<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/35131?offset=180</link>
	<atom:link href="https://bioinformaticsonline.com/related/35131?offset=180" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34418/spades-hybrid-genome-assembly</guid>
	<pubDate>Mon, 27 Nov 2017 08:05:40 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34418/spades-hybrid-genome-assembly</link>
	<title><![CDATA[SPAdes hybrid genome assembly]]></title>
	<description><![CDATA[<p>When you have both Illumina and Nanopore data, then SPAdes remains a good option for hybrid assembly - SPAdes was used to produce the&nbsp;<a href="https://gigascience.biomedcentral.com/articles/10.1186/s13742-015-0101-6">B fragilis assembly</a>&nbsp;by Mick Watson&rsquo;s group.</p><p>Again, running spades.py will show you the options:</p><div><pre><code>spades.py
</code></pre></div><p>This produces:</p><div><pre><code>SPAdes genome assembler v3.10.1

Usage: /usr/local/SPAdes-3.10.1-Linux/bin/spades.py [options] -o &lt;output_dir&gt;

Basic options:
-o      &lt;output_dir&gt;    directory to store all the resulting files (required)
--sc                    this flag is required for MDA (single-cell) data
--meta                  this flag is required for metagenomic sample data
--rna                   this flag is required for RNA-Seq data
--plasmid               runs plasmidSPAdes pipeline for plasmid detection
--iontorrent            this flag is required for IonTorrent data
--test                  runs SPAdes on toy dataset
-h/--help               prints this usage message
-v/--version            prints version

Input data:
--12    &lt;filename&gt;      file with interlaced forward and reverse paired-end reads
-1      &lt;filename&gt;      file with forward paired-end reads
-2      &lt;filename&gt;      file with reverse paired-end reads
-s      &lt;filename&gt;      file with unpaired reads
--pe&lt;#&gt;-12      &lt;filename&gt;      file with interlaced reads for paired-end library number &lt;#&gt; (&lt;#&gt; = 1,2,..,9)
--pe&lt;#&gt;-1       &lt;filename&gt;      file with forward reads for paired-end library number &lt;#&gt; (&lt;#&gt; = 1,2,..,9)
--pe&lt;#&gt;-2       &lt;filename&gt;      file with reverse reads for paired-end library number &lt;#&gt; (&lt;#&gt; = 1,2,..,9)
--pe&lt;#&gt;-s       &lt;filename&gt;      file with unpaired reads for paired-end library number &lt;#&gt; (&lt;#&gt; = 1,2,..,9)
--pe&lt;#&gt;-&lt;or&gt;    orientation of reads for paired-end library number &lt;#&gt; (&lt;#&gt; = 1,2,..,9; &lt;or&gt; = fr, rf, ff)
--s&lt;#&gt;          &lt;filename&gt;      file with unpaired reads for single reads library number &lt;#&gt; (&lt;#&gt; = 1,2,..,9)
--mp&lt;#&gt;-12      &lt;filename&gt;      file with interlaced reads for mate-pair library number &lt;#&gt; (&lt;#&gt; = 1,2,..,9)
--mp&lt;#&gt;-1       &lt;filename&gt;      file with forward reads for mate-pair library number &lt;#&gt; (&lt;#&gt; = 1,2,..,9)
--mp&lt;#&gt;-2       &lt;filename&gt;      file with reverse reads for mate-pair library number &lt;#&gt; (&lt;#&gt; = 1,2,..,9)
--mp&lt;#&gt;-s       &lt;filename&gt;      file with unpaired reads for mate-pair library number &lt;#&gt; (&lt;#&gt; = 1,2,..,9)
--mp&lt;#&gt;-&lt;or&gt;    orientation of reads for mate-pair library number &lt;#&gt; (&lt;#&gt; = 1,2,..,9; &lt;or&gt; = fr, rf, ff)
--hqmp&lt;#&gt;-12    &lt;filename&gt;      file with interlaced reads for high-quality mate-pair library number &lt;#&gt; (&lt;#&gt; = 1,2,..,9)
--hqmp&lt;#&gt;-1     &lt;filename&gt;      file with forward reads for high-quality mate-pair library number &lt;#&gt; (&lt;#&gt; = 1,2,..,9)
--hqmp&lt;#&gt;-2     &lt;filename&gt;      file with reverse reads for high-quality mate-pair library number &lt;#&gt; (&lt;#&gt; = 1,2,..,9)
--hqmp&lt;#&gt;-s     &lt;filename&gt;      file with unpaired reads for high-quality mate-pair library number &lt;#&gt; (&lt;#&gt; = 1,2,..,9)
--hqmp&lt;#&gt;-&lt;or&gt;  orientation of reads for high-quality mate-pair library number &lt;#&gt; (&lt;#&gt; = 1,2,..,9; &lt;or&gt; = fr, rf, ff)
--nxmate&lt;#&gt;-1   &lt;filename&gt;      file with forward reads for Lucigen NxMate library number &lt;#&gt; (&lt;#&gt; = 1,2,..,9)
--nxmate&lt;#&gt;-2   &lt;filename&gt;      file with reverse reads for Lucigen NxMate library number &lt;#&gt; (&lt;#&gt; = 1,2,..,9)
--sanger        &lt;filename&gt;      file with Sanger reads
--pacbio        &lt;filename&gt;      file with PacBio reads
--nanopore      &lt;filename&gt;      file with Nanopore reads
--tslr  &lt;filename&gt;      file with TSLR-contigs
--trusted-contigs       &lt;filename&gt;      file with trusted contigs
--untrusted-contigs     &lt;filename&gt;      file with untrusted contigs

Pipeline options:
--only-error-correction runs only read error correction (without assembling)
--only-assembler        runs only assembling (without read error correction)
--careful               tries to reduce number of mismatches and short indels
--continue              continue run from the last available check-point
--restart-from  &lt;cp&gt;    restart run with updated options and from the specified check-point ('ec', 'as', 'k&lt;int&gt;', 'mc')
--disable-gzip-output   forces error correction not to compress the corrected reads
--disable-rr            disables repeat resolution stage of assembling

Advanced options:
--dataset       &lt;filename&gt;      file with dataset description in YAML format
-t/--threads    &lt;int&gt;           number of threads
                                [default: 16]
-m/--memory     &lt;int&gt;           RAM limit for SPAdes in Gb (terminates if exceeded)
                                [default: 250]
--tmp-dir       &lt;dirname&gt;       directory for temporary files
                                [default: &lt;output_dir&gt;/tmp]
-k              &lt;int,int,...&gt;   comma-separated list of k-mer sizes (must be odd and
                                less than 128) [default: 'auto']
--cov-cutoff    &lt;float&gt;         coverage cutoff value (a positive float number, or 'auto', or 'off') [default: 'off']
--phred-offset  &lt;33 or 64&gt;      PHRED quality offset in the input reads (33 or 64)
                                [default: auto-detect]
</code></pre></div><p>As you can see this is also a &ldquo;pipeline&rdquo; of tools that can be switched on or off. SPAdes takes quite a long time, so for the purposes of this practical, something like this may suffice:</p><div><pre><code>spades.py -t 4 <span>\</span>
          -m 32 <span>\</span>
          -k 31,51,71 <span>\</span>
          --only-assembler <span>\</span>
          -1 miseq.1.fastq -2 miseq.2.fastq <span>\</span>
          --nanopore minion.fastq <span>\</span>
          -o hybrid_assembly
</code></pre></div><p>In turn, these parameters mean</p><ul>
<li>use 4 threads</li>
<li>max memory is 32Gb</li>
<li>use 3 kmer values to build the de bruijn graph(s) - 31, 51 and 71</li>
<li>only run the assembler, not the correction algorithm (for speed)</li>
<li>read 1 and read 2 of the MiSeq data</li>
<li>the nanopore data</li>
<li>put the output in folder &ldquo;hybrid_assembly&rdquo;</li>
</ul>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34567/jobtree-based-python-wrapper-to-run-the-genome-simulation-tool-suite-evolver</guid>
	<pubDate>Fri, 08 Dec 2017 16:26:32 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34567/jobtree-based-python-wrapper-to-run-the-genome-simulation-tool-suite-evolver</link>
	<title><![CDATA[jobTree based python wrapper to run the genome simulation tool suite Evolver]]></title>
	<description><![CDATA[<p><span>evolverSimControl</span><span>&nbsp;(</span><span>eSC</span><span>) can be used to simulate multi-chromosome genome evolution on an arbitrary phylogeny (</span><a href="http://evolution.genetics.washington.edu/phylip/newicktree.html">Newick format</a><span>). In addition to simply running evolver,&nbsp;</span><span>eSC</span><span>&nbsp;also automatically creates statistical summaries of the simulation as it runs including text and image files. Also included are convenience scripts to: check on a running simulation and see detailed status and logging information; extract fasta sequence files from the leaf nodes of a completed simulation; extract pairwise multiple alignment files (</span><a href="http://genome.ucsc.edu/FAQ/FAQformat.html#format5">.maf</a><span>) from leaf and branch nodes from a completed simulation and with the help of&nbsp;</span><a href="https://github.com/dentearl/mafTools/">mafJoin</a><span>, join them together into a single maf covering the entire simulation.</span></p><p>Address of the bookmark: <a href="https://github.com/dentearl/evolverSimControl" rel="nofollow">https://github.com/dentearl/evolverSimControl</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/34707/string-graph-based-genome-assembly-software-and-tools</guid>
