BOL: Related items

AlfaPang: alignment free algorithm for pangenome graph construction

BioStar — Thu, 28 Aug 2025 02:56:35 -0500

AlfaPang constructs variation graphs, leveraging its alignment-free and reference-free approach, based solely on intrinsic sequence properties. This design allows AlfaPang's runtime and memory usage to scale linearly with the size of input sequences, enabling it to handle significantly larger genome sets compared to other methods.

Address of the bookmark: https://github.com/AdamCicherski/AlfaPang

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

Murasaki

Anjana — Fri, 30 Sep 2016 10:22:30 -0500

Murasaki is an anchor alignment program that is

exteremely fast (17 CPU hours for whole Human x Mouse genome (with 40 nodes: 35 wall minutes), or 8 mammals in 21 CPU hours (42 wall minutes))
scalable (Arbitrarily parallelizable across multiple nodes using MPI)
memory efficient. (Even a single node with 16GB of ram can handle over 1Gbp of sequence)
unlimited by pattern length or selection
repeat tolerant

Address of the bookmark: http://murasaki.dna.bio.keio.ac.jp/wiki/index.php?Murasaki

GenomeRing: alignment visualization based on SuperGenome coordinates

Neel — Wed, 18 Jan 2017 10:24:10 -0600

The number of completely sequenced genomes is continuously rising, allowing for comparative analyses of genomic variation. Such analyses are often based on whole-genome alignments to elucidate structural differences arising from insertions, deletions or from rearrangement events. Computational tools that can visualize genome alignments in a meaningful manner are needed to help researchers gain new insights into the underlying data. Such visualizations typically are either realized in a linear fashion as in genome browsers or by using a circular approach, where relationships between genomic regions are indicated by arcs. Both methods allow for the integration of additional information such as experimental data or annotations. However, providing a visualization that still allows for a quick and comprehensive interpretation of all important genomic variations together with various supplemental data, which may be highly heterogeneous, remains a challenge.

More at https://academic.oup.com/bioinformatics/article/28/12/i7/268598/GenomeRing-alignment-visualization-based-on

Address of the bookmark: http://it.informatik.uni-tuebingen.de/?page_id=185

Synima: Synteny Imaging tool

Jit — Sun, 10 Dec 2017 17:03:48 -0600

Synteny Imaging tool (Synima) written in Perl, which uses the graphical features of R. Synima takes orthologues computed from reciprocal best BLAST hits or OrthoMCL, and DAGchainer, and outputs an overview of genome-wide synteny in PDF. Each of these programs are included with the Synima package, and a pipeline for their use. Synima has a range of graphical parameters including size, colours, order, and labels, which are specified in a config file generated by the first run of Synima – and can be subsequently edited. Synima runs quickly on a command line to generate informative and publication quality figures. Synima is open source and freely available from https://github.com/rhysf/Synima under the MIT License.

Address of the bookmark: https://github.com/rhysf/Synima

Mercator: Multiple Whole-Genome Orthology Map Construction

Jit — Tue, 19 May 2020 16:46:22 -0500

Whole-genome homology maps attempt to identify the evolutionary relationships between and within multiple genomes. The term "syntenic" is often used to describe regions of multiple genomes that are believed to have evolved from the same region in an ancestral genome. However, it has been pointed out that this use of the term is incorrect (Passarge et al. 1999) and thus we will use the terms "homologous", "orthologous", and "paralogous" instead. Ideally, given K genomes, we would like to identify all orthologous genomic regions as well as paralogous regions within each genome and hypothetical ancestral genome. Maps listing these relationships are extremely valuable to researchers performing comparative analyses of genomic sequence. Here we present our initial work in the form a program called Mercator that constructs orthology maps between multiple whole genomes.

Address of the bookmark: https://www.biostat.wisc.edu/~cdewey/mercator/

JCVI:Python utility libraries on genome assembly, annotation and comparative genomics

Jit — Tue, 17 Mar 2020 06:19:06 -0500

Collection of Python libraries to parse bioinformatics files, or perform computation related to assembly, annotation, and comparative genomics.

https://github.com/tanghaibao/jcvi

More at https://github.com/tanghaibao/jcvi/wiki

Address of the bookmark: https://github.com/tanghaibao/jcvi

Ancient whole genome duplication (WGD) detection tools !

Rahul Nayak — Sun, 07 Mar 2021 00:32:44 -0600

There are two methods for ancient WGD detection, one is collinearity analysis, and the other is based on the Ks distribution map. Among them, Ks is defined as the average number of synonymous substitutions at each synonymous site, and there is also a Ka corresponding to it, which refers to the average number of non-synonymous substitutions at each non-synonymous site.

At present, some people have posted articles about the analysis process of WGD. I searched for the keyword "wgd pipeline" and found the following:

GenoDup: https:// github.com/MaoYafei/GenoDup-Pipeline
https://peerj.com/articles/6303/
WGDdetector: https:// github.com/yongzhiyang2 012/WGDdetector
https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2670-3
wgd: https:// github.com/arzwa/wgd
https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1142-2#Sec1
https://bmcbiol.biomedcentral.com/articles/10.1186/s12915-017-0399-x
GeNoGAP https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1142-2
https://bmcbiol.biomedcentral.com/articles/10.1186/s12915-017-0399-x
https://github.com/dfguan/purge_dups
https://www.biorxiv.org/content/10.1101/2020.01.24.917997v1

This article introduces the usage of wgd.

