList::Util=min -alne '@M = (@M, @F); END { print min @M }'<br />perl -MList::Util=min -alne '$min = min @F; $rmin = $min unless defined $rmin &amp;&amp; $min &gt; $rmin; END { print $rmin }'</p><p># Find the maximum element on a line<br />perl -MList::Util=max -alne 'print max @F'</p><p># Find the maximum element over all the lines<br />perl -MList::Util=max -alne '@M = (@M, @F); END { print max @M }'</p><p># Replace each field with its absolute value<br />perl -alne 'print "@{[map { abs } @F]}"'</p><p># Find the total number of fields (words) on each line<br />perl -alne 'print scalar @F'</p><p># Print the total number of fields (words) on each line followed by the line<br />perl -alne 'print scalar @F, " $_"'</p><p># Find the total number of fields (words) on all lines<br />perl -alne '$t += @F; END { print $t}'</p><p># Print the total number of fields that match a pattern<br />perl -alne 'map { /regex/ &amp;&amp; $t++ } @F; END { print $t }'<br />perl -alne '$t += /regex/ for @F; END { print $t }'<br />perl -alne '$t += grep /regex/, @F; END { print $t }'</p><p># Print the total number of lines that match a pattern<br />perl -lne '/regex/ &amp;&amp; $t++; END { print $t }'</p><p># Print the number PI to n decimal places<br />perl -Mbignum=bpi -le 'print bpi(n)'</p><p># Print the number PI to 39 decimal places<br />perl -Mbignum=PI -le 'print PI'</p><p># Print the number E to n decimal places<br />perl -Mbignum=bexp -le 'print bexp(1,n+1)'</p><p># Print the number E to 39 decimal places<br />perl -Mbignum=e -le 'print e'</p><p># Print UNIX time (seconds since Jan 1, 1970, 00:00:00 UTC)<br />perl -le 'print time'</p><p># Print GMT (Greenwich Mean Time) and local computer time<br />perl -le 'print scalar gmtime'<br />perl -le 'print scalar localtime'</p><p># Print local computer time in H:M:S format<br />perl -le 'print join ":", (localtime)[2,1,0]'</p><p># Print yesterday's date<br />perl -MPOSIX -le '@now = localtime; $now[3] -= 1; print scalar localtime mktime @now'</p><p># Print date 14 months, 9 days and 7 seconds ago<br />perl -MPOSIX -le '@now = localtime; $now[0] -= 7; $now[4] -= 14; $now[7] -= 9; print scalar localtime mktime @now'</p><p># Prepend timestamps to stdout (GMT, localtime)<br />tail -f logfile | perl -ne 'print scalar gmtime," ",$_'<br />tail -f logfile | perl -ne 'print scalar localtime," ",$_'</p><p># Calculate factorial of 5<br />perl -MMath::BigInt -le 'print Math::BigInt-&gt;new(5)-&gt;bfac()'<br />perl -le '$f = 1; $f *= $_ for 1..5; print $f'</p><p># Calculate greatest common divisor (GCM)<br />perl -MMath::BigInt=bgcd -le 'print bgcd(@list_of_numbers)'</p><p># Calculate GCM of numbers 20 and 35 using Euclid's algorithm<br />perl -le '$n = 20; $m = 35; ($m,$n) = ($n,$m%$n) while $n; print $m'</p><p># Calculate least common multiple (LCM) of numbers 35, 20 and 8<br />perl -MMath::BigInt=blcm -le 'print blcm(35,20,8)'</p><p># Calculate LCM of 20 and 35 using Euclid's formula: n*m/gcd(n,m)<br />perl -le '$a = $n = 20; $b = $m = 35; ($m,$n) = ($n,$m%$n) while $n; print $a*$b/$m'</p><p># Generate 10 random numbers between 5 and 15 (excluding 15)<br />perl -le '$n=10; $min=5; $max=15; $, = " "; print map { int(rand($max-$min))+$min } 1..$n'</p><p># Find and print all permutations of a list<br />perl -MAlgorithm::Permute -le '$l = [1,2,3,4,5]; $p = Algorithm::Permute-&gt;new($l); print @r while @r = $p-&gt;next'</p><p># Generate the power set<br />perl -MList::PowerSet=powerset -le '@l = (1,2,3,4,5); for (@{powerset(@l)}) { print "@$_" }'</p><p># Convert an IP address to unsigned integer<br />perl -le '$i=3; $u += ($_&lt;&lt;8*$i--) for "127.0.0.1" =~ /(\d+)/g; print $u'<br />perl -le '$ip="127.0.0.1"; $ip =~ s/(\d+)\.?/sprintf("%02x", $1)/ge; print hex($ip)'<br />perl -le 'print unpack("N", 127.0.0.1)'<br />perl -MSocket -le 'print unpack("N", inet_aton("127.0.0.1"))'</p><p># Convert an unsigned integer to an IP address<br />perl -MSocket -le 'print inet_ntoa(pack("N", 2130706433))'<br />perl -le '$ip = 2130706433; print join ".", map { (($ip&gt;&gt;8*($_))&amp;0xFF) } reverse 0..3'<br />perl -le '$ip = 2130706433; $, = "."; print map { (($ip&gt;&gt;8*($_))&amp;0xFF) } reverse 0..3'</p><p><br />STRING CREATION AND ARRAY CREATION<br />----------------------------------</p><p># Generate and print the alphabet<br />perl -le 'print a..z'<br />perl -le 'print ("a".."z")'<br />perl -le '$, = ","; print ("a".."z")'<br />perl -le 'print join ",", ("a".."z")'</p><p># Generate and print all the strings from "a" to "zz"<br />perl -le 'print ("a".."zz")'<br />perl -le 'print "aa".."zz"'</p><p># Create a hex lookup table<br />@hex = (0..9, "a".."f")</p><p># Convert a decimal number to hex using @hex lookup table<br />perl -le '$num = 255; @hex = (0..9, "a".."f"); while ($num) { $s = $hex[($num%16)&amp;15].$s; $num = int $num/16 } print $s'<br />perl -le '$hex = sprintf("%x", 255); print $hex'<br />perl -le '$num = "ff"; print hex $num'</p><p># Generate a random 8 character password<br />perl -le 'print map { ("a".."z")[rand 26] } 1..8'<br />perl -le 'print map { ("a".."z", 0..9)[rand 36] } 1..8'</p><p># Create a string of specific length<br />perl -le 'print "a"x50'</p><p># Create a repeated list of elements<br />perl -le '@list = (1,2)x20; print "@list"'</p><p># Create an array from a string<br />@months = split ' ', "Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec"<br />@months = qw/Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec/</p><p># Create a string from an array<br />@stuff = ("hello", 0..9, "world"); $string = join '-', @stuff</p><p># Find the numeric values for characters in the string<br />perl -le 'print join ", ", map { ord } split //, "hello world"'</p><p># Convert a list of numeric ASCII values into a string<br />perl -le '@ascii = (99, 111, 100, 105, 110, 103); print pack("C*", @ascii)'<br />perl -le '@ascii = (99, 111, 100, 105, 110, 103); print map { chr } @ascii'</p><p># Generate an array with odd numbers from 1 to 100<br />perl -le '@odd = grep {$_ % 2 == 1} 1..100; print "@odd"'<br />perl -le '@odd = grep { $_ &amp; 1 } 1..100; print "@odd"'</p><p># Generate an array with even numbers from 1 to 100<br />perl -le '@even = grep {$_ % 2 == 0} 1..100; print "@even"'</p><p># Find the length of the string<br />perl -le 'print length "one-liners are great"'</p><p># Find the number of elements in an array<br />perl -le '@array = ("a".."z"); print scalar @array'<br />perl -le '@array = ("a".."z"); print $#array + 1'</p><p><br />TEXT CONVERSION AND SUBSTITUTION<br />--------------------------------</p><p># ROT13 a string<br />'y/A-Za-z/N-ZA-Mn-za-m/'</p><p># ROT 13 a file<br />perl -lpe 'y/A-Za-z/N-ZA-Mn-za-m/' file</p><p># Base64 encode a string<br />perl -MMIME::Base64 -e 'print encode_base64("string")'<br />perl -MMIME::Base64 -0777 -ne 'print encode_base64($_)' file</p><p># Base64 decode a string<br />perl -MMIME::Base64 -le 'print decode_base64("base64string")'<br />perl -MMIME::Base64 -ne 'print decode_base64($_)' file</p><p># URL-escape a string<br />perl -MURI::Escape -le 'print uri_escape($string)'</p><p># URL-unescape a string<br />perl -MURI::Escape -le 'print uri_unescape($string)'</p><p># HTML-encode a string<br />perl -MHTML::Entities -le 'print encode_entities($string)'</p><p># HTML-decode a string<br />perl -MHTML::Entities -le 'print decode_entities($string)'</p><p># Convert all text to uppercase<br />perl -nle 'print uc'<br />perl -ple '$_=uc'<br />perl -nle 'print "\U$_"'</p><p># Convert all text to lowercase<br />perl -nle 'print lc'<br />perl -ple '$_=lc'<br />perl -nle 'print "\L$_"'</p><p># Uppercase only the first word of each line<br />perl -nle 'print ucfirst lc'<br />perl -nle 'print "\u\L$_"'</p><p># Invert the letter case<br />perl -ple 'y/A-Za-z/a-zA-Z/'</p><p># Camel case each line<br />perl -ple 's/(\w+)/\u$1/g'<br />perl -ple 's/(?