Here are few companies:

https://mynucleus.com/

https://myome.com/

https://nebula.org/whole-genome-sequencing-dna-test/

What Are piRNAs?

piRNAs are the largest class of small non-coding RNAs, typically 24–32 nucleotides in length. Unlike microRNAs (miRNAs) and small interfering RNAs (siRNAs), piRNAs do not rely on Dicer enzymes for maturation. Instead, they are processed from long single-stranded precursors and associate with PIWI proteins, a subclass of the Argonaute protein family.

The primary functions of piRNAs include:

1. Silencing Transposable Elements: By targeting transposons, piRNAs prevent genomic instability, particularly in germline cells.
2. Regulating Gene Expression: piRNAs modulate gene expression at transcriptional and post-transcriptional levels.
3. Epigenetic Modulation: They guide epigenetic modifications, such as DNA methylation, to specific genomic loci.

Challenges in piRNA Research

Studying piRNAs is fraught with challenges, including:

• Short Length: Their small size complicates sequencing and alignment.
• Lack of Sequence Conservation: Unlike miRNAs, piRNAs exhibit limited sequence conservation across species.
• Complex Biogenesis: The intricate pathways of piRNA generation require sophisticated computational tools to unravel.

Bioinformatics: Illuminating the World of piRNAs

Bioinformatics has emerged as an indispensable tool for studying piRNAs, facilitating their discovery, annotation, and functional analysis. Here's how bioinformatics is transforming piRNA research:

1. Identification and Annotation

The discovery of piRNAs relies on next-generation sequencing (NGS) data. Bioinformatics tools such as piRNApredictor and Piano identify piRNA clusters and predict potential targets. Databases like piRBase and piRNAdb curate information about known piRNAs, their sequences, and associated proteins.

2. Mapping and Alignment

piRNAs often originate from repetitive regions, making their alignment challenging. Tools like Bowtie and STAR handle the unique mapping requirements of piRNAs, enabling accurate identification of piRNA clusters in genomes.

3. Functional Analysis

Bioinformatics approaches predict piRNA functions by analyzing their interactions with transposons, genes, and epigenetic marks. Algorithms such as TargetFinder and RIblast explore piRNA-mRNA interactions, shedding light on regulatory networks.

4. Evolutionary Studies

piRNAs are evolutionarily diverse, reflecting their roles in species-specific genomic defense. Comparative genomics tools help trace the evolution of piRNA clusters and their associated PIWI proteins across species.

5. Epigenomic Insights

piRNAs are key players in epigenetic regulation. Bioinformatics pipelines integrate piRNA data with chromatin immunoprecipitation sequencing (ChIP-seq) and DNA methylation data to uncover their role in shaping the epigenome.

Case Study: piRNAs in Germline Integrity

One of the hallmark functions of piRNAs is the suppression of transposable elements in the germline. For example, in Drosophila melanogaster, piRNAs target retrotransposons like gypsy and copia. Bioinformatics analyses revealed that these piRNAs guide PIWI proteins to transposon-derived RNA, ensuring genome stability during gametogenesis.

Clinical Relevance of piRNAs

Recent studies suggest that piRNAs may serve as biomarkers for diseases such as cancer, infertility, and neurodegenerative disorders. For instance:

• Cancer: Dysregulated piRNA expression has been linked to tumorigenesis, making them potential targets for cancer therapies.
• Infertility: Aberrant piRNA pathways are implicated in male infertility due to their role in spermatogenesis.
• Neurodegeneration: piRNAs may regulate neuronal gene expression, highlighting their potential in neurological research.

Future Directions

The integration of bioinformatics with emerging technologies offers exciting opportunities for piRNA research:

• Single-Cell Sequencing: Unveiling cell-specific piRNA expression and function.
• Machine Learning: Predicting piRNA functions and targets with greater accuracy.
• CRISPR-Based Tools: Editing piRNA clusters to explore their roles in vivo.

Conclusion

piRNAs are the unsung guardians of the genome, safeguarding genetic material from transposable elements and contributing to gene regulation and epigenetic programming. Bioinformatics has opened the floodgates of discovery, unraveling the complexities of piRNAs and their myriad roles in biology and disease.

