<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/35148?offset=100</link>
	<atom:link href="https://bioinformaticsonline.com/related/35148?offset=100" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/88/regular-expression-cheat-sheet</guid>
	<pubDate>Tue, 09 Jul 2013 17:38:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/88/regular-expression-cheat-sheet</link>
	<title><![CDATA[Regular Expression Cheat Sheet]]></title>
	<description><![CDATA[<p><span>The Regular Expression are the sole of Perl language, and for bioinformatician it is just a magical stick to resolve gingatic string data. We did not find any good and user friendly regular expression cheat sheet, hence write our own cheat sheet.&nbsp;</span><span>The Regular Expressions Cheat Sheet, a quick reference guide for regular expressions, including symbols, ranges, grouping, assertions and some sample patterns to get you started.</span></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/88" length="14944" type="application/pdf" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/783/perl-module-installation</guid>
	<pubDate>Fri, 12 Jul 2013 11:19:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/783/perl-module-installation</link>
	<title><![CDATA[Perl Module Installation]]></title>
	<description><![CDATA[<p>Nice step wide information on perl module installation.</p><p>Address of the bookmark: <a href="http://bioinformaticsonline.com/blog/view/710/how-to-install-perl-modules-manually-using-cpan-command-and-other-quick-ways" rel="nofollow">http://bioinformaticsonline.com/blog/view/710/how-to-install-perl-modules-manually-using-cpan-command-and-other-quick-ways</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/fun/view/2053/perl-poem-parse-it-in-both-perl-and-english</guid>
	<pubDate>Mon, 12 Aug 2013 19:00:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/fun/view/2053/perl-poem-parse-it-in-both-perl-and-english</link>
	<title><![CDATA[Perl Poem: Parse it in both Perl and English!]]></title>
	<description><![CDATA[<p>Larry's, er, corpus has fortunately been overshadowed by that of the reigning Perl Poet, Sharon Hopkins. She has written quite a few Perl poems, as well as a paper on Perl poetry that she presented at the Usenix Winter 1992 Technical Conference, entitled "Camels and Needles: Computer Poetry Meets the Perl Programming Language". (The paper is available as misc/<a href="http://poetry.ps/" target="_blank">poetry.ps</a>&nbsp;on CPAN.) Besides being the most prolific Perl poet, Sharon is also the most widely published, having had the following poem published in both the Economist and the Guardian:</p><p>#!/usr/bin/perl</p><p>APPEAL:</p><p>listen (please, please);</p><p>open yourself, wide;<br />join (you, me),<br />connect (us,together),</p><p>tell me.</p><p>do something if distressed;</p><p>@dawn, dance;<br />@evening, sing;<br />read (books,$poems,stories) until peaceful;<br />study if able;</p><p>write me if-you-please;</p><p>sort your feelings, reset goals, seek (friends, family, anyone);</p><p>do*not*die (like this)<br />if sin abounds;</p><p>keys (hidden), open (locks, doors), tell secrets;<br />do not, I-beg-you, close them, yet.</p><p>accept (yourself, changes),<br />bind (grief, despair);</p><p>require truth, goodness if-you-will, each moment;</p><p>select (always), length(of-days)</p><p># listen (a perl poem)<br /># Sharon Hopkins<br /># rev. June 19, 1995</p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/4193/bioinformatics-101-running-blast</guid>
	<pubDate>Tue, 03 Sep 2013 14:59:50 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/4193/bioinformatics-101-running-blast</link>
	<title><![CDATA[Bioinformatics 101 -  Running BLAST]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/CYnjROfGXv8" frameborder="0" allowfullscreen></iframe>How to format the database for BLAST, run the command, view the output file, and use BioPerl and Perl to parse the output. By David Francis, Ohio State University. Delivered live at the Tomato Disease Workshop 2010. For more information, please visit http://www.extension.org/pages/32521/bioinformatics-101-video.]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/20471/bioinformatics-scripts</guid>