	<pubDate>Tue, 19 Dec 2017 17:17:38 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/34707/string-graph-based-genome-assembly-software-and-tools</link>
	<title><![CDATA[String graph based genome assembly software and tools !]]></title>
	<description><![CDATA[<p>In&nbsp;<a href="https://en.wikipedia.org/wiki/Graph_theory" title="Graph theory">graph theory</a>, a&nbsp;<strong>string graph</strong>&nbsp;is an&nbsp;<a href="https://en.wikipedia.org/wiki/Intersection_graph" title="Intersection graph">intersection graph</a>&nbsp;of&nbsp;<a href="https://en.wikipedia.org/wiki/Curve" title="Curve">curves</a>&nbsp;in the plane; each curve is called a "string".&nbsp; String graphs were first proposed by E. W. Myers in a&nbsp;<a href="http://bioinformatics.oxfordjournals.org/content/21/suppl_2/ii79.full.pdf+html">2005 publication</a>.&nbsp;In&nbsp;recent&nbsp;<a href="http://genome.cshlp.org/content/early/2012/01/22/gr.126953.111">Genome Research paper</a>&nbsp;describing an innovative approach for assembling large genomes from NGS data caught our attention for several reasons. i) it give different "string graph" prospective of long lasting genome assembly problem ii) the&nbsp;paper is coauthored by Jared Simpson, the developer of&nbsp;<a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2694472/">ABySS assembler</a>&nbsp;and Richard Durbin. iii)&nbsp;Simpson-Durbin algorithm is that it does not rely on de Bruijn graphs, and instead employs a different graph construction approach called &lsquo;string graph&rsquo;.</p><p>Following are the genome assembly tools based on string graph:</p><p>1.SGA (String Graph Assembler)&nbsp;https://github.com/jts/sga</p><p>Assembles large genomes from high coverage short read data. SGA is designed as a modular set of programs, which are used to form an assembly pipeline. SGA implements a set of assembly algorithms based on the FM-index. As the FM-index is a compressed data structure, the algorithms are very memory efficient. The SGA assembly has three distinct phases. The first phase corrects base calling errors in the reads. The second phase assembles contigs from the corrected reads. The third phase uses paired end and/or mate pair data to build scaffolds from the contigs. The output of this software is a PDF report that allows the properties of the genome and data quality to be visually explored. By providing more information to the user at the start of an assembly project, this software will help increase awareness of the factors that make a given assembly easy or difficult, assist in the selection of software and parameters and help to troubleshoot an assembly if it runs into problems.</p><p>2.&nbsp;SAGE: String-overlap Assembly of GEnomes&nbsp;https://github.com/lucian-ilie/SAGE2</p><p>SAGE, for de novo genome assembly. As opposed to most assemblers, which are de Bruijn graph based, SAGE uses the string-overlap graph. SAGE builds upon great existing work on string-overlap graph and maximum likelihood assembly, bringing an important number of new ideas, such as the efficient computation of the transitive reduction of the string overlap graph, the use of (generalized) edge multiplicity statistics for more accurate estimation of read copy counts, and the improved use of mate pairs and min-cost flow for supporting edge merging. The assemblies produced by SAGE for several short and medium-size genomes compared favourably with those of existing leading assemblers.</p><p>3. FSG: Fast String Graph</p><p>The new integrated assembler has been assessed on a standard benchmark, showing that fast string graph (FSG) is significantly faster than SGA while maintaining a moderate use of main memory, and showing practical advantages in running FSG on multiple threads. Moreover, we have studied the effect of coverage rates on the running times.</p><p>4.&nbsp;&nbsp;BASE&nbsp;https://github.com/dhlbh/BASE</p><p>It enhances the classic seed-extension approach by indexing the reads efficiently to generate adaptive seeds that have high probability to appear uniquely in the genome. Such seeds form the basis for BASE to build extension trees and then to use reverse validation to remove the branches based on read coverage and paired-end information, resulting in high-quality consensus sequences of reads sharing the seeds. Such consensus sequences are then extended to contigs.