As we continue to decode the piRNA landscape, these small RNAs promise to unveil big secrets about genome stability, evolution, and human health, cementing their place as a fascinating frontier in molecular biology.

Key Findings:

1. Chromosomal Fusion and Its Molecular Signature:

   • The fusion site is located at 2q13–2q14.1 and is characterized by degenerate telomeric sequences appearing interstitially, indicating the historical head-to-head joining of ancestral chromosomes.
   • Despite being a signature of a past fusion event, these telomeric repeats are no longer functional and have undergone sequence degradation over time.

2. Extensive Duplications in the Surrounding Genomic Region:

   • The study identifies large-scale segmental duplications flanking the fusion site, with several of these regions duplicated and scattered across multiple chromosomes.
   • These duplications are predominantly located in subtelomeric and pericentromeric regions, suggesting their role in genomic instability and chromosomal evolution.

3. Paralogous Regions and Their Evolutionary Relationships:

   • A 168-kilobase (kb) segment near the fusion site has 98%–99% sequence identity with three regions on chromosome 9 (9pter, 9p11.2, and 9q13).
   • Another 67-kb region distal to the fusion site shows a high degree of homology to sequences in chromosome 22qter.
   • Additionally, a 100-kb segment exhibits 96% sequence identity with a region in chromosome 2q11.2.

4. Comparative Genomics and Evolutionary Implications:

   • By comparing the duplicated sequences and their arrangement in primates, the researchers traced the order of duplication events leading to their present distribution.
   • The presence of specific repetitive elements within these duplicated segments serves as evolutionary markers that help infer their historical rearrangements.
   • Some of these duplicated regions are associated with chromosomal inversion breakpoints, potentially contributing to evolutionary changes in primates.
   • Recurrent structural rearrangements in these regions have been linked to human chromosomal disorders.

Conclusions and Implications:

• The findings provide valuable insights into the structural evolution of human chromosome 2, which played a crucial role in human speciation.
• Understanding these segmental duplications and their evolutionary trajectories sheds light on genomic instability, which may contribute to human genetic diseases.
• The study highlights how large-scale chromosomal rearrangements, such as fusion and duplication, have influenced the evolutionary divergence of humans from other primates.

This research advances our understanding of human genome evolution and offers a foundation for studying the effects of structural variants in genetic disorders.

GoJS offers many advanced features for user interactivity such as drag-and-drop, copy-and-paste, in-place text editing, tooltips, context menus, automatic layouts, templates, data binding and models, transactional state and undo management, palettes, overviews, event handlers, commands, and an extensible tool system for custom operations.

GoJS is pure JavaScript, so users get interactivity without requiring round-trips to servers and without plugins. GoJS normally runs completely in the browser, rendering to an HTML5 Canvas element or SVG without any server-side requirements. GoJS does not depend on any JavaScript libraries or frameworks, so it should work with any HTML or JavaScript framework or with no framework at all.          

More at http://gojs.net/latest/index.html

Address of the bookmark: http://gojs.net/latest/index.html

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

More at https://github.com/AntonBankevich/jumboDB

Address of the bookmark: https://github.com/AntonBankevich/jumboDB

Address of the bookmark: https://github.com/codialab/GFAffix

Address of the bookmark: http://sysomics.com/deephic

Title: Comparison of Short Read De Novo Alignment Algorithms 

Author: Nikhil Gopal

Address of the bookmark: http://biochem218.stanford.edu/Projects%202011/Gopal%202011.pdf

Unless otherwise noted, all terminology below is consistent with this paper, and all references to figures and tables in this readme refer to this paper. Specifically, some of the terminology used below is outlined in Figure S2. The assembly procedure is described in detail in the Supporting Online Materials, specifically in the section labelled “Pipeline description”.

In addition, the pipeline uses tools and methods from Juicer (Durand & Shamim et al., Cell Systems, 2016) and Juicebox (Durand & Robinson et al., Cell Systems, 2016), as well as additional dependencies noted below.

Feel free to post your questions and comments at: http://www.aidenlab.org/forum.html

http://aidenlab.org/documentation.html

Address of the bookmark: https://github.com/theaidenlab/3d-dna