&lt;!['])(\w+)/\u\1/g'</p><p># Strip leading whitespace (spaces, tabs) from the beginning of each line<br />perl -ple 's/^[ \t]+//'<br />perl -ple 's/^\s+//'</p><p># Strip trailing whitespace (space, tabs) from the end of each line<br />perl -ple 's/[ \t]+$//'</p><p># Strip whitespace from the beginning and end of each line<br />perl -ple 's/^[ \t]+|[ \t]+$//g'</p><p># Convert UNIX newlines to DOS/Windows newlines<br />perl -pe 's|\n|\r\n|'</p><p># Convert DOS/Windows newlines to UNIX newlines<br />perl -pe 's|\r\n|\n|'</p><p># Convert UNIX newlines to Mac newlines<br />perl -pe 's|\n|\r|'</p><p># Substitute (find and replace) "foo" with "bar" on each line<br />perl -pe 's/foo/bar/'</p><p># Substitute (find and replace) all "foo"s with "bar" on each line<br />perl -pe 's/foo/bar/g'</p><p># Substitute (find and replace) "foo" with "bar" on lines that match "baz"<br />perl -pe '/baz/ &amp;&amp; s/foo/bar/'</p><p># Binary patch a file (find and replace a given array of bytes as hex numbers)<br />perl -pi -e 's/\x89\xD8\x48\x8B/\x90\x90\x48\x8B/g' file</p><p><br />SELECTIVE PRINTING AND DELETING OF CERTAIN LINES<br />------------------------------------------------</p><p># Print the first line of a file (emulate head -1)<br />perl -ne 'print; exit'</p><p># Print the first 10 lines of a file (emulate head -10)<br />perl -ne 'print if $. &lt;= 10'<br />perl -ne '$. &lt;= 10 &amp;&amp; print'<br />perl -ne 'print if 1..10'</p><p># Print the last line of a file (emulate tail -1)<br />perl -ne '$last = $_; END { print $last }'<br />perl -ne 'print if eof'</p><p># Print the last 10 lines of a file (emulate tail -10)<br />perl -ne 'push @a, $_; @a = @a[@a-10..$#a]; END { print @a }'</p><p># Print only lines that match a regular expression<br />perl -ne '/regex/ &amp;&amp; print'</p><p># Print only lines that do not match a regular expression<br />perl -ne '!/regex/ &amp;&amp; print'</p><p># Print the line before a line that matches a regular expression<br />perl -ne '/regex/ &amp;&amp; $last &amp;&amp; print $last; $last = $_'</p><p># Print the line after a line that matches a regular expression<br />perl -ne 'if ($p) { print; $p = 0 } $p++ if /regex/'</p><p># Print lines that match regex AAA and regex BBB in any order<br />perl -ne '/AAA/ &amp;&amp; /BBB/ &amp;&amp; print'</p><p># Print lines that don't match match regexes AAA and BBB<br />perl -ne '!/AAA/ &amp;&amp; !/BBB/ &amp;&amp; print'</p><p># Print lines that match regex AAA followed by regex BBB followed by CCC<br />perl -ne '/AAA.*BBB.*CCC/ &amp;&amp; print'</p><p># Print lines that are 80 chars or longer<br />perl -ne 'print if length &gt;= 80'</p><p># Print lines that are less than 80 chars in length<br />perl -ne 'print if length &lt; 80'</p><p># Print only line 13<br />perl -ne '$. == 13 &amp;&amp; print &amp;&amp; exit'</p><p># Print all lines except line 27<br />perl -ne '$. != 27 &amp;&amp; print'<br />perl -ne 'print if $. != 27'</p><p># Print only lines 13, 19 and 67<br />perl -ne 'print if $. == 13 || $. == 19 || $. == 67'<br />perl -ne 'print if int($.) ~~ (13, 19, 67)'</p><p># Print all lines between two regexes (including lines that match regex)<br />perl -ne 'print if /regex1/../regex2/'</p><p># Print all lines from line 17 to line 30<br />perl -ne 'print if $. &gt;= 17 &amp;&amp; $. &lt;= 30'<br />perl -ne 'print if int($.) ~~ (17..30)'<br />perl -ne 'print if grep { $_ == $. } 17..30'</p><p># Print the longest line<br />perl -ne '$l = $_ if length($_) &gt; length($l); END { print $l }'</p><p># Print the shortest line<br />perl -ne '$s = $_ if $. == 1; $s = $_ if length($_) &lt; length($s); END { print $s }'</p><p># Print all lines that contain a number<br />perl -ne 'print if /\d/'</p><p># Find all lines that contain only a number<br />perl -ne 'print if /^\d+$/'</p><p># Print all lines that contain only characters<br />perl -ne 'print if /^[[:alpha:]]+$/</p><p># Print every second line<br />perl -ne 'print if $. % 2'</p><p># Print every second line, starting the second line<br />perl -ne 'print if $. % 2 == 0'</p><p># Print all lines that repeat<br />perl -ne 'print if ++$a{$_} == 2'</p><p># Print all unique lines<br />perl -ne 'print unless $a{$_}++'</p><p># Print the first field (word) of every line (emulate cut -f 1 -d ' ')<br />perl -alne 'print $F[0]'</p><p><br />HANDY REGULAR EXPRESSIONS<br />-------------------------</p><p># Match something that looks like an IP address<br />/^\d{1,3}\.\d{1,3}\.\d{1,3}\.\d{1,3}$/<br />/^(\d{1,3}\.){3}\d{1,3}$/</p><p># Test if a number is in range 0-255<br />/^([0-9]|[0-9][0-9]|1[0-9][0-9]|2[0-4][0-9]|25[0-5])$/</p><p># Match an IP address<br />my $ip_part = qr|([0-9]|[0-9][0-9]|1[0-9][0-9]|2[0-4][0-9]|25[0-5])|;<br />if ($ip =~ /^($ip_part\.){3}$ip_part$/) {<br /> say "valid ip";<br />}</p><p># Check if the string looks like an email address<br />/\S+@\S+\.\S+/</p><p># Check if the string is a decimal number<br />/^\d+$/<br />/^[+-]?\d+$/<br />/^[+-]?\d+\.?\d*$/</p><p># Check if the string is a hexadecimal number<br />/^0x[0-9a-f]+$/i</p><p># Check if the string is an octal number<br />/^0[0-7]+$/</p><p># Check if the string is binary<br />/^[01]+$/</p><p># Check if a word appears twice in the string<br />/(word).*\1/</p><p># Increase all numbers by one in the string<br />$str =~ s/(\d+)/$1+1/ge</p><p># Extract HTTP User-Agent string from the HTTP headers<br />/^User-Agent: (.+)$/</p><p># Match printable ASCII characters<br />/[ -~]/</p><p># Match unprintable ASCII characters<br />/[^ -~]/</p><p># Match text between two HTML tags<br />m|&lt;strong&gt;([^&lt;]*)&lt;/strong&gt;|<br />m|&lt;strong&gt;(.*?)&lt;/strong&gt;|</p><p># Replace all &lt;b&gt; tags with &lt;strong&gt;<br />$html =~ s|&lt;(/)?b&gt;|&lt;$1strong&gt;|g</p><p># Extract all matches from a regular expression<br />my @matches = $text =~ /regex/g;</p><p><br />PERL TRICKS<br />-----------</p><p># Print the version of a Perl module<br />perl -MModule -le 'print $Module::VERSION'<br />perl -MLWP::UserAgent -le 'print $LWP::UserAgent::VERSION'</p>]]></description>
	<dc:creator>Shruti Paniwala</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43683/genview-a-phylogeny-based-comparative-genomics-software-to-analyze-the-genetic-environment-of-genes</guid>
	<pubDate>Tue, 28 Dec 2021 01:49:03 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43683/genview-a-phylogeny-based-comparative-genomics-software-to-analyze-the-genetic-environment-of-genes</link>
	<title><![CDATA[GEnView: A phylogeny based comparative genomics software to analyze the genetic environment of genes]]></title>
	<description><![CDATA[<p><span>A phylogeny based comparative genomics software to analyze the genetic environment of genes. The user can select one or several taxa and provide one or several reference protein(s). Genomes and plasmids (based on user choice) will be downloaded from the NCBI Assembly/NR database and searched for the respective gene. Alternatively, custom genomes can be provided. User selected stretches (20kbp by default) of the genes genetic environment are extracted, annotated and aligned between all genomes. The sequences are then visualized, enabling comparison of synteny and gene content.</span></p>
<p><span>More at&nbsp;https://pubmed.ncbi.nlm.nih.gov/34951622/</span></p><p>Address of the bookmark: <a href="https://github.com/EbmeyerSt/GEnView" rel="nofollow">https://github.com/EbmeyerSt/GEnView</a></p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36497/installing-python-numpy</guid>
	<pubDate>Mon, 07 May 2018 04:31:25 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36497/installing-python-numpy</link>
	<title><![CDATA[Installing  python-numpy !]]></title>