&nbsp;BASE is a practically efficient tool for constructing contig, with significant improvement in quality for long NGS reads. It is relatively easy to extend BASE to include scaffolding.</p><p>5.&nbsp;Fermi&nbsp;https://github.com/lh3/fermi/</p><p>Fermi is a de novo assembler with a particular focus on assembling Illumina&nbsp;short sequence reads from a mammal-sized genome. In addition to the role of a&nbsp;typical assembler, fermi also aims to preserve heterozygotes which are often&nbsp;collapsed by other assemblers. Its ultimate goal is to find a minimal set of&nbsp;unitigs to represent all the information in raw reads.</p><p>If you want to learn about String Graph assembler, please read the following papers -</p><p>i)&nbsp;<a href="http://bioinformatics.oxfordjournals.org/content/21/suppl_2/ii79.full.pdf+html">The Fragment Assembly String Graph - E. W. Myers</a></p><p>This paper describes the String Graph concept.</p><p>ii)&nbsp;<a href="http://bioinformatics.oxfordjournals.org/content/26/12/i367.full#ref-20">Efficient construction of an assembly string graph using the FM-index - Jared T. Simpson and Richard Durbin</a></p><p>This earlier paper from Simpson and Durbin</p><p>iii)&nbsp;<a href="http://genome.cshlp.org/content/early/2012/01/22/gr.126953.111">Efficient de novo assembly of large genomes using compressed data structures - Jared T. Simpson and Richard Durbin</a></p><p>&nbsp;</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35432/mummer4-a-fast-and-versatile-genome-alignment-system</guid>
	<pubDate>Sat, 03 Feb 2018 04:59:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35432/mummer4-a-fast-and-versatile-genome-alignment-system</link>
	<title><![CDATA[MUMmer4: A fast and versatile genome alignment system]]></title>
	<description><![CDATA[<p><span>MUMmer4, a substantially improved version of MUMmer that addresses genome size constraints by changing the 32-bit suffix tree data structure at the core of MUMmer to a 48-bit suffix array, and that offers improved speed through parallel processing of input query sequences. With a theoretical limit on the input size of 141Tbp, MUMmer4 can now work with input sequences of any biologically realistic length. We show that as a result of these enhancements, the&nbsp;</span><span>nucmer</span><span>&nbsp;program in MUMmer4 is easily able to handle alignments of large genomes;&nbsp;</span></p><p>Address of the bookmark: <a href="https://mummer4.github.io/" rel="nofollow">https://mummer4.github.io/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36257/aligngraph-algorithm-for-secondary-de-novo-genome-assembly-guided-by-closely-related-references</guid>
	<pubDate>Tue, 17 Apr 2018 16:21:20 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36257/aligngraph-algorithm-for-secondary-de-novo-genome-assembly-guided-by-closely-related-references</link>
	<title><![CDATA[AlignGraph: algorithm for secondary de novo genome assembly guided by closely related references]]></title>
	<description><![CDATA[<p>AlignGraph is a software that extends and joins contigs or scaffolds by reassembling them with help provided by a reference genome of a closely related organism.</p>
<p>Using AlignGraph</p>
<pre><code>AlignGraph --read1 reads_1.fa --read2 reads_2.fa --contig contigs.fa --genome genome.fa --distanceLow distanceLow --distanceHigh distancehigh --extendedContig extendedContigs.fa --remainingContig remainingContigs.fa [--kMer k --insertVariation insertVariation --coverage coverage --part p --fastMap --ratioCheck --iterativeMap --misassemblyRemoval --resume]</code></pre>
<h3>&nbsp;</h3><p>Address of the bookmark: <a href="https://github.com/baoe/AlignGraph" rel="nofollow">https://github.com/baoe/AlignGraph</a></p>]]></description>
	<dc:creator>Manisha Mishra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</guid>
	<pubDate>Thu, 31 May 2018 06:00:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</link>
	<title><![CDATA[CrossMap: a program for convenient conversion of genome coordinates]]></title>
	<description><![CDATA[CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) &lt;&gt; hg19 (GRCh37), Mouse mm9 (MGSCv37) &lt;&gt; mm10 (GRCm38)).

