<![CDATA[BOL: Related items]]> https://bioinformaticsonline.com/related/35119?offset=90 https://bioinformaticsonline.com/bookmarks/view/42201/rosettaantibodydesign-rabd-a-general-framework-for-computational-antibody-design Sun, 20 Sep 2020 06:03:42 -0500 https://bioinformaticsonline.com/bookmarks/view/42201/rosettaantibodydesign-rabd-a-general-framework-for-computational-antibody-design <![CDATA[RosettaAntibodyDesign (RAbD): A general framework for computational antibody design]]> RosettaAntibodyDesign (RAbD) is a generalized framework for the design of antibodies, in which a user can easily tailor the run to their project needs. The algorithm is meant to sample the diverse sequence, structure, and binding space of an antibody-antigen complex. It can be used for a multitude of project types, from denovo design to redesigns that improve binding affinity, optimize stability, or manipulate function.

The framework is based on rigorous bioinformatic analysis and rooted very much on our recent clustering of antibody CDR regions. It uses the North/Dunbrack CDR definition as outlined in the North/Dunbrack clustering paper.

More at

https://www.rosettacommons.org/docs/latest/application_documentation/antibody/RosettaAntibodyDesign

https://bio-jade.readthedocs.io/en/latest/installation.html

Address of the bookmark: https://www.rosettacommons.org/docs/latest/application_documentation/antibody/RosettaAntibodyDesign

]]> BioStar https://bioinformaticsonline.com/pages/view/18749/list-of-biotechnology-research-laboratory-university-and-centre-in-india Thu, 30 Oct 2014 12:34:34 -0500 https://bioinformaticsonline.com/pages/view/18749/list-of-biotechnology-research-laboratory-university-and-centre-in-india <![CDATA[List of Biotechnology Research Laboratory, University, and Centre in India]]> DEPARTMENT OF BIOTECHNOLOGY

INDIAN COUNCIL OF MEDICAL RESEARCH (ICMR)

COUNCIL OF SCIENTIFIC & INDUSTRIAL RESEARCH (CSIR)

 

CITYWISE

City Wise Llist of Govt. and Non Govt. Research institutions in India -

Ahmedabad

Allahabad

Bangalore

Barrackpore (W. B.)

· Central Inland Capture Fisheries Research Institute

Bhopal

Bhubaneswar

Calcutta

Chandigarh

Chennai (Madras)

Delhi

Dehradun

Dirang (Arunachal Pradesh)

Durgapur

Eluru (A. P.)

Gandhi Nagar

Goa

Hyderabad

Indore

Jammu

Jhansi (U. P)

Jodhpur (Rajasthan)

Kanpur

Kasaragod

Kharagpur

Kochi

Lucknow

Mathura

Mumbai (Bombay)

Palakkad

Palampur (H.P.)

Peechi

Pilani

Puttur (Karnataka)

Pune

Roorkie (U. P.)

Trivandrum (Thiruvananthapuram)

Varanasi (U. P.)

· Indian Institute of Vegetable Research

 

UNIVERSITIES/COLLEGES UNDER UGC

DST

•  Agharkar Research Institute, Pune

•  Birbal Sahni Institute of Palaeobotany, Lucknow

•  Bose Institute, Kolkata

•  Indian Association for the Cultivation of Science, Kolkata

•  International Advanced Research Centre for Powder Metallurgy and New Materials,
...esr ...Hyderabad

•  Indian Institute of Astrophysics, Bangalore

•  Indian Institute of Geomagnetism, Mumbai

•  Indian Institute of Tropical Meteorology, Pune

•  Jawaharlal Nehru Centre for Advanced Scientific Research, Bangalore

•  National Accreditation Board for Testing & Calibration Laboratories, New Delhi

•  Raman Research Institute, Bangalore

•  S.N. Bose National Centre for Basic Sciences, Kolkata

•  Sreechitra Tirunal Institute for Medical Sciences & Technology, Thiruvananthapuram

•  Technology Information, Forecasting & Assessment Council (TIFAC), New Delhi

•  Vigyan Prasar, New Delhi

 