	<description><![CDATA[<p>$ sudo apt-get install python-numpy python-scipy python-matplotlib ipython ipython-notebook python-pandas python-sympy python-nose<br />[sudo] password for urbe: <br />Reading package lists... Done<br />Building dependency tree <br />Reading state information... Done<br />The following packages were automatically installed and are no longer required:<br /> bridge-utils containerd linux-headers-4.4.0-116 linux-headers-4.4.0-116-generic linux-headers-4.4.0-21 linux-headers-4.4.0-21-generic<br /> linux-image-4.4.0-116-generic linux-image-4.4.0-21-generic linux-image-extra-4.4.0-116-generic linux-image-extra-4.4.0-21-generic<br /> linux-signed-image-4.4.0-116-generic runc ubuntu-fan<br />Use 'sudo apt autoremove' to remove them.<br />The following additional packages will be installed:<br /> blt fonts-lyx fonts-mathjax ipython-notebook-common isympy libaec0 libamd2.4.1 libdsdp-5.8gf libglpk36 libgsl2 libhdf5-10 libjs-highlight<br /> libjs-highlight.js libjs-jquery-ui libjs-marked libjs-mathjax libjs-underscore libsz2 python-antlr python-bs4 python-chardet python-cvxopt<br /> python-cycler python-dateutil python-decorator python-glade2 python-gmpy python-html5lib python-imaging python-jdcal python-jinja2 python-joblib<br /> python-lxml python-markupsafe python-matplotlib-data python-mpmath python-numexpr python-openpyxl python-pandas-lib python-patsy python-pexpect<br /> python-pil python-ptyprocess python-py python-pycurl python-pyglet python-pymysql python-pyparsing python-pytest python-simplegeneric<br /> python-simplejson python-statsmodels python-statsmodels-lib python-sympy-doc python-tables python-tables-data python-tables-lib python-tk<br /> python-tornado python-tz python-xlrd python-xlwt python-zmq tk8.6-blt2.5 ttf-bitstream-vera<br />Suggested packages:<br /> blt-demo ipython-doc ipython-qtconsole python-pygments nodejs pandoc libiodbc2-dev libmysqlclient-dev gsl-ref-psdoc | gsl-doc-pdf | gsl-doc-info<br /> | gsl-ref-html libjs-jquery-ui-docs fonts-mathjax-extras libjs-mathjax-doc python-gtk2-doc python-genshi python-jinja2-doc python-lxml-dbg<br /> python-lxml-doc ffmpeg inkscape python-cairocffi python-configobj python-excelerator python-matplotlib-doc python-qt4 python-sip python-traits<br /> python-wxgtk3.0 ttf-staypuft python-gmpy2 python-mpmath-doc python-coverage python-nose-doc python-numpy-dbg python-numpy-doc python-pandas-doc<br /> python-patsy-doc python-pexpect-doc python-pil-doc python-pil-dbg subversion python-pytest-xdist libcurl4-gnutls-dev python-pycurl-dbg<br /> python-pycurl-doc python-pymysql-doc python-mock python-scipy-doc python-statsmodels-doc python-tables-doc python-netcdf vitables tix<br /> python-tk-dbg<br />The following NEW packages will be installed:<br /> blt fonts-lyx fonts-mathjax ipython ipython-notebook ipython-notebook-common isympy libaec0 libamd2.4.1 libdsdp-5.8gf libglpk36 libgsl2<br /> libhdf5-10 libjs-highlight libjs-highlight.js libjs-jquery-ui libjs-marked libjs-mathjax libjs-underscore libsz2 python-antlr python-bs4<br /> python-chardet python-cvxopt python-cycler python-dateutil python-decorator python-glade2 python-gmpy python-html5lib python-imaging<br /> python-jdcal python-jinja2 python-joblib python-lxml python-markupsafe python-matplotlib python-matplotlib-data python-mpmath python-nose<br /> python-numexpr python-numpy python-openpyxl python-pandas python-pandas-lib python-patsy python-pexpect python-pil python-ptyprocess python-py<br /> python-pycurl python-pyglet python-pymysql python-pyparsing python-pytest python-scipy python-simplegeneric python-simplejson python-statsmodels<br /> python-statsmodels-lib python-sympy python-sympy-doc python-tables python-tables-data python-tables-lib python-tk python-tornado python-tz<br /> python-xlrd python-xlwt python-zmq tk8.6-blt2.5 ttf-bitstream-vera<br />0 upgraded, 73 newly installed, 0 to remove and 35 not upgraded.<br />Need to get 49,5 MB of archives.<br />After this operation, 271 MB of additional disk space will be used.<br />Do you want to continue? [Y/n] Y<br />Get:1 http://be.archive.ubuntu.com/ubuntu xenial-updates/main amd64 python-pymysql all 0.7.2-1ubuntu1 [56,4 kB]<br />Get:2 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 tk8.6-blt2.5 amd64 2.5.3+dfsg-3 [574 kB]<br />Get:3 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 blt amd64 2.5.3+dfsg-3 [4.852 B]<br />Get:4 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 fonts-lyx all 2.1.4-2 [161 kB]<br />Get:5 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 fonts-mathjax all 2.6.1-1 [960 kB]<br />Get:6 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-decorator all 4.0.6-1 [9.326 B]<br />Get:7 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-ptyprocess all 0.5-1 [12,9 kB]<br />Get:8 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-pexpect all 4.0.1-1 [40,5 kB]<br />Get:9 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-simplegeneric all 0.8.1-1 [11,5 kB]<br />Get:10 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 ipython all 2.4.1-1 [610 kB]<br />Get:11 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 libjs-highlight.js all 8.2+ds-4build1 [151 kB]<br />Get:12 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 libjs-highlight all 8.2+ds-4build1 [7.032 B]<br />Get:13 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 libjs-jquery-ui all 1.10.1+dfsg-1 [458 kB]<br />Get:14 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 libjs-marked all 0.3.2+dfsg-1 [12,7 kB]<br />Get:15 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 libjs-mathjax all 2.6.1-1 [5.601 kB]<br />Get:16 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 libjs-underscore all 1.7.0~dfsg-1ubuntu1 [46,7 kB]<br />Get:17 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 ipython-notebook-common all 2.4.1-1 [712 kB]<br />Get:18 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-markupsafe amd64 0.23-2build2 [15,5 kB]<br />Get:19 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-jinja2 all 2.8-1 [109 kB]<br />Get:20 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-pycurl amd64 7.43.0-1ubuntu1 [43,3 kB]<br />Get:21 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-tornado amd64 4.2.1-1ubuntu3 [273 kB]<br />Get:22 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-zmq amd64 15.2.0-0ubuntu4 [200 kB]<br />Get:23 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 ipython-notebook all 2.4.1-1 [48,4 kB]<br />Get:24 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 isympy all 0.7.6.1-1 [82,5 kB]<br />Get:25 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 libaec0 amd64 0.3.2-1 [18,0 kB]<br />Get:26 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 libamd2.4.1 amd64 1:4.4.6-1 [21,3 kB]<br />Get:27 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 libglpk36 amd64 4.57-1build3 [386 kB]<br />Get:28 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 libgsl2 amd64 2.1+dfsg-2 [840 kB]<br />Get:29 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 libsz2 amd64 0.3.2-1 [5.048 B]<br />Get:30 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 libhdf5-10 amd64 1.8.16+docs-4ubuntu1 [995 kB]<br />Get:31 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-antlr all 2.7.7+dfsg-6ubuntu1 [19,0 kB]<br />Get:32 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-bs4 all 4.4.1-1 [64,2 kB]<br />Get:33 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-chardet all 2.3.0-2 [96,3 kB]<br />Get:34 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 libdsdp-5.8gf amd64 5.8-9.1ubuntu2 [192 kB]<br />Get:35 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-cvxopt amd64 1.1.4-1.4 [1.344 kB]<br />Get:36 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-cycler all 0.9.0-1 [5.426 B]<br />Get:37 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-dateutil all 2.4.2-1 [42,5 kB]<br />Get:38 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-glade2 amd64 2.24.0-4ubuntu1 [9.078 B]<br />Get:39 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-gmpy amd64 1.17-1 [91,1 kB]<br />Get:40 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-html5lib all 0.999-4 [83,1 kB]<br />Get:41 http://be.archive.ubuntu.com/ubuntu xenial-updates/main amd64 python-pil amd64 3.1.2-0ubuntu1.1 [312 kB]<br />Get:42 http://be.archive.ubuntu.com/ubuntu xenial-updates/universe amd64 python-imaging all 3.1.2-0ubuntu1.1 [4.596 B]<br />Get:43 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-jdcal all 1.0-1build1 [7.702 B]<br />Get:44 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-joblib all 0.9.4-1 [74,6 kB]<br />Get:45 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-lxml amd64 3.5.0-1build1 [819 kB]<br />Get:46 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 ttf-bitstream-vera all 1.10-8 [352 kB]<br />Get:47 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-matplotlib-data all 1.5.1-1ubuntu1 [2.414 kB]<br />Get:48 http://be.archive.ubuntu.com/ubuntu xenial-updates/main amd64 python-pyparsing all 2.0.3+dfsg1-1ubuntu0.1 [35,4 kB]<br />Get:49 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-tz all 2014.10~dfsg1-0ubuntu2 [31,5 kB]<br />Get:50 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-numpy amd64 1:1.11.0-1ubuntu1 [1.763 kB]<br />Get:51 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-matplotlib amd64 1.5.1-1ubuntu1 [3.888 kB]<br />Get:52 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-mpmath all 0.19-3 [387 kB]<br />Get:53 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-nose all 1.3.7-1 [116 kB]<br />Get:54 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-numexpr amd64 2.4.3-1ubuntu1 [129 kB]<br />Get:55 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-openpyxl all 2.3.0-1 [193 kB]<br />Get:56 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-pandas-lib amd64 0.17.1-3ubuntu2 [1.538 kB]<br />Get:57 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-pandas all 0.17.1-3ubuntu2 [2.386 kB]<br />Get:58 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-patsy all 0.4.1-2 [169 kB]<br />Get:59 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-py all 1.4.31-1 [62,5 kB]<br />Get:60 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-pyglet all 1.1.4.dfsg-3 [726 kB]<br />Get:61 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-pytest all 2.8.7-4 [119 kB]<br />Get:62 http://be.archive.ubuntu.com/ubuntu xenial/main amd64 python-simplejson amd64 3.8.1-1ubuntu2 [60,4 kB]<br />Get:63 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-sympy all 0.7.6.1-1 [2.252 kB]<br />Get:64 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-sympy-doc all 0.7.6.1-1 [4.774 kB]<br />Get:65 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-tables-lib amd64 3.2.2-2 [353 kB]<br />Get:66 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-tables-data all 3.2.2-2 [45,3 kB]<br />Get:67 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-tables all 3.2.2-2 [335 kB]<br />Get:68 http://be.archive.ubuntu.com/ubuntu xenial-updates/main amd64 python-tk amd64 2.7.12-1~16.04 [26,3 kB]<br />Get:69 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-xlrd all 0.9.4-1 [107 kB]<br />Get:70 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-xlwt all 0.7.5+debian1-1 [83,5 kB]<br />Get:71 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-scipy amd64 0.17.0-1 [8.733 kB]<br />Get:72 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-statsmodels-lib amd64 0.6.1-4 [173 kB]<br />Get:73 http://be.archive.ubuntu.com/ubuntu xenial/universe amd64 python-statsmodels all 0.6.1-4 [2.581 kB]<br />Fetched 49,5 MB in 0s (52,8 MB/s) <br />Extracting templates from packages: 100%<br />Selecting previously unselected package python-pymysql.<br />(Reading database ... 435155 files and directories currently installed.)<br />Preparing to unpack .../python-pymysql_0.7.2-1ubuntu1_all.deb ...<br />Unpacking python-pymysql (0.7.2-1ubuntu1) ...<br />Selecting previously unselected package tk8.6-blt2.5.<br />Preparing to unpack .../tk8.6-blt2.5_2.5.3+dfsg-3_amd64.deb ...<br />Unpacking tk8.6-blt2.5 (2.5.3+dfsg-3) ...<br />Selecting previously unselected package blt.<br />Preparing to unpack .../blt_2.5.3+dfsg-3_amd64.deb ...<br />Unpacking blt (2.5.3+dfsg-3) ...<br />Selecting previously unselected package fonts-lyx.<br />Preparing to unpack .../fonts-lyx_2.1.4-2_all.deb ...<br />Unpacking fonts-lyx (2.1.4-2) ...<br />Selecting previously unselected package fonts-mathjax.<br />Preparing to unpack .../fonts-mathjax_2.6.1-1_all.deb ...<br />Unpacking fonts-mathjax (2.6.1-1) ...<br />Selecting previously unselected package python-decorator.<br />Preparing to unpack .../python-decorator_4.0.6-1_all.deb ...<br />Unpacking python-decorator (4.0.6-1) ...<br />Selecting previously unselected package python-ptyprocess.<br />Preparing to unpack .../python-ptyprocess_0.5-1_all.deb ...<br />Unpacking python-ptyprocess (0.5-1) ...<br />Selecting previously unselected package python-pexpect.<br />Preparing to unpack .../python-pexpect_4.0.1-1_all.deb ...<br />Unpacking python-pexpect (4.0.1-1) ...<br />Selecting previously unselected package python-simplegeneric.<br />Preparing to unpack .../python-simplegeneric_0.8.1-1_all.deb ...<br />Unpacking python-simplegeneric (0.8.1-1) ...<br />Selecting previously unselected package ipython.<br />Preparing to unpack .../ipython_2.4.1-1_all.deb ...<br />Unpacking ipython (2.4.1-1) ...<br />Selecting previously unselected package libjs-highlight.js.<br />Preparing to unpack .../libjs-highlight.js_8.2+ds-4build1_all.deb ...<br />Unpacking libjs-highlight.js (8.2+ds-4build1) ...<br />Selecting previously unselected package libjs-highlight.<br />Preparing to unpack .../libjs-highlight_8.2+ds-4build1_all.deb ...<br />Unpacking libjs-highlight (8.2+ds-4build1) ...<br />Selecting previously unselected package libjs-jquery-ui.<br />Preparing to unpack .../libjs-jquery-ui_1.10.1+dfsg-1_all.deb ...<br />Unpacking libjs-jquery-ui (1.10.1+dfsg-1) ...<br />Selecting previously unselected package libjs-marked.<br />Preparing to unpack .../libjs-marked_0.3.2+dfsg-1_all.deb ...<br />Unpacking libjs-marked (0.3.2+dfsg-1) ...<br />Selecting previously unselected package libjs-mathjax.<br />Preparing to unpack .../libjs-mathjax_2.6.1-1_all.deb ...<br />Unpacking libjs-mathjax (2.6.1-1) ...<br />Selecting previously unselected package libjs-underscore.<br />Preparing to unpack .../libjs-underscore_1.7.0~dfsg-1ubuntu1_all.deb ...<br />Unpacking libjs-underscore (1.7.0~dfsg-1ubuntu1) ...<br />Selecting previously unselected package ipython-notebook-common.<br />Preparing to unpack .../ipython-notebook-common_2.4.1-1_all.deb ...<br />Unpacking ipython-notebook-common (2.4.1-1) ...<br />Selecting previously unselected package python-markupsafe.<br />Preparing to unpack .../python-markupsafe_0.23-2build2_amd64.deb ...<br />Unpacking python-markupsafe (0.23-2build2) ...<br />Selecting previously unselected package python-jinja2.<br />Preparing to unpack .../python-jinja2_2.8-1_all.deb ...<br />Unpacking python-jinja2 (2.8-1) ...<br />Selecting previously unselected package python-pycurl.<br />Preparing to unpack .../python-pycurl_7.43.0-1ubuntu1_amd64.deb ...<br />Unpacking python-pycurl (7.43.0-1ubuntu1) ...<br />Selecting previously unselected package python-tornado.<br />Preparing to unpack .../python-tornado_4.2.1-1ubuntu3_amd64.deb ...<br />Unpacking python-tornado (4.2.1-1ubuntu3) ...<br />Selecting previously unselected package python-zmq.<br />Preparing to unpack .../python-zmq_15.2.0-0ubuntu4_amd64.deb ...<br />Unpacking python-zmq (15.2.0-0ubuntu4) ...<br />Selecting previously unselected package ipython-notebook.<br />Preparing to unpack .../ipython-notebook_2.4.1-1_all.deb ...