This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

kallisto

The bpRNA code is written in perl and requires the Graph perl module. Several additional scripts for analysis are included. The source code is available at http://github.com/hendrixlab/bpRNA.

Address of the bookmark: http://github.com/hendrixlab/bpRNA

Other tools

https://github.com/shenwei356/taxonkit

• ETE, version: 3.1.1
• BioPython, version: 1.73
• taxadb, version: 0.10.1
• TaxonKit, version: 0.5.0

Address of the bookmark: https://pypi.org/project/ete3/3.1.1/

Currently, netGO supports analysis for four species (Human, Mouse, Arabidopsis thaliana,and Yeast)
These data are available from netGO-Data repository.

https://academic.oup.com/bioinformatics/advance-article/doi/10.1093/bioinformatics/btaa077/5728635

Address of the bookmark: https://github.com/unistbig/netGO

Address of the bookmark: https://breedbase.org/

http://www.bioinf.jku.at/software/kebabs/

http://bioconductor.org/packages/release/bioc/vignettes/kebabs/inst/doc/kebabs.pdf

Address of the bookmark: http://www.bioinf.jku.at/software/kebabs/

https://csgillespie.github.io/efficientR/

https://r-graphics.org/

https://rstudio-education.github.io/hopr/

https://r-pkgs.org/

https://r4ds.had.co.nz/

Address of the bookmark: https://r-graphics.org/

The postdocs will join an international group and network of researchers at the University of Vienna studying a diverse range of species and questions in molecular evolution, development, morphology and genomics. Our group is also part of the large evolVienna network of more than 50 evolutionary biology labs in Vienna, across several universities and research institutes. Our Faculty will be relocating to a new campus at the Vienna Biocenter in summer 2021 (https://biologiezentrum.univie.ac.at/en/). Vienna is a vibrant historic European capital with a high QOL. Information about postdoctoral salaries in Austria can be found on this webpage: https://www.fwf.ac.at/en/research-funding/personnel-costs/

Earliest start date will be after July 2021. Initial term of employment is for two years with the possibility of extension. Remote working, at least initially, is a possibility.

Requirements:
- PhD degree or equivalent by the start date
- Publishing record in peer-reviewed journals or evidence thereof
- At least 2 letters of support

Applications including a letter of motivation should be submitted via the Job Center to the University of Vienna (https://personalwesen.univie.ac.at/en/jobs-recruiting/job-center/,
job reference number 11615).

Application deadline: January 15th 2021.
Application link: https://univis.univie.ac.at/ebewerbung

The University of Idaho is in Moscow, a small college town located in
Northern Idaho on the Washington border. Moscow is widely considered to
be a great place to live, and it's known for a pleasant downtown, active
farmer's market, and nearby recreational opportunities. All of Moscow
is within biking or walking distance of the University of Idaho. For
more information about Moscow, see https://visitmoscowid.com/.

The University of Idaho has very strong faculty in evolution and
genomics in multiple departments and interdisciplinary programs. Of
particular note are the Bioinformatics and Computational Biology
Program (BCB: https://www.uidaho.edu/sci/bcb/people/faculty) and
the Institute for Bioinformatics and Evolutionary Studies (IBEST:
https://www.ibest.uidaho.edu/index.php). In addition, the University of
Idaho is only eight miles from Washington State University in Pullman, and
faculty from the two institutions interact and collaborate extensively.

Minimum qualifications include: a Ph.D. in biological sciences,
bioinformatics, or a related discipline; experience conducting research
in genomics or evolutionary biology, as evidenced by publications
in peer-reviewed journals; and evidence of strong written and oral
communication skills. Experience analyzing next-generation sequence
data and familiarity with the genomics of marine fishes are desirable
but not required.

Apply at: https://uidaho.peopleadmin.com/postings/30003

Review of applications will begin January 15, 2021. The start date
is flexible.

The University of Idaho is an equal opportunity/Affirmative Action/equal
access employer.

Informal inquiries are encouraged and can be directed to Adam Jones
(adamjones@uidaho.edu).

"adamjones@uidaho.edu"