It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF.

CrossMap is designed to liftover genome coordinates between assemblies. 

It’s not a program for aligning sequences to reference genome.

We do not recommend using CrossMap to convert genome coordinates between species.<p>Address of the bookmark: <a href="http://crossmap.sourceforge.net" rel="nofollow">http://crossmap.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</guid>
	<pubDate>Fri, 20 Jul 2018 10:03:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</link>
	<title><![CDATA[Converting a VCF into a FASTA given some reference !]]></title>
	<description><![CDATA[<p>Samtools/BCFtools (Heng Li) provides a Perl script&nbsp;<a href="https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl"><code>vcfutils.pl</code></a>&nbsp;which does this, the function&nbsp;<code>vcf2fq</code>&nbsp;(lines 469-528)</p><p>This script has been modified by others to convert InDels as well, e.g.&nbsp;<a href="https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl">this</a>&nbsp;by David Eccles</p><pre><code><span>./</span><span>vcf2fq</span><span>.</span><span>pl </span><span>-</span><span>f </span><span>&lt;</span><span>input</span><span>.</span><span>fasta</span><span>&gt;</span><span> </span><span>&lt;</span><span>all</span><span>-</span><span>site</span><span>.</span><span>vcf</span><span>&gt;</span><span> </span><span>&gt;</span><span> </span><span>&lt;</span><span>output</span><span>.</span><span>fastq</span><span>&gt;</span></code></pre><p>https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl</p><p>https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</guid>
	<pubDate>Thu, 14 May 2020 15:09:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</link>
	<title><![CDATA[LR_Gapcloser: a tiling path-based gap closer that uses long reads to complete genome assembly]]></title>
	<description><![CDATA[<p>LR_Gapcloser is a gap closing tool using long reads from studied species. The long reads could be downloaed from public read archive database (for instance, NCBI SRA database ) or be your own data. Then they are fragmented and aligned to scaffolds using BWA mem algorithm in BWA package. In the package, we provided a compiled bwa, so the user needn't to install bwa. LR_Gapcloser uses the alignments to find the bridging that cross the gap, and then fills the long read original sequence into the genomic gaps.</p><p>Address of the bookmark: <a href="https://github.com/CAFS-bioinformatics/LR_Gapcloser" rel="nofollow">https://github.com/CAFS-bioinformatics/LR_Gapcloser</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

</channel>
</rss>