<br />Unpacking ipython-notebook (2.4.1-1) ...<br />Selecting previously unselected package isympy.<br />Preparing to unpack .../isympy_0.7.6.1-1_all.deb ...<br />Unpacking isympy (0.7.6.1-1) ...<br />Selecting previously unselected package libaec0:amd64.<br />Preparing to unpack .../libaec0_0.3.2-1_amd64.deb ...<br />Unpacking libaec0:amd64 (0.3.2-1) ...<br />Selecting previously unselected package libamd2.4.1:amd64.<br />Preparing to unpack .../libamd2.4.1_1%3a4.4.6-1_amd64.deb ...<br />Unpacking libamd2.4.1:amd64 (1:4.4.6-1) ...<br />Selecting previously unselected package libglpk36:amd64.<br />Preparing to unpack .../libglpk36_4.57-1build3_amd64.deb ...<br />Unpacking libglpk36:amd64 (4.57-1build3) ...<br />Selecting previously unselected package libgsl2:amd64.<br />Preparing to unpack .../libgsl2_2.1+dfsg-2_amd64.deb ...<br />Unpacking libgsl2:amd64 (2.1+dfsg-2) ...<br />Selecting previously unselected package libsz2:amd64.<br />Preparing to unpack .../libsz2_0.3.2-1_amd64.deb ...<br />Unpacking libsz2:amd64 (0.3.2-1) ...<br />Selecting previously unselected package libhdf5-10:amd64.<br />Preparing to unpack .../libhdf5-10_1.8.16+docs-4ubuntu1_amd64.deb ...<br />Unpacking libhdf5-10:amd64 (1.8.16+docs-4ubuntu1) ...<br />Selecting previously unselected package python-antlr.<br />Preparing to unpack .../python-antlr_2.7.7+dfsg-6ubuntu1_all.deb ...<br />Unpacking python-antlr (2.7.7+dfsg-6ubuntu1) ...<br />Selecting previously unselected package python-bs4.<br />Preparing to unpack .../python-bs4_4.4.1-1_all.deb ...<br />Unpacking python-bs4 (4.4.1-1) ...<br />Selecting previously unselected package python-chardet.<br />Preparing to unpack .../python-chardet_2.3.0-2_all.deb ...<br />Unpacking python-chardet (2.3.0-2) ...<br />Selecting previously unselected package libdsdp-5.8gf.<br />Preparing to unpack .../libdsdp-5.8gf_5.8-9.1ubuntu2_amd64.deb ...<br />Unpacking libdsdp-5.8gf (5.8-9.1ubuntu2) ...<br />Selecting previously unselected package python-cvxopt.<br />Preparing to unpack .../python-cvxopt_1.1.4-1.4_amd64.deb ...<br />Unpacking python-cvxopt (1.1.4-1.4) ...<br />Selecting previously unselected package python-cycler.<br />Preparing to unpack .../python-cycler_0.9.0-1_all.deb ...<br />Unpacking python-cycler (0.9.0-1) ...<br />Selecting previously unselected package python-dateutil.<br />Preparing to unpack .../python-dateutil_2.4.2-1_all.deb ...<br />Unpacking python-dateutil (2.4.2-1) ...<br />Selecting previously unselected package python-glade2.<br />Preparing to unpack .../python-glade2_2.24.0-4ubuntu1_amd64.deb ...<br />Unpacking python-glade2 (2.24.0-4ubuntu1) ...<br />Selecting previously unselected package python-gmpy.<br />Preparing to unpack .../python-gmpy_1.17-1_amd64.deb ...<br />Unpacking python-gmpy (1.17-1) ...<br />Selecting previously unselected package python-html5lib.<br />Preparing to unpack .../python-html5lib_0.999-4_all.deb ...<br />Unpacking python-html5lib (0.999-4) ...<br />Selecting previously unselected package python-pil:amd64.<br />Preparing to unpack .../python-pil_3.1.2-0ubuntu1.1_amd64.deb ...<br />Unpacking python-pil:amd64 (3.1.2-0ubuntu1.1) ...<br />Selecting previously unselected package python-imaging.<br />Preparing to unpack .../python-imaging_3.1.2-0ubuntu1.1_all.deb ...<br />Unpacking python-imaging (3.1.2-0ubuntu1.1) ...<br />Selecting previously unselected package python-jdcal.<br />Preparing to unpack .../python-jdcal_1.0-1build1_all.deb ...<br />Unpacking python-jdcal (1.0-1build1) ...<br />Selecting previously unselected package python-joblib.<br />Preparing to unpack .../python-joblib_0.9.4-1_all.deb ...<br />Unpacking python-joblib (0.9.4-1) ...<br />Selecting previously unselected package python-lxml.<br />Preparing to unpack .../python-lxml_3.5.0-1build1_amd64.deb ...<br />Unpacking python-lxml (3.5.0-1build1) ...<br />Selecting previously unselected package ttf-bitstream-vera.<br />Preparing to unpack .../ttf-bitstream-vera_1.10-8_all.deb ...<br />Unpacking ttf-bitstream-vera (1.10-8) ...<br />Selecting previously unselected package python-matplotlib-data.<br />Preparing to unpack .../python-matplotlib-data_1.5.1-1ubuntu1_all.deb ...<br />Unpacking python-matplotlib-data (1.5.1-1ubuntu1) ...<br />Selecting previously unselected package python-pyparsing.<br />Preparing to unpack .../python-pyparsing_2.0.3+dfsg1-1ubuntu0.1_all.deb ...<br />Unpacking python-pyparsing (2.0.3+dfsg1-1ubuntu0.1) ...<br />Selecting previously unselected package python-tz.<br />Preparing to unpack .../python-tz_2014.10~dfsg1-0ubuntu2_all.deb ...<br />Unpacking python-tz (2014.10~dfsg1-0ubuntu2) ...<br />Selecting previously unselected package python-numpy.<br />Preparing to unpack .../python-numpy_1%3a1.11.0-1ubuntu1_amd64.deb ...<br />Unpacking python-numpy (1:1.11.0-1ubuntu1) ...<br />Selecting previously unselected package python-matplotlib.<br />Preparing to unpack .../python-matplotlib_1.5.1-1ubuntu1_amd64.deb ...<br />Unpacking python-matplotlib (1.5.1-1ubuntu1) ...<br />Selecting previously unselected package python-mpmath.<br />Preparing to unpack .../python-mpmath_0.19-3_all.deb ...<br />Unpacking python-mpmath (0.19-3) ...<br />Selecting previously unselected package python-nose.<br />Preparing to unpack .../python-nose_1.3.7-1_all.deb ...<br />Unpacking python-nose (1.3.7-1) ...<br />Selecting previously unselected package python-numexpr.<br />Preparing to unpack .../python-numexpr_2.4.3-1ubuntu1_amd64.deb ...<br />Unpacking python-numexpr (2.4.3-1ubuntu1) ...<br />Selecting previously unselected package python-openpyxl.<br />Preparing to unpack .../python-openpyxl_2.3.0-1_all.deb ...<br />Unpacking python-openpyxl (2.3.0-1) ...<br />Selecting previously unselected package python-pandas-lib.<br />Preparing to unpack .../python-pandas-lib_0.17.1-3ubuntu2_amd64.deb ...<br />Unpacking python-pandas-lib (0.17.1-3ubuntu2) ...<br />Selecting previously unselected package python-pandas.<br />Preparing to unpack .../python-pandas_0.17.1-3ubuntu2_all.deb ...<br />Unpacking python-pandas (0.17.1-3ubuntu2) ...<br />Selecting previously unselected package python-patsy.<br />Preparing to unpack .../python-patsy_0.4.1-2_all.deb ...<br />Unpacking python-patsy (0.4.1-2) ...<br />Selecting previously unselected package python-py.<br />Preparing to unpack .../python-py_1.4.31-1_all.deb ...<br />Unpacking python-py (1.4.31-1) ...<br />Selecting previously unselected package python-pyglet.<br />Preparing to unpack .../python-pyglet_1.1.4.dfsg-3_all.deb ...<br />Unpacking python-pyglet (1.1.4.dfsg-3) ...<br />Selecting previously unselected package python-pytest.<br />Preparing to unpack .../python-pytest_2.8.7-4_all.deb ...<br />Unpacking python-pytest (2.8.7-4) ...<br />Selecting previously unselected package python-simplejson.<br />Preparing to unpack .../python-simplejson_3.8.1-1ubuntu2_amd64.deb ...<br />Unpacking python-simplejson (3.8.1-1ubuntu2) ...<br />Selecting previously unselected package python-sympy.<br />Preparing to unpack .../python-sympy_0.7.6.1-1_all.deb ...<br />Unpacking python-sympy (0.7.6.1-1) ...<br />Selecting previously unselected package python-sympy-doc.<br />Preparing to unpack .../python-sympy-doc_0.7.6.1-1_all.deb ...<br />Unpacking python-sympy-doc (0.7.6.1-1) ...<br />Selecting previously unselected package python-tables-lib.<br />Preparing to unpack .../python-tables-lib_3.2.2-2_amd64.deb ...<br />Unpacking python-tables-lib (3.2.2-2) ...<br />Selecting previously unselected package python-tables-data.<br />Preparing to unpack .../python-tables-data_3.2.2-2_all.deb ...<br />Unpacking python-tables-data (3.2.2-2) ...<br />Selecting previously unselected package python-tables.<br />Preparing to unpack .../python-tables_3.2.2-2_all.deb ...<br />Unpacking python-tables (3.2.2-2) ...