Indian Council of Agricultural Research

  • National Bureaue of Soil Survey & Land Use Planning (NBSSLUP)
  • Central Research Institute for Jute & Allied Fibres (CRIJAF)
  • National Bureaue of Agriculturally Important Micro-Organisms (NBAIMO
  • Central Research Institute for Dryland Agriculture
]]> Jit https://bioinformaticsonline.com/opportunity/view/42294/the-hiller-lab-at-the-loewe-tbg-in-frankfurt-is-looking-for-an-ambitious-postdoc%E2%80%93-comparative-genomics Sat, 31 Oct 2020 23:01:41 -0500 <![CDATA[The Hiller Lab at the LOEWE-TBG in Frankfurt is looking for an ambitious PostDoc– Comparative Genomics]]> The mission of our group is to discover genomic determinants of phenotypic differences between species, which is important to understand how nature's fascinating phenotypic diversity evolved and how it is encoded in the genome. Work in the lab ranges from genome assembly and alignment to annotating genes, developing and applying comparative genomic methods to discover key differences in genes (such as loss, gain, selection) and regulatory elements, and using statistical approaches to associate genomic to phenotypic differences [1-8].

The postdoc will join our efforts to extend our methods repertoire to accurately detect additional types of genomic changes, to adopt them to other taxonomic groups, and to apply them on a large-scale to existing and numerous newly-sequenced genomes generated by us and our TBG collaborators.

Candidate requirements
· PhD degree in bioinformatics / computational biology, genomics or a related area

· a strong publication record

· excellent programming skills in a Linux environment as well as experience with shell scripting and Unix tools

· previous experience in large-scale comparative genomic data analysis is an advantage.

More at https://www.lifescience.net/jobs/71529/postdoc-mfd-comparative-genomics/

]]> https://bioinformaticsonline.com/opportunity/view/43769/ideaslab-workshop Wed, 02 Feb 2022 06:13:48 -0600 <![CDATA["IdeasLab"* workshop !]]> A new, grant-funded opportunity seeks early career researchers interested
in life's origins: https://templetonideaslab.umbc.edu/

Applications are invited to an all-expenses paid position at a 5-day
"IdeasLab"* workshop to be held near Prague CZ in June 2022. Thirty
successful applicants will be drawn in equal number from the relevant
sectors biological evolution, A-Life anbd theoretical physics. The week's
activities will lead these thirty to form interdisciplinary teams which
each propose how they can advance frontiers of abiogenesis research. Up to
$5 million total funding will be available for developing these ideas
produced by the week's activities. Further details of the event,
including the online application form, are found at the link posted above

]]> https://bioinformaticsonline.com/blog/view/428/five-unique-traits-of-effective-computational-biologist Thu, 11 Jul 2013 13:12:51 -0500 https://bioinformaticsonline.com/blog/view/428/five-unique-traits-of-effective-computational-biologist <![CDATA[Five unique traits of effective computational biologist]]> Bioinformatics research is driven by large set of software, scripts, and tools to analyse gigantic biological data. Being a great biological programmer or bioinformatician involves more than writing code that works. The biological programmers who rise to the top ranks of their profession are not only good programmer but also expert in biological stuff. Moreover, In order to be a good and effective biological programmer, you need to possess a combination of traits that allow your computational as well as biological skill, experience, and knowledge to produce working code. There are some technically skilled biological programmers who will never be effective because they lack the other important traits needed. Here are top five traits that are necessary to become a great biological programmer.

1. Learn and get updated

Some of the bad biological programmers only learn new technical or non-technical things when it’s absolutely necessary. The good biological programmers learn new technical skills proactively. But great biological programmers not only learn new technical skills on their own but also learn non-technical skills, and have an open mind to sources of knowledge that others may shut out.

In other concrete term, the bad biological programmer learn Perl's regular expression when they started a project on comparative genomics; the good biological programmer learned it a year before because it looked interesting; and the great biological programmer also read about the BioPerl packages, genomics, DNA string, genomic theories, or some similar course of study so that they could understand the results and explain it biologically.

2. Not a merely coder!!!

I often encountered with biological programmer who call themself a hard-core computer programmer and avoid biology. I can almost guarantee that if you are one of them then you are not doing research but merely writing "dry" codes.

According to my supervisor most of the computational biologist, don't know what they are doing biologically. Even they struggle to explain their own programs output and results. Therefore, It is highly advisable to learn basic of biology which can assist you to explain the result and understand your discovery. Always remember you are a researcher not a coder.

