<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/35384?offset=470</link>
	<atom:link href="https://bioinformaticsonline.com/related/35384?offset=470" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34867/magic-blast-a-tool-for-mapping-large-next-generation-rna-or-dna-sequencing-runs-against-a-whole-genome-or-transcriptome</guid>
	<pubDate>Tue, 26 Dec 2017 22:23:39 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34867/magic-blast-a-tool-for-mapping-large-next-generation-rna-or-dna-sequencing-runs-against-a-whole-genome-or-transcriptome</link>
	<title><![CDATA[Magic-BLAST: a tool for mapping large next-generation RNA or DNA sequencing runs against a whole genome or transcriptome.]]></title>
	<description><![CDATA[<p>Magic-BLAST is a tool for mapping large next-generation RNA or DNA sequencing runs against a whole genome or transcriptome. Each alignment optimizes a composite score, taking into account simultaneously the two reads of a pair, and in case of RNA-seq, locating the candidate introns and adding up the score of all exons. This is very different from other versions of BLAST, where each exon is scored as a separate hit and read-pairing is ignored.</p>
<p>Magic-BLAST incorporates within the NCBI BLAST code framework ideas developed in the NCBI Magic pipeline, in particular hit extensions by local walk and jump&nbsp;<a href="http://www.ncbi.nlm.nih.gov/pubmed/26109056">(http://www.ncbi.nlm.nih.gov/pubmed/26109056)</a>, and recursive clipping of mismatches near the edges of the reads, which avoids accumulating artefactual mismatches near splice sites and is needed to distinguish short indels from substitutions near the edges.</p><p>Address of the bookmark: <a href="https://ncbi.github.io/magicblast/" rel="nofollow">https://ncbi.github.io/magicblast/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41158/carefully-opt-for-human-reference-genome</guid>
	<pubDate>Tue, 18 Feb 2020 07:43:32 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41158/carefully-opt-for-human-reference-genome</link>
	<title><![CDATA[Carefully opt for human reference genome]]></title>
	<description><![CDATA[<p><a href="http://lh3.github.io/2017/11/13/which-human-reference-genome-to-use" target="_blank">Heng Li posted several issues with the human reference genomes given in these resources</a> and suggests the following compressed FASTA file to be used as hg38/GRCh38 human reference genome.</p>
<p>if you map reads to GRCh38 or hg38, use the following:</p>
<div>
<div>
<pre><code>ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/405/GCA_000001405.15_GRCh38/seqs_for_alignment_pipelines.ucsc_ids/GCA_000001405.15_GRCh38_no_alt_analysis_set.fna.gz
</code></pre>
</div>
</div>
<p>There are several other versions of GRCh37/GRCh38. What&rsquo;s wrong with them? Here are a collection of potential issues:</p>
<p>More at http://lh3.github.io/2017/11/13/which-human-reference-genome-to-use</p><p>Address of the bookmark: <a href="http://lh3.github.io/2017/11/13/which-human-reference-genome-to-use" rel="nofollow">http://lh3.github.io/2017/11/13/which-human-reference-genome-to-use</a></p>]]></description>
	<dc:creator>biogeek</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36533/mecat-fast-mapping-error-correction-and-de-novo-assembly-for-single-molecule-sequencing-reads</guid>
	<pubDate>Fri, 11 May 2018 05:07:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36533/mecat-fast-mapping-error-correction-and-de-novo-assembly-for-single-molecule-sequencing-reads</link>
	<title><![CDATA[MECAT: fast mapping, error correction, and de novo assembly for single-molecule sequencing reads]]></title>
	<description><![CDATA[<p>MECAT is an ultra-fast Mapping, Error Correction and de novo Assembly Tools for single molecula sequencing (SMRT) reads. MECAT employs novel alignment and error correction algorithms that are much more efficient than the state of art of aligners and error correction tools. MECAT can be used for effectively de novo assemblying large genomes. For example, on a 32-thread computer with 2.0 GHz CPU , MECAT takes 9.5 days to assemble a human genome based on 54x SMRT data, which is 40 times faster than the current&nbsp;<a href="http://cbcb.umd.edu/software/pbcr/mhap/">PBcR-Mhap pipeline</a>. MECAT performance were compared with&nbsp;<a href="http://cbcb.umd.edu/software/pbcr/mhap/">PBcR-Mhap pipeline</a>,&nbsp;<a href="https://github.com/PacificBiosciences/falcon">FALCON</a>&nbsp;and&nbsp;<a href="http://canu.readthedocs.io/en/latest/">Canu(v1.3)</a>&nbsp;in five real datasets. The quality of assembled contigs produced by MECAT is the same or better than that of the&nbsp;<a href="http://cbcb.umd.edu/software/pbcr/mhap/">PBcR-Mhap pipeline</a>&nbsp;and&nbsp;<a href="https://github.com/PacificBiosciences/falcon">FALCON</a>.&nbsp;</p>
<p>https://www.nature.com/articles/nmeth.4432</p><p>Address of the bookmark: <a href="https://github.com/xiaochuanle/MECAT" rel="nofollow">https://github.com/xiaochuanle/MECAT</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</guid>
	<pubDate>Mon, 11 Jun 2018 03:08:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</link>
	<title><![CDATA[PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.]]></title>
	<description><![CDATA[We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler.