<br />Selecting previously unselected package python-tk.<br />Preparing to unpack .../python-tk_2.7.12-1~16.04_amd64.deb ...<br />Unpacking python-tk (2.7.12-1~16.04) ...<br />Selecting previously unselected package python-xlrd.<br />Preparing to unpack .../python-xlrd_0.9.4-1_all.deb ...<br />Unpacking python-xlrd (0.9.4-1) ...<br />Selecting previously unselected package python-xlwt.<br />Preparing to unpack .../python-xlwt_0.7.5+debian1-1_all.deb ...<br />Unpacking python-xlwt (0.7.5+debian1-1) ...<br />Selecting previously unselected package python-scipy.<br />Preparing to unpack .../python-scipy_0.17.0-1_amd64.deb ...<br />Unpacking python-scipy (0.17.0-1) ...<br />Selecting previously unselected package python-statsmodels-lib.<br />Preparing to unpack .../python-statsmodels-lib_0.6.1-4_amd64.deb ...<br />Unpacking python-statsmodels-lib (0.6.1-4) ...<br />Selecting previously unselected package python-statsmodels.<br />Preparing to unpack .../python-statsmodels_0.6.1-4_all.deb ...<br />Unpacking python-statsmodels (0.6.1-4) ...<br />Processing triggers for libc-bin (2.23-0ubuntu10) ...<br />Processing triggers for fontconfig (2.11.94-0ubuntu1.1) ...<br />Processing triggers for man-db (2.7.5-1) ...<br />Processing triggers for hicolor-icon-theme (0.15-0ubuntu1) ...<br />Processing triggers for gnome-menus (3.13.3-6ubuntu3.1) ...<br />Processing triggers for desktop-file-utils (0.22-1ubuntu5.1) ...<br />Processing triggers for mime-support (3.59ubuntu1) ...<br />Processing triggers for doc-base (0.10.7) ...<br />Processing 5 added doc-base files...<br />Setting up python-pymysql (0.7.2-1ubuntu1) ...<br />Setting up tk8.6-blt2.5 (2.5.3+dfsg-3) ...<br />Setting up blt (2.5.3+dfsg-3) ...<br />Setting up fonts-lyx (2.1.4-2) ...<br />Setting up fonts-mathjax (2.6.1-1) ...<br />Setting up python-decorator (4.0.6-1) ...<br />Setting up python-ptyprocess (0.5-1) ...<br />Setting up python-pexpect (4.0.1-1) ...<br />Setting up python-simplegeneric (0.8.1-1) ...<br />Setting up ipython (2.4.1-1) ...<br />Setting up libjs-highlight.js (8.2+ds-4build1) ...<br />Setting up libjs-highlight (8.2+ds-4build1) ...<br />Setting up libjs-jquery-ui (1.10.1+dfsg-1) ...<br />Setting up libjs-marked (0.3.2+dfsg-1) ...<br />Setting up libjs-mathjax (2.6.1-1) ...<br />Setting up libjs-underscore (1.7.0~dfsg-1ubuntu1) ...<br />Setting up ipython-notebook-common (2.4.1-1) ...<br />Setting up python-markupsafe (0.23-2build2) ...<br />Setting up python-jinja2 (2.8-1) ...<br />Setting up python-pycurl (7.43.0-1ubuntu1) ...<br />Setting up python-tornado (4.2.1-1ubuntu3) ...<br />Setting up python-zmq (15.2.0-0ubuntu4) ...<br />Setting up ipython-notebook (2.4.1-1) ...<br />Setting up isympy (0.7.6.1-1) ...<br />Setting up libaec0:amd64 (0.3.2-1) ...<br />Setting up libamd2.4.1:amd64 (1:4.4.6-1) ...<br />Setting up libglpk36:amd64 (4.57-1build3) ...<br />Setting up libgsl2:amd64 (2.1+dfsg-2) ...<br />Setting up libsz2:amd64 (0.3.2-1) ...<br />Setting up libhdf5-10:amd64 (1.8.16+docs-4ubuntu1) ...<br />Setting up python-antlr (2.7.7+dfsg-6ubuntu1) ...<br />Setting up python-bs4 (4.4.1-1) ...<br />Setting up python-chardet (2.3.0-2) ...<br />Setting up libdsdp-5.8gf (5.8-9.1ubuntu2) ...<br />Setting up python-cvxopt (1.1.4-1.4) ...<br />Setting up python-cycler (0.9.0-1) ...<br />Setting up python-dateutil (2.4.2-1) ...<br />Setting up python-glade2 (2.24.0-4ubuntu1) ...<br />Setting up python-gmpy (1.17-1) ...<br />Setting up python-html5lib (0.999-4) ...<br />Setting up python-pil:amd64 (3.1.2-0ubuntu1.1) ...<br />Setting up python-imaging (3.1.2-0ubuntu1.1) ...<br />Setting up python-jdcal (1.0-1build1) ...<br />Setting up python-joblib (0.9.4-1) ...<br />Setting up python-lxml (3.5.0-1build1) ...<br />Setting up ttf-bitstream-vera (1.10-8) ...<br />Setting up python-matplotlib-data (1.5.1-1ubuntu1) ...<br />Setting up python-pyparsing (2.0.3+dfsg1-1ubuntu0.1) ...<br />Setting up python-tz (2014.10~dfsg1-0ubuntu2) ...<br />Setting up python-numpy (1:1.11.0-1ubuntu1) ...<br />Setting up python-matplotlib (1.5.1-1ubuntu1) ...<br />Setting up python-mpmath (0.19-3) ...<br />Setting up python-nose (1.3.7-1) ...<br />Setting up python-numexpr (2.4.3-1ubuntu1) ...<br />Setting up python-openpyxl (2.3.0-1) ...<br />Setting up python-pandas-lib (0.17.1-3ubuntu2) ...<br />Setting up python-pandas (0.17.1-3ubuntu2) ...<br />Setting up python-patsy (0.4.1-2) ...<br />Setting up python-py (1.4.31-1) ...<br />Setting up python-pyglet (1.1.4.dfsg-3) ...<br />Setting up python-pytest (2.8.7-4) ...<br />Setting up python-simplejson (3.8.1-1ubuntu2) ...<br />Setting up python-sympy (0.7.6.1-1) ...<br />Setting up python-sympy-doc (0.7.6.1-1) ...<br />Setting up python-tables-lib (3.2.2-2) ...<br />Setting up python-tables-data (3.2.2-2) ...<br />Setting up python-tables (3.2.2-2) ...<br />Setting up python-tk (2.7.12-1~16.04) ...<br />Setting up python-xlrd (0.9.4-1) ...<br />Setting up python-xlwt (0.7.5+debian1-1) ...<br />Setting up python-scipy (0.17.0-1) ...<br />Setting up python-statsmodels-lib (0.6.1-4) ...<br />Setting up python-statsmodels (0.6.1-4) ...<br />Processing triggers for libc-bin (2.23-0ubuntu10) ...<br />➜ redundans git:(master) ✗ python2 redundans.py -v -i test/*_?.fq.gz -f test/contigs.fa -o test/run1<br />Options: Namespace(fasta='test/contigs.fa', fastq=['test/5000_1.fq.gz', 'test/5000_2.fq.gz', 'test/600_1.fq.gz', 'test/600_2.fq.gz'], identity=0.51, iters=2, joins=5, limit=0.2, linkratio=0.7, log=', mode 'w' at 0x7f85d1de31e0&gt;, longreads=[], mapq=10, mem=16, minLength=200, nocleaning=True, nogapclosing=True, norearrangements=False, noreduction=True, noscaffolding=True, outdir='test/run1', overlap=0.8, reference='', resume=False, threads=4, tmp='/tmp', usebwa=False, verbose=True)</p><p>##################################################<br />[Mon May 7 11:29:18 2018] Reduction...<br />#file name genome size contigs heterozygous size [%] heterozygous contigs [%] identity [%] possible joins homozygous size [%] homozygous contigs [%]<br />/usr/lib/python2.7/dist-packages/matplotlib/font_manager.py:273: UserWarning: Matplotlib is building the font cache using fc-list. This may take a moment.<br /> warnings.warn('Matplotlib is building the font cache using fc-list. This may take a moment.')<br />test/run1/contigs.fa 163897 245 66377 40.50 221 90.20 94.854 0 97520 59.50 24 9.80</p><p>##################################################<br />[Mon May 7 11:29:29 2018] Estimating parameters of libraries...<br /> Aligning 19504 mates per library...<br />Insert size statistics Mates orientation stats<br />FastQ files read length median mean stdev FF FR RF RR<br />test/5000_1.fq.gz test/5000_2.fq.gz 50 4998 4990.20 721.47 0 4674 0 0<br />test/600_1.fq.gz test/600_2.fq.gz 100 599 598.63 47.68 0 10000 0 0</p><p>##################################################<br />[Mon May 7 11:29:29 2018] Scaffolding...<br /> iteration 1.1: test/run1/contigs.reduced.fa 24 97520 39.355 17 94157 7321 2195 0 29603<br /> 19505 pairs. 17302 passed filtering [88.71%]. 1627 in different contigs [8.34%].<br /> 1526 pairs. 558 in different contigs [36.57%].<br /> iteration 1.2: test/run1/_sspace.1.1.fa 3 97626 39.344 3 97626 87536 6063 821 87536<br /> 19505 pairs. 17607 passed filtering [90.27%]. 182 in different contigs [0.93%].<br /> 1077 pairs. 124 in different contigs [11.51%].<br /> iteration 2.1: test/run1/_sspace.1.2.fa 3 97626 39.344 3 97626 87536 6063 821 87536<br /> 19505 pairs. 15112 passed filtering [77.48%]. 1295 in different contigs [6.64%].<br /> 3417 pairs. 396 in different contigs [11.59%].<br /> iteration 2.2: test/run1/_sspace.2.1.fa 1 99133 39.344 1 99133 99133 99133 2328 99133<br /> 19505 pairs. 15152 passed filtering [77.68%]. 0 in different contigs [0.00%].<br /> 3398 pairs. 0 in different contigs [0.00%].</p><p>##################################################<br />[Mon May 7 11:29:34 2018] Gap closing...<br /> iteration 1.1: test/run1/scaffolds.fa 1 99133 39.344 1 99133 99133 99133 2328 99133</p><p>##################################################<br />[Mon May 7 11:29:35 2018] Final reduction...<br />#file name genome size contigs heterozygous size [%] heterozygous contigs [%] identity [%] possible joins homozygous size [%] homozygous contigs [%]<br />[WARNING] Nothing reduced!<br />test/run1/scaffolds.filled.fa 99390 1 0 0.00 0 0.00 0.000 0 99390 100.00 1 100.00</p><p>##################################################<br />[Mon May 7 11:29:35 2018] Reporting statistics...<br />#fname contigs bases GC [%] contigs &gt;1kb bases in contigs &gt;1kb N50 N90 Ns longest<br />test/contigs.fa 245 163897 40.298 24 117391 3975 233 0 29603<br />test/run1/contigs.fa 245 163897 40.298 24 117391 3975 233 0 29603<br />test/run1/contigs.reduced.fa 24 97520 39.355 17 94157 7321 2195 0 29603<br />test/run1/_sspace.1.1.fa 3 97626 39.344 3 97626 87536 6063 821 87536<br />test/run1/_sspace.1.2.fa 3 97626 39.344 3 97626 87536 6063 821 87536<br />test/run1/_sspace.2.1.fa 1 99133 39.344 1 99133 99133 99133 2328 99133<br />test/run1/_sspace.2.2.fa 1 99133 39.344 1 99133 99133 99133 2328 99133<br />test/run1/scaffolds.fa 1 99133 39.344 1 99133 99133 99133 2328 99133<br />test/run1/_gapcloser.1.1.fa 1 99390 39.689 1 99390 99390 99390 2 99390<br />test/run1/scaffolds.filled.fa 1 99390 39.689 1 99390 99390 99390 2 99390<br />test/run1/scaffolds.reduced.fa 1 99390 39.689 1 99390 99390 99390 2 99390</p><p>##################################################<br />[Mon May 7 11:29:35 2018] Cleaning-up...<br />#Time elapsed: 0:00:17.376924</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/87/linux-cheat-sheet</guid>
	<pubDate>Tue, 09 Jul 2013 17:30:04 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/87/linux-cheat-sheet</link>
	<title><![CDATA[Linux Cheat Sheet]]></title>
	<description><![CDATA[<p><span>In an attempt to find a good Linux reference for bioinformatician and BOL readers, I was unsuccessful at finding a decent one on the Internet. So, we decided to make a cheat sheet for biological programmers.</span></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/87" length="81260" type="application/pdf" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/9030/linux-ssh-client-commands-for-bioinformatics</guid>
	<pubDate>Thu, 13 Mar 2014 17:16:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/9030/linux-ssh-client-commands-for-bioinformatics</link>
	<title><![CDATA[Linux SSH Client Commands for Bioinformatics]]></title>
	<description><![CDATA[<p>Here come on let play with the following basic command line usage of the ssh client.<br /><br /><strong>1. Check your SSH Client Version:</strong><br /><br />Checking for your SSH client is very sare, but sometimes it may be necessary to identify the SSH client that you are currently running and it&rsquo;s corresponding version number. The SSh client can be identified as follows<br /><br />$ ssh -V<br />OpenSSH_3.9p1, OpenSSL 0.9.7a Feb 19 2013<br /><br />$ ssh -V<br />ssh: SSH Secure Shell 3.2.9.1 (non-commercial version) on i686-pc-linux-gnu<br /><br /><strong>2. Connect and login to remote host:</strong></p><p>The First time when you login to the remotehost from a localhost, it will display the host key not found message and you can give &ldquo;yes&rdquo; to continue. The host key of the remote host will be added under .ssh2/hostkeys directory of your home directory, as shown below.<br /><br />localhost$ ssh -l jit remotehost.example.com<br /><br />jit@remotehost.example.com password:</p><p>remotehost.example.com$</p><p>The Second time when you login to the remote host from the localhost, it will prompt only for the password as the remote host key is already added to the known hosts list of the ssh client.<br /><br />localhost$ ssh -l jit remotehost.example.com<br />jit@remotehost.example.com password: <br />remotehost.example.com$<br /><br />For some reason, if the host key of the remote host is changed after you logged in for the first time, you may get a warning message as shown below. This could be because of various reasons such as 1) Sysadmin upgraded/reinstalled the SSH server on the remote host 2) someone is doing malicious activity etc., The best possible action to take before saying &ldquo;yes&rdquo; to the message below, is to call your sysadmin and identify why you got the host key changed message and verify whether it is the correct host key or not.<br /><br />localhost$ ssh -l jit remotehost.example.com<br /><br />jit @remotehost.example.com's password: <br />remotehost$<br /><br /><strong>4. Debug SSH Client:</strong><br /><br />Sometimes it is necessary to view debug messages to troubleshoot any SSH connection issues. For this purpose, pass -v (lowercase v) option to the ssh as shown below.<br /><br />Example without debug message:<br /><br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; localhost$ ssh -l jit remotehost.example.com<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; warning: Connecting to remotehost.example.com failed: No address associated to the name<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; localhost$</p><p>Example with debug message:<br /><br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; locaclhost$ ssh -v -l jit remotehost.example.com<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; debug: SshConfig/sshconfig.c:2838/ssh2_parse_config_ext: Metaconfig parsing stopped at line 3.<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; debug: SshConfig/sshconfig.c:637/ssh_config_set_param_verbose: Setting variable 'VerboseMode' to 'FALSE'.<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; debug: SshConfig/sshconfig.c:3130/ssh_config_read_file_ext: Read 17 params from config file.<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; debug: Ssh2/ssh2.c:1707/main: User config file not found, using defaults. (Looked for '/home/jit/.ssh2/ssh2_config')<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; debug: Connecting to remotehost.example.com, port 22... (SOCKS not used)<br />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; warning: Connecting to remotehost.example.com failed: No address associated to</p><p><strong>5. Escape Character: (Toggle SSH session, SSH session statistics etc.)</strong><br /><br />Escape character ~ get&rsquo;s SSH clients attention and the character following the ~ determines the escape command.<br />Toggle SSH Session: When you&rsquo;ve logged on to the remotehost using ssh from the localhost, you may want to come back to the localhost to perform some activity and go back to remote host again. In this case, you don&rsquo;t need to disconnect the ssh session to the remote host. Instead follow the steps below.</p><p>i. Login to remotehost from localhost: localhost$ssh -l jit remotehost<br />ii. Now you are connected to the remotehost: remotehost$<br />iii. To come back to the localhost temporarily, type the escape character ~ and Control-Z. When you type ~ you will not see that immediately on the screen until you press and press enter. So, on the remotehost in a new line enter the following key strokes for the below to work: ~<br /><br />&nbsp;&nbsp;&nbsp; remotehost$ ~^Z<br />&nbsp;&nbsp;&nbsp; [1]+&nbsp; Stopped&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ssh -l jit remotehost<br />&nbsp;&nbsp;&nbsp; localhost$</p><p>iv. Now you are back to the localhost and the ssh remotehost client session runs as a typical unix background job, which you can check as shown below:<br /><br />&nbsp;&nbsp;&nbsp; localhost$ jobs<br />&nbsp;&nbsp;&nbsp; [1]+&nbsp; Stopped&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; ssh -l jit remotehost<br /><br />v. You can go back to the remote host ssh without entering the password again by bringing the background ssh remotehost session job to foreground on the localhost<br /><br />&nbsp;&nbsp;&nbsp; localhost$ fg %1<br />&nbsp;&nbsp;&nbsp; ssh -l jit remotehost<br />&nbsp;&nbsp;&nbsp; remotehost$</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/9639/find-certain-filesdocuments-in-linux-os</guid>
	<pubDate>Sun, 06 Apr 2014 23:56:18 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/9639/find-certain-filesdocuments-in-linux-os</link>
	<title><![CDATA[Find certain files/documents in Linux OS]]></title>
	<description><![CDATA[<p>As bioinformatician I know the fact that we usually handle the large dataset and lost in the huge numbers of files and folders. In order to search the missing file a strong search command is required. The Linux Find Command is one of the most important and much used command in Linux sytems. Find command used to search and locate list of files and directories based on conditions you specify for files that match the arguments. Find can be used in variety of conditions like you can find files by permissions, users, groups, file type, date, size and other possible criteria.<br /><br />Through this article we are sharing our day-to-day Linux find command experience and its usage in the form of examples. In this article we will show you the most used 35 Find Commands examples in Linux. We have divided the section into Five parts from basic to advance usage of find command.</p><p><strong>Part I &ndash; Basic Find Commands for Finding Files with Names</strong><br />1. Find Files Using Name in Current Directory<br /><br />Find all the files whose name is gene.txt in a current working directory.<br /><br /># find . -name gene.txt<br /><br />./gene.txt<br /><br />2. Find Files Under Home Directory<br /><br />Find all the files under /home directory with name gene.txt.<br /><br /># find /home -name gene.txt<br /><br />/home/gene.txt<br /><br />3. Find Files Using Name and Ignoring Case<br /><br />Find all the files whose name is gene.txt and contains both capital and small letters in /home directory.<br /><br /># find /home -iname gene.txt<br /><br />./gene.txt<br />./Gene.txt<br /><br />4. Find Directories Using Name<br /><br />Find all directories whose name is Gene in / directory.<br /><br /># find / -type d -name Gene<br /><br />/Gene<br /><br />5. Find fasta Files Using Name<br /><br />Find all php files whose name is gene.fasta in a current working directory.<br /><br /># find . -type f -name gene.fasta<br /><br />./gene.fasta<br /><br />6. Find all PHP Files in Directory<br /><br />Find all fasta files in a directory.<br /><br /># find . -type f -name "*.fasta"<br /><br />./gene.fasta<br />./cancer.fasta<br />./allgene.fasta<br /><br /><strong>Part II &ndash; Find Files Based on their Permissions</strong><br />7. Find Files With 777 Permissions<br /><br />Find all the files whose permissions are 777.<br /><br /># find . -type f -perm 0777 -print<br /><br />8. Find Files Without 777 Permissions<br /><br />Find all the files without permission 777.<br /><br /># find / -type f ! -perm 777<br /><br />9. Find SGID Files with 644 Permissions<br /><br />Find all the SGID bit files whose permissions set to 644.<br /><br /># find / -perm 2644<br /><br />10. Find Sticky Bit Files with 551 Permissions<br /><br />Find all the Sticky Bit set files whose permission are 551.<br /><br /># find / -perm 1551<br /><br />11. Find SUID Files<br /><br />Find all SUID set files.<br /><br /># find / -perm /u=s<br /><br />12. Find SGID Files<br /><br />Find all SGID set files.<br /><br /># find / -perm /g+s<br /><br />13. Find Read Only Files<br /><br />Find all Read Only files.<br /><br /># find / -perm /u=r<br /><br />14. Find Executable Files<br /><br />Find all Executable files.<br /><br /># find / -perm /a=x<br /><br />15. Find Files with 777 Permissions and Chmod to 644<br /><br />Find all 777 permission files and use chmod command to set permissions to 644.<br /><br /># find / -type f -perm 0777 -print -exec chmod 644 {} \;<br /><br />16. Find Directories with 777 Permissions and Chmod to 755<br /><br />Find all 777 permission directories and use chmod command to set permissions to 755.<br /><br /># find / -type d -perm 777 -print -exec chmod 755 {} \;<br /><br />17. Find and remove single File<br /><br />To find a single file called gene.txt and remove it.<br /><br /># find . -type f -name "gene.txt" -exec rm -f {} \;<br /><br />18. Find and remove Multiple File<br /><br />To find and remove multiple files such as .fa or .gb, then use.<br /><br /># find . -type f -name "*.fa" -exec rm -f {} \;<br /><br />OR<br /><br /># find . -type f -name "*.gb" -exec rm -f {} \;<br /><br />19. Find all Empty Files<br /><br />To file all empty files under certain path.<br /><br /># find /tmp -type f -empty<br /><br />20. Find all Empty Directories<br /><br />To file all empty directories under certain path.<br /><br /># find /tmp -type d -empty<br /><br />21. File all Hidden Files<br /><br />To find all hidden files, use below command.<br /><br /># find /tmp -type f -name ".*"<br /><br /><strong>Part III &ndash; Search Files Based On Owners and Groups</strong><br />22. Find Single File Based on User<br /><br />To find all or single file called gene.txt under / root directory of owner root.<br /><br /># find / -user root -name gene.txt<br /><br />23. Find all Files Based on User<br /><br />To find all files that belongs to user Rahul under /home directory.<br /><br /># find /home -user rahul<br /><br />24. Find all Files Based on Group<br /><br />To find all files that belongs to group Developer under /home directory.<br /><br /># find /home -group developer<br /><br />25. Find Particular Files of User<br /><br />To find all .txt files of user Rahul under /home directory.<br /><br /># find /home -user rahul -iname "*.txt"<br /><br /><strong>Part IV &ndash; Find Files and Directories Based on Date and Time</strong><br />26. Find Last 50 Days Modified Files<br /><br />To find all the files which are modified 50 days back.<br /><br /># find / -mtime 50<br /><br />27. Find Last 50 Days Accessed Files<br /><br />To find all the files which are accessed 50 days back.<br /><br /># find / -atime 50<br /><br />28. Find Last 50-100 Days Modified Files<br /><br />To find all the files which are modified more than 50 days back and less than 100 days.<br /><br /># find / -mtime +50 &ndash;mtime -100<br /><br />29. Find Changed Files in Last 1 Hour<br /><br />To find all the files which are changed in last 1 hour.<br /><br /># find / -cmin -60<br /><br />30. Find Modified Files in Last 1 Hour<br /><br />To find all the files which are modified in last 1 hour.<br /><br /># find / -mmin -60<br /><br />31. Find Accessed Files in Last 1 Hour<br /><br />To find all the files which are accessed in last 1 hour.<br /><br /># find / -amin -60<br /><br /><strong>Part V &ndash; Find Files and Directories Based on Size</strong><br />32. Find 50MB Files<br /><br />To find all 50MB files, use.<br /><br /># find / -size 50M<br /><br />33. Find Size between 50MB &ndash; 100MB<br /><br />To find all the files which are greater than 50MB and less than 100MB.<br /><br /># find / -size +50M -size -100M<br /><br />34. Find and Delete 100MB Files<br /><br />To find all 100MB files and delete them using one single command.<br /><br /># find / -size +100M -exec rm -rf {} \;<br /><br />35. Find Specific Files and Delete<br /><br />Find all .gb files with more than 10MB and delete them using one single command.<br /><br /># find / -type f -name *.gb -size +10M -exec rm {} \;</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

</channel>
</rss>