Wgd cannot be installed directly with bioconda at present, so it is a little troublesome to install, because it depends on a lot of software. wgd depends on the following software

BLAST
MCL
MUSCLE/MAFFT/PRANK
PAML
PhyML/FastTree
i-ADHoRe

But the good news is that most of the software it depends on can be installed with bioconda

conda create -n wgd python=3.5 blast mcl muscle mafft prank paml fasttree cmake libpng mpi=1.0=mpich
conda activate wgd

Here mpi=1.0=mpich is selected, because i-adhore depends on mpich. If openmpi is installed, an error will appear while loading shared libraries: libmpi_cxx.so.40: cannot open shared object file: No such file or directory

After that, the installation is much simpler

git clone https://github.com/arzwa/wgd.git
cd wgd
pip install .
pip install git+https://github.com/arzwa/wgd.git
For i-ADHoRe, you need to register at http:// bioinformatics.psb.ugent.be /webtools/i-adhore/licensing/Agree to the license to download i-ADHoRe-3.0

Since my miniconda3 installed ~/opt/, the installation path is so~/opt/miniconda3/envs/wgd/

tar -zxvf i-adhore-3.0.01.tar.gz
cd i-adhore-3.0.01
mkdir -p build && cd build
cmake .. -DCMAKE_INSTALL_PREFIX=~/opt/miniconda3/envs/wgd/
make -j 4
make insatall

Take the sugarcane genome Saccharum spontaneum L as an example. The genome is 8-ploid with 32 chromosomes (2n = 4x8 = 32)

Download the tutorial for CDS and GFF annotation files

mkdir -p wgd_tutorial && cd wgd_tutorial
wget http://www.life.illinois.edu/ming/downloads/Spontaneum_genome/Sspon.v20190103.cds.fasta.gz
wget http://www.life.illinois.edu/ming/downloads/Spontaneum_genome/Sspon.v20190103.gff3.gz
gunzip *.gz

First conda activate wgdstart our analysis environment, and then start the analysis

Step 1 : Use to wgd mclidentify homologous genes in the genome

wgd mcl -n 20 --cds --mcl -s Sspon.v20190103.cds.fasta -o Sspon_cds.out

Step 2 : Use to wgd ksdbuild Ks distribution

wgd ksd --n_threads 80 Sspon_cds.out/Sspon.v20190103.cds.fasta.blast.tsv.mcl Sspon.v20190103.cds.fasta

Step 3 : If the quality of the genome is good, then wgd syncollinearity analysis can be used . It can help us find the collinearity block in the genome and the corresponding anchor point

wgd syn --feature gene --gene_attribute ID \
-ks wgd_ksd/Sspon.v20190103.cds.fasta.ks.tsv \
Sspon.v20190103.gff3 Sspon_cds.out/Sspon.v20190103.cds.fasta.blast.tsv.mcl

For more reading - There are 9 sub-modules in WGD

kde: KDE fitting to the Ks distribution
ksd: Ks distribution construction
mcl: BLASP comparison of All-vs-ALl + MCL classification analysis.
mix: Hybrid modeling of Ks distribution.
pre: preprocess the CDS file
syn: Call I-ADHoRe 3.0 to use GFF files for collinearity analysis
viz: draw histogram and density plot
wf1: Ks standard analysis procedure of the whole genome paranome (paranome), call mcl, ksd and syn
wf2: Ks standard analysis procedure of one-vs-one homologous gene (ortholog), call wcl and kSD

Synorth: exploring the evolution of synteny and long-range regulatory interactions in vertebrate genomes

LEGE — Mon, 06 May 2024 06:21:10 -0500

Genomic regulatory blocks are chromosomal regions spanned by long clusters of highly conserved noncoding elements devoted to long-range regulation of developmental genes, often immobilizing other, unrelated genes into long-lasting syntenic arrangements. Synorth http://synorth.genereg.net/ is a web resource for exploring and categorizing the syntenic relationships in genomic regulatory blocks across multiple genomes, tracing their evolutionary fate after teleost whole genome duplication at the level of genomic regulatory block loci, individual genes, and their phylogenetic context.

More at https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2745767/

Address of the bookmark: http://synorth.genereg.net/

Integrative Genomics Viewer (IGV) tutorial

Neel — Sat, 12 Jul 2014 15:16:23 -0500

The Integrative Genomics Viewer (IGV) from the Broad Center allows you to view several types of data files involved in any NGS analysis that employs a reference genome, including how reads from a dataset are mapped, gene annotations, and predicted genetic variants.

http://www.broadinstitute.org/igv/

Address of the bookmark: https://wikis.utexas.edu/display/bioiteam/Integrative+Genomics+Viewer+%28IGV%29+tutorial