http://derisilab.ucsf.edu/software/price/<p>Address of the bookmark: <a href="http://derisilab.ucsf.edu/software/price/" rel="nofollow">http://derisilab.ucsf.edu/software/price/</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</guid>
	<pubDate>Fri, 20 Jul 2018 10:03:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</link>
	<title><![CDATA[Converting a VCF into a FASTA given some reference !]]></title>
	<description><![CDATA[<p>Samtools/BCFtools (Heng Li) provides a Perl script&nbsp;<a href="https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl"><code>vcfutils.pl</code></a>&nbsp;which does this, the function&nbsp;<code>vcf2fq</code>&nbsp;(lines 469-528)</p><p>This script has been modified by others to convert InDels as well, e.g.&nbsp;<a href="https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl">this</a>&nbsp;by David Eccles</p><pre><code><span>./</span><span>vcf2fq</span><span>.</span><span>pl </span><span>-</span><span>f </span><span>&lt;</span><span>input</span><span>.</span><span>fasta</span><span>&gt;</span><span> </span><span>&lt;</span><span>all</span><span>-</span><span>site</span><span>.</span><span>vcf</span><span>&gt;</span><span> </span><span>&gt;</span><span> </span><span>&lt;</span><span>output</span><span>.</span><span>fastq</span><span>&gt;</span></code></pre><p>https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl</p><p>https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</guid>
	<pubDate>Thu, 14 May 2020 15:09:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</link>
	<title><![CDATA[LR_Gapcloser: a tiling path-based gap closer that uses long reads to complete genome assembly]]></title>
	<description><![CDATA[<p>LR_Gapcloser is a gap closing tool using long reads from studied species. The long reads could be downloaed from public read archive database (for instance, NCBI SRA database ) or be your own data. Then they are fragmented and aligned to scaffolds using BWA mem algorithm in BWA package. In the package, we provided a compiled bwa, so the user needn't to install bwa. LR_Gapcloser uses the alignments to find the bridging that cross the gap, and then fills the long read original sequence into the genomic gaps.</p><p>Address of the bookmark: <a href="https://github.com/CAFS-bioinformatics/LR_Gapcloser" rel="nofollow">https://github.com/CAFS-bioinformatics/LR_Gapcloser</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37840/long-read-assembly-workshop</guid>
	<pubDate>Thu, 04 Oct 2018 17:23:18 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37840/long-read-assembly-workshop</link>
	<title><![CDATA[Long read assembly workshop !]]></title>
	<description><![CDATA[<p>This is a tutorial for a workshop on long-read (PacBio) genome assembly.</p>
<p>It demonstrates how to use long PacBio sequencing reads to assemble a bacterial genome, and includes additional steps for circularising, trimming, finding plasmids, and correcting the assembly with short-read Illumina data.</p>
<p>&nbsp;Please comment if you know any other long read addembly tutorial.</p><p>Address of the bookmark: <a href="http://sepsis-omics.github.io/tutorials/modules/cmdline_assembly_v2/" rel="nofollow">http://sepsis-omics.github.io/tutorials/modules/cmdline_assembly_v2/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38041/synima-a-synteny-imaging-tool-for-annotated-genome-assemblies</guid>
	<pubDate>Tue, 30 Oct 2018 10:49:13 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38041/synima-a-synteny-imaging-tool-for-annotated-genome-assemblies</link>
	<title><![CDATA[Synima: a Synteny imaging tool for annotated genome assemblies]]></title>
	<description><![CDATA[<p><span>Synima written in Perl, which uses the graphical features of R. Synima takes orthologues computed from reciprocal best BLAST hits or OrthoMCL, and DAGchainer, and outputs an overview of genome-wide synteny in PDF. Each of these programs are included with the Synima package, and a pipeline for their use. Synima has a range of graphical parameters including size, colours, order, and labels, which are specified in a config file generated by the first run of Synima &ndash; and can be subsequently edited. Synima runs quickly on a command line to generate informative and publication quality figures. Synima is open source and freely available from&nbsp;</span><a href="https://github.com/rhysf/Synima" target="_blank">https://github.com/rhysf/Synima</a><span>&nbsp;under the MIT License.</span></p><p>Address of the bookmark: <a href="https://github.com/rhysf/Synima" rel="nofollow">https://github.com/rhysf/Synima</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38208/anitools-web-a-web-tool-for-fast-genome-comparison-within-multiple-bacterial-strains</guid>
	<pubDate>Wed, 14 Nov 2018 04:34:23 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38208/anitools-web-a-web-tool-for-fast-genome-comparison-within-multiple-bacterial-strains</link>
	<title><![CDATA[ANItools web: a web tool for fast genome comparison within multiple bacterial strains]]></title>
	<description><![CDATA[<p><span>ANItools is a software package written by PERL scripts that can be run in a Linux/Unix system. If you want to compare bacterial genomes and calculate their average nucleotide identity (ANI), you could download and run this program directly. Or you could send us the genome sequence by email. Then we will do the analysis work for you.</span></p>
<p><span>https://academic.oup.com/database/article/doi/10.1093/database/baw084/2630454</span></p><p>Address of the bookmark: <a href="http://ani.mypathogen.cn/" rel="nofollow">http://ani.mypathogen.cn/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>