More at https://www.nature.com/articles/s41592-023-01970-4

Address of the bookmark: https://github.com/seryrzu/unialigner

Understanding Large Language Models

LLMs are AI systems trained on extensive datasets of natural language. Their ability to model context, identify patterns, and generate coherent language has proven invaluable across domains, including bioinformatics. By fine-tuning these models on biological datasets, researchers can unlock insights into molecular biology, systems biology, and beyond.

Key Applications of LLMs in Bioinformatics

1. Annotating Biological Data

Annotating genomic and proteomic data is fundamental yet labor-intensive. LLMs streamline this process by extracting functional annotations from literature and databases, predicting gene and protein functions, and providing automated insights.

2. Mining Scientific Literature

The exponential growth of publications presents a challenge for researchers to stay updated. LLMs can process large volumes of text to extract key findings, summarize papers, and identify trends, thereby facilitating efficient literature reviews.

3. Predicting Gene and Protein Functions

By leveraging sequence data and annotations, LLMs can predict the functions of uncharacterized genes and proteins. This capability is particularly useful for studying non-model organisms and orphan genes.

4. Drug Discovery and Repurposing

LLMs enable pattern recognition across chemical, genomic, and clinical datasets, identifying novel drug candidates and repurposing existing drugs for new therapeutic targets. They can simulate interactions between drugs and biological molecules, accelerating the discovery pipeline.

5. Generating Hypotheses for Research

LLMs analyze complex datasets to propose testable hypotheses. For example, they can predict protein-protein interactions, identify regulatory motifs, or model evolutionary processes in genomes.

Advantages of LLMs in Bioinformatics

• Scalability: LLMs process massive datasets rapidly, reducing the time required for data analysis.

• Versatility: These models adapt to diverse bioinformatics tasks, from genomic annotation to network analysis.

• Contextual Insights: By synthesizing information across disparate datasets, LLMs provide integrative insights into biological systems.

Challenges in Applying LLMs

Despite their promise, LLMs face limitations:

• Data Quality and Bias: Inaccurate or biased datasets can affect model predictions, necessitating rigorous data curation.

• Interpretability: Understanding the decision-making process of LLMs remains a critical challenge, especially in high-stakes fields like genomics and medicine.

• Resource Intensity: Training and deploying LLMs require substantial computational power, which can limit accessibility.

• Ethical Concerns: Handling sensitive genomic data raises privacy and security issues, emphasizing the need for ethical guidelines.

Future Prospects

The continued development of LLMs tailored for bioinformatics promises exciting advancements. Specialized models trained on omics data, open-access platforms, and interdisciplinary collaborations will expand the utility of LLMs. Moreover, integrating LLMs with other AI technologies, such as graph neural networks and reinforcement learning, can unlock deeper biological insights.

Conclusion

Large language models are revolutionizing bioinformatics by addressing longstanding challenges in data annotation, literature mining, and function prediction. Their ability to analyze complex biological datasets efficiently positions them as indispensable tools for modern research. As bioinformatics embraces AI, the synergy between LLMs and biological sciences holds the potential to unravel the complexities of life with unprecedented precision and scale.

1. Learn and get updated

Some of the bad biological programmers only learn new technical or non-technical things when it’s absolutely necessary. The good biological programmers learn new technical skills proactively. But great biological programmers not only learn new technical skills on their own but also learn non-technical skills, and have an open mind to sources of knowledge that others may shut out.

In other concrete term, the bad biological programmer learn Perl's regular expression when they started a project on comparative genomics; the good biological programmer learned it a year before because it looked interesting; and the great biological programmer also read about the BioPerl packages, genomics, DNA string, genomic theories, or some similar course of study so that they could understand the results and explain it biologically.

2. Not a merely coder!!!

I often encountered with biological programmer who call themself a hard-core computer programmer and avoid biology. I can almost guarantee that if you are one of them then you are not doing research but merely writing "dry" codes.

According to my supervisor most of the computational biologist, don't know what they are doing biologically. Even they struggle to explain their own programs output and results. Therefore, It is highly advisable to learn basic of biology which can assist you to explain the result and understand your discovery. Always remember you are a researcher not a coder.

3. Be Social with biologist

The computational biologist spends most of the time in from of computers, writing codes. They always think their job is to produce working codes, not technical research perfections. But, they are completely wrong. You should not forget that apart from your computational skills you also need some biologist, other than your supervisor, to explain and make you understand the complex biological mechanism.