	<pubDate>Thu, 22 Jan 2015 22:29:39 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/20471/bioinformatics-scripts</link>
	<title><![CDATA[Bioinformatics Scripts]]></title>
	<description><![CDATA[<p>Some of the useful bioinformatics scripts.</p>
<p>For example ... contig-stats.pl is a Perl script that will automatically describe features of a sequence assembly.</p>
<p>http://milkweedgenome.org/?q=scripts</p><p>Address of the bookmark: <a href="http://milkweedgenome.org/?q=scripts" rel="nofollow">http://milkweedgenome.org/?q=scripts</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22569/reverse-complement-problem-solved-with-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:37:23 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22569/reverse-complement-problem-solved-with-perl</link>
	<title><![CDATA[Reverse Complement Problem Solved with Perl]]></title>
	<description><![CDATA[<p>Question at http://rosalind.info/problems/1b/</p><p>#Find the reverse complement of a DNA string.<br />#Given: A DNA string Pattern.<br />#Return: Pattern, the reverse complement of Pattern.<br /><br />use strict;<br />use warnings;<br /><br />my $string="AAAACCCGGT";<br />my $finalString="";<br />my %hash = (<br />&nbsp;&nbsp; &nbsp;"C" =&gt; "G", <br />&nbsp;&nbsp; &nbsp;"A" =&gt; "T", <br />&nbsp;&nbsp; &nbsp;"T" =&gt; "A", <br />&nbsp;&nbsp; &nbsp;"G" =&gt; "C",<br />);<br /><br />for (my $aa=0; $aa&lt;=(length($string)-1); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $char=substr $string, $aa, 1;<br />&nbsp;&nbsp; &nbsp;#print $hash{$char};<br />&nbsp;&nbsp; &nbsp;$finalString="$hash{$char}"."$finalString";<br />}<br /><br />print $finalString;<br />print "\n";</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/28141/csbb-v10</guid>
	<pubDate>Wed, 29 Jun 2016 07:33:05 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/28141/csbb-v10</link>
	<title><![CDATA[CSBB-v1.0]]></title>
	<description><![CDATA[<p>CSBB is a command line based bioinformatics suite to analyze biological data acquired through varied avenues of biological experiments. CSBB is implemented in Perl, while it also leverages the use of R and python in background for specific modules. Major focus of CSBB is to allow users from biology and bioinformatics community, to get benefited by performing down-stream analysis tasks while eliminating the need to write programming code. CSBB is currently available on Linux, UNIX, MAC OS and Windows platforms.</p>
<p>Currently CSBB provides 13 modules focused on analytical tasks like performing upper-quantile normalization on expression data or convert genome wide gene expression to z-scores when comparing expression data from different platforms.</p>
<p>More at&nbsp;https://github.com/skygenomics/CSBB-v1.0</p><p>Address of the bookmark: <a href="https://github.com/skygenomics/CSBB-v1.0" rel="nofollow">https://github.com/skygenomics/CSBB-v1.0</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/31976/snpgenie</guid>
	<pubDate>Thu, 30 Mar 2017 17:38:02 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/31976/snpgenie</link>
	<title><![CDATA[SNPGenie]]></title>
	<description><![CDATA[<p>SNPGenie is a Perl script for estimating evolutionary parameters, mainly from pooled next-generation sequencing (NGS) single-nucleotide polymorphism (SNP) variant data. SNP reports (acceptable in a variety of formats) much each correspond to a single population, with variants called relative to a single reference sequence (one sequence in one FASTA file). Just run the main script, <strong>snpgenie.pl</strong>, in a directory containing the necessary <a href="https://github.com/hugheslab/snpgenie#snpgenie-input">input files</a>, and we take care of the rest! For the earlier version, see <a href="http://ww2.biol.sc.edu/~austin/">Hughes Lab Bioinformatics Resource</a>.</p><p>Address of the bookmark: <a href="https://github.com/hugheslab/snpgenie" rel="nofollow">https://github.com/hugheslab/snpgenie</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>