BOL: Related items

VGSC: A Web-Based Vector Graph Toolkit of Genome Synteny and Collinearity

Abhimanyu Singh — Tue, 30 Oct 2018 10:46:28 -0500

VGSC, the Vector Graph toolkit of genome Synteny and Collinearity, and its online service, to visualize the synteny and collinearity in the common graphical format, including both raster (JPEG, Bitmap, and PNG) and vector graphic (SVG, EPS, and PDF).

Address of the bookmark: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4783527/

GoJS

Jit — Tue, 22 Nov 2016 08:25:37 -0600

GoJS is a feature-rich JavaScript library for implementing custom interactive diagrams and complex visualizations across modern web browsers and platforms. GoJS makes constructing JavaScript diagrams of complex nodes, links, and groups easy with customizable templates and layouts.

GoJS offers many advanced features for user interactivity such as drag-and-drop, copy-and-paste, in-place text editing, tooltips, context menus, automatic layouts, templates, data binding and models, transactional state and undo management, palettes, overviews, event handlers, commands, and an extensible tool system for custom operations.

GoJS is pure JavaScript, so users get interactivity without requiring round-trips to servers and without plugins. GoJS normally runs completely in the browser, rendering to an HTML5 Canvas element or SVG without any server-side requirements. GoJS does not depend on any JavaScript libraries or frameworks, so it should work with any HTML or JavaScript framework or with no framework at all.

More at http://gojs.net/latest/index.html

Address of the bookmark: http://gojs.net/latest/index.html

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

JumboDB: tool for de Bruijn graph construction

BioStar — Tue, 17 Aug 2021 13:33:46 -0500

jumboDB tool for fast de Bruijn graph construction from long sequences (reads or genomes) with very low error rate. JumboDB is not a genome assembler by itself but rather a subroutine that translates a set of reads into compressed de Bruijn graph.

More at https://github.com/AntonBankevich/jumboDB

Address of the bookmark: https://github.com/AntonBankevich/jumboDB

GFAffix : Identifies walk-preserving shared affixes in variation graphs and collapses them into a non-redundant graph structure.

BioStar — Thu, 28 Aug 2025 03:11:25 -0500

GFAffix identifies walk-preserving shared affixes in variation graphs and collapses them into a non-redundant graph structure.

Address of the bookmark: https://github.com/codialab/GFAffix

DeepHiC: A Generative Adversarial Network for Enhancing Hi-C Data Resolution

Rahul Nayak — Tue, 03 Mar 2020 01:12:47 -0600

DeepHiC is a GAN-based model for enhancing Hi-C data resolution. We developed this server for helping researchers to enhance their own low-resolution data by a few steps of clicks. Ab initio training could be performed according to our published code. We provided trained models for various depth of low-coverage sequencing Hi-C data. The depth of input data is estimated by its distribution comparing with those of the downsampled Hi-C data we used in training

Address of the bookmark: http://sysomics.com/deephic

Comparison of Short Read De Novo Alignment Algorithms

Rahul Agarwal — Wed, 21 Aug 2013 07:56:01 -0500

Excellent article to introduce different sequencing methods along with tools for de novo assembly of sequencing reads and their relevant references.

Title: Comparison of Short Read De Novo Alignment Algorithms

Author: Nikhil Gopal

Address of the bookmark: http://biochem218.stanford.edu/Projects%202011/Gopal%202011.pdf

3d-dna: 3D de novo assembly (3D DNA) pipeline

Jit — Thu, 28 Dec 2017 10:09:37 -0600

This code is designed to enable anyone to reproduce the Hs2-HiC and the AaegL4 genomes reported in: Dudchenko et al., De novo assembly of the Aedes aegypti genome using Hi-C yields chromosome-length scaffolds. Science, 2017.

Unless otherwise noted, all terminology below is consistent with this paper, and all references to figures and tables in this readme refer to this paper. Specifically, some of the terminology used below is outlined in Figure S2. The assembly procedure is described in detail in the Supporting Online Materials, specifically in the section labelled “Pipeline description”.

In addition, the pipeline uses tools and methods from Juicer (Durand & Shamim et al., Cell Systems, 2016) and Juicebox (Durand & Robinson et al., Cell Systems, 2016), as well as additional dependencies noted below.

Feel free to post your questions and comments at: http://www.aidenlab.org/forum.html

http://aidenlab.org/documentation.html

Address of the bookmark: https://github.com/theaidenlab/3d-dna

ALPACA: A hybrid strategy for assembly of genomic DNA shotgun sequencing reads.

Seema Singh — Mon, 30 Apr 2018 04:38:40 -0500

ALPACA requires Celera Assembler 8.3 or later. It is recommended to build Celera Assembler from source. (Why? The pre-built binaries CA_8.3rc1 and CA8.3rc2 will work for any large data set.

Detail paper at https://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-017-3927-8

Address of the bookmark: https://github.com/VicugnaPacos/ALPACA

PERGA: A Paired-End Read Guided De Novo Assembler for Extending Contigs Using SVM and Look Ahead Approach

Rahul Nayak — Tue, 05 Jun 2018 09:57:11 -0500

PERGA - Paired End Reads Guided Assembler PERGA is a novel sequence reads guided de novo assembly approach which adopts greedy-like prediction strategy for assembling reads to contigs and scaffolds. Instead of using single-end reads to construct contig, PERGA uses paired-end reads and different read overlap sizes from O ≥ Omax to Omin to resolve the gaps and branches. Moreover, by constructing a decision model using machine learning approach based on branch features, PERGA can determine the correct extension in 99.7% of cases. PERGA will try to extend the contigs by all feasible nucleotides and determine if these multiple extensions due to sequencing errors or repeats by using looking ahead technology, and it also try to separate the different repeats of nearby genomic regions to make the assembly result more longer and accurate. The simulated E.coli paired-end reads data are generated using GemSim (KE McElroy, F Luciani, T Thomas. Gemsim: General, Error-Model Based Simulator of Next-Generation Sequencing Data. BMC Genomics 2012, 13:74), with coverage 50x, 60x, 100x, read lengths 100-bp, and can be downloaded from https://github.com/zhuxiao/data_PERGA.

Address of the bookmark: https://github.com/hitbio/PERGA