I highly recommend your to interact with biotech researchers and learn how do they explain their one graph (which they generally produce after one year of work) biologically. Remember, the origin of your research project is complex biological phenomenon, which is more complex than that of your limited programming rules.

4. Do not search, research for answers

Researching for answers means more than typing several keywords into a search engine or posting a question at Stack Overflow or the BioStars forums. I have entered problems into search engines that generate no results, and every question I posted on Stack Overflow or the BioStars forums never got anything resembling an answer, yet I solved the issues and moved on. I’m not a magician — I just know how to find answers or discover root causes.

Many problems are situational, and if you depend on search engines and forums, you can waste a lot of time going down a rabbit hole and possibly never getting a solution. Learn to perform root cause analysis, learn enough about the underlying system to look for other clues and solutions, and learn to take a long distance view of an issue before deep diving into it.

5. Love and defend your research

You cannot rise to the top in this research profession without loving your work. There are some very good “it’s just a job” biological programmers (I’ve been one at times), but if that is your outlook, you won’t be willing to do whatever it takes to succeed. This idea gets a lot of folks in a huff, because they feel it is a personal insult. “I’m a good programmer, but I have other priorities and can’t make work my life.” I understand completely; I have other priorities too. As much as I hate to say it, when I am passionate about my work, I am willing (though not eager) to abandon my other priorities to finish the job. It is not an insult to say that if you aren’t willing to pull out all the stops you can’t be the best, it is a fact.

You must be passionate about more than programming — you must also be excited about your research, the tools and technology you are using, and so on. I have seen very good and even great biological programmers operating at mediocre levels because something was not a good fit, such as they hated the project or were using a technology they disliked. Therefore, like your research project and get excited about your discoveries. You have not only to discover but also defend your finding with scientific words.

Thanks to all of you for reading.

http://ritg.med.harvard.edu/training/perl/RC_Perl_Intro.pdf

I google it and found that Strawberry comes with additional dev tools to compile CPAN modules if necessary. Whereas ActivePerl has a lot of prepackaged modules which are easier to install with PPM. In addition, DWIM Perl contains the standard Perl and a lot of extension and Citrus Perl is a binary distribution of Perl created for GUI application developers. 

Now, I wonder what should I pick to get started? 

Note: I am going to use BioPerl in near future.

http://dwimperl.com/

http://www.activestate.com/activeperl

http://www.citrusperl.com/

http://strawberryperl.com/

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

ICRISAT is headquartered in Patancheru near Hyderabad, India, with two regional hubs and five country offices in sub-Saharan Africa. ICRISAT, established in 1972, is a member of the CGIAR Consortium. For more details, see www.icrisat.org.

Responsibilities:Design efficient SQL queries for pulling large sequencing projects.
Serve as a technical adviser to the project leadership and provide computational perspective on product design and deliverability.
Develop and oversee a rapid and incremental software development and release schedule.
Design the software architecture, oversee the implementation and evolution of the design on appropriate hardware platforms.
Working collaboratively in a team environment to design, code, test, debug, and document programs for an integrated genomic analysis pipeline in a rapid and incremental software development and release schedule.
Supervise and review code development and ensure that software products meet project objectives in terms of functionality, scalability, robustness and user experience.
Implement and oversee the QA/QC practices to ensure the development team is adhering to quality standards.
Work closely with the application specialist to integrate feedbacks from teams in each CGIAR center into software customization and improvement.
Assist in training of breeders in the CGIAR centers to use software developed.
Personal Profile:

The applicant should have:

Understanding of genomics data and advanced knowledge of Java, and C/C++ as the programming languages and any of the scripting language like perl and/or Python, SQL
High Performance Computing, data architecture, database platforms and QA/QC practices in software engineering.
She/he should have solid experience in software development projects, preferably as a senior programmer or in the software project management role, and in projects involving big data.
Excellent communication skills are needed to work in this multi-disciplinary, multi-location and multi-cultural team.
Ability to mentor colleagues in quality software development practices is desired.
Educational Qualification : Ph. D or Masters Degree in Computational Biology / Computational Genomics or Equivalent with Research Experience in Mentioned Areas.

More at http://www.icrisat.org/careers/