3. Be Social with biologist

The computational biologist spends most of the time in from of computers, writing codes. They always think their job is to produce working codes, not technical research perfections. But, they are completely wrong. You should not forget that apart from your computational skills you also need some biologist, other than your supervisor, to explain and make you understand the complex biological mechanism.

I highly recommend your to interact with biotech researchers and learn how do they explain their one graph (which they generally produce after one year of work) biologically. Remember, the origin of your research project is complex biological phenomenon, which is more complex than that of your limited programming rules.

4. Do not search, research for answers

Researching for answers means more than typing several keywords into a search engine or posting a question at Stack Overflow or the BioStars forums. I have entered problems into search engines that generate no results, and every question I posted on Stack Overflow or the BioStars forums never got anything resembling an answer, yet I solved the issues and moved on. I’m not a magician — I just know how to find answers or discover root causes.

Many problems are situational, and if you depend on search engines and forums, you can waste a lot of time going down a rabbit hole and possibly never getting a solution. Learn to perform root cause analysis, learn enough about the underlying system to look for other clues and solutions, and learn to take a long distance view of an issue before deep diving into it.

5. Love and defend your research

You cannot rise to the top in this research profession without loving your work. There are some very good “it’s just a job” biological programmers (I’ve been one at times), but if that is your outlook, you won’t be willing to do whatever it takes to succeed. This idea gets a lot of folks in a huff, because they feel it is a personal insult. “I’m a good programmer, but I have other priorities and can’t make work my life.” I understand completely; I have other priorities too. As much as I hate to say it, when I am passionate about my work, I am willing (though not eager) to abandon my other priorities to finish the job. It is not an insult to say that if you aren’t willing to pull out all the stops you can’t be the best, it is a fact.

You must be passionate about more than programming — you must also be excited about your research, the tools and technology you are using, and so on. I have seen very good and even great biological programmers operating at mediocre levels because something was not a good fit, such as they hated the project or were using a technology they disliked. Therefore, like your research project and get excited about your discoveries. You have not only to discover but also defend your finding with scientific words.

Thanks to all of you for reading.

]]> Jitendra Narayan https://bioinformaticsonline.com/news/view/1737/perl-in-a-day Sat, 10 Aug 2013 21:14:03 -0500 https://bioinformaticsonline.com/news/view/1737/perl-in-a-day <![CDATA[Perl in a day !!]]> This pdf based tutorial in good resource to understand the basic of Perl in a day

http://ritg.med.harvard.edu/training/perl/RC_Perl_Intro.pdf

]]> Jitendra Narayan https://bioinformaticsonline.com/view/2379 Wed, 14 Aug 2013 15:43:06 -0500 https://bioinformaticsonline.com/view/2379 <![CDATA[Which Perl distribution should I choose for bioinformatics study : ActivePerl, Strawberry Perl, DWIM Perl, Citrus Perl ?]]> I'm new to bioinformatics and recently started learning Perl. I found several rival distributions available for Windows platform, which confuse me at the begining.

I google it and found that Strawberry comes with additional dev tools to compile CPAN modules if necessary. Whereas ActivePerl has a lot of prepackaged modules which are easier to install with PPM. In addition, DWIM Perl contains the standard Perl and a lot of extension and Citrus Perl is a binary distribution of Perl created for GUI application developers. 

Now, I wonder what should I pick to get started? 

Note: I am going to use BioPerl in near future.

http://dwimperl.com/

http://www.activestate.com/activeperl

http://www.citrusperl.com/

http://strawberryperl.com/

]]> Manshi Raghubanshi https://bioinformaticsonline.com/file/view/5307/clean-the-fasta-file Thu, 03 Oct 2013 14:19:14 -0500 https://bioinformaticsonline.com/file/view/5307/clean-the-fasta-file <![CDATA[Clean the FASTA file]]> Mostly FASTA file contain NNN characters, which can be replace by random A T G C character with this perl script. It also print the FASTA sequence name, N's counts, nucleotide count and percentage details at command prompt/standard output.

 

]]> Jit https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics Sun, 24 May 2015 09:28:33 -0500 https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics <![CDATA[Perl One liner basics !!]]> Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

]]> Abhimanyu Singh https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl Tue, 09 Jun 2015 23:38:44 -0500 https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl <![CDATA[Frequent words problem solution by Perl]]>

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

]]> Jit