<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/35798?offset=0</link>
	<atom:link href="https://bioinformaticsonline.com/related/35798?offset=0" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42672/introduction-to-bioinformatics-and-computational-biology</guid>
	<pubDate>Mon, 25 Jan 2021 01:32:30 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42672/introduction-to-bioinformatics-and-computational-biology</link>
	<title><![CDATA[Introduction to Bioinformatics and Computational Biology]]></title>
	<description><![CDATA[<p><span>This is the course material for STAT115/215 BIO/BST282 at Harvard University.</span></p>
<p>Xiaole Shirley Liu (lead instructor)<br>Joshua Starmer<br>Martin Hemberg<br>Ting Wang<br>Feng Yue</p>
<p>Ming Tang<br>Yang Liu<br>Jack Kang<br>Scarlett Ge<br>Jiazhen Rong<br>Phillip Nicol<br>Maartin De Vries</p>
<p>We thank many colleagues in the community, who helped Dr.&nbsp;Liu in prepare the STAT115/215 BIO/BST282 course over the years.&nbsp;</p><p>Address of the bookmark: <a href="https://liulab-dfci.github.io/bioinfo-combio/" rel="nofollow">https://liulab-dfci.github.io/bioinfo-combio/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/26539/scikit-learn</guid>
	<pubDate>Mon, 29 Feb 2016 17:39:24 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/26539/scikit-learn</link>
	<title><![CDATA[scikit-learn]]></title>
	<description><![CDATA[<p>Machine Learning in Python</p>
<p>Simple and efficient tools for data mining and data analysis<br> Accessible to everybody, and reusable in various contexts<br> Built on NumPy, SciPy, and matplotlib<br> Open source, commercially usable - BSD license</p>
<p>More at&nbsp;http://scikit-learn.org/stable/index.html</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="http://scikit-learn.org/stable/auto_examples/index.html" rel="nofollow">http://scikit-learn.org/stable/auto_examples/index.html</a></p>]]></description>
	<dc:creator>Jitendra Prajapati</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/32076/ngs-teaching-material</guid>
	<pubDate>Wed, 05 Apr 2017 04:29:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/32076/ngs-teaching-material</link>
	<title><![CDATA[NGS teaching material]]></title>
	<description><![CDATA[<p><span>High throughput sequencing (HTS) technologies are being applied to a wide range of important topics in biology. However, the analyses of non-model organisms, for which little previous sequence information is available, pose specific problems. This course addresses the specific strengths and weaknesses of alternative HTS technologies, the computational resources needed for HTS, and how to analyze non-model species using HTS. The course consists of a practical training module, HTS bioinformatics training, and lecturing/seminars of HTS approaches specifically targeting non-model organisms.</span></p><p>Address of the bookmark: <a href="http://marinetics.org/teaching/hts/Assembly.html" rel="nofollow">http://marinetics.org/teaching/hts/Assembly.html</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/42815/bioinformatics-in-africa-part7-tunisia</guid>
	<pubDate>Sat, 06 Feb 2021 21:25:09 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/42815/bioinformatics-in-africa-part7-tunisia</link>
	<title><![CDATA[Bioinformatics in Africa: Part7 - Tunisia]]></title>
	<description><![CDATA[<p>Institut Pasteur de Tunis (IPT):<br />The IPT is a research institution founded in 1883. IPT is under the supervision of the Ministry of &nbsp;Health and is part of the Universit&eacute; El Manar of Tunis (Ministry of high Education). The missions &nbsp;of the institute are: Public Health Laboratory activities (PHL), Research on infectious diseases, and &nbsp;R/D on vaccines. Research programs are mainly oriented towards local health problems such as &nbsp;leishmaniais, viral hepatitis, and scorpion venoms. The &nbsp; group &nbsp; of &nbsp; Bioinformatics &nbsp; and &nbsp; Modelling &nbsp; of &nbsp; the &nbsp; IPT &nbsp; is &nbsp; hosted &nbsp; by &nbsp; the &nbsp;Laboratoire &nbsp;d&rsquo;Immunopathologie Vaccinologie et G&eacute;n&eacute;tique Mol&eacute;culaire &nbsp;(LIVGM), and exists since the &nbsp;beginning of 2005. Its present research activities include: genome annotation, EST clustering and &nbsp;modelling of the host/parasite response to Leishmania infection. It consists of two senior scientists, &nbsp;two PhD students and one MSc student</p><p>Centre&nbsp;de&nbsp;Biotechnology&nbsp;de&nbsp;Sfax&nbsp;(CBS):<br />Bioinformatics&nbsp;activity&nbsp;started&nbsp;at&nbsp;CBS&nbsp;in&nbsp;2001&nbsp;with&nbsp;the&nbsp;setting&shy;up&nbsp;of&nbsp;a&nbsp;research&nbsp;and&nbsp;service&nbsp;unit&nbsp;of&nbsp; bioinformatics.&nbsp;This&nbsp;unit&nbsp;currently&nbsp;includes&nbsp;one&nbsp;senior&nbsp;researcher,&nbsp;one&nbsp;engineer&nbsp;and&nbsp;four&nbsp;Phd&nbsp; students.&nbsp;Activities&nbsp;include&nbsp;sequence&nbsp;annotation&nbsp;(service)&nbsp;and&nbsp;three&nbsp;research&nbsp;programs:&nbsp;ab&nbsp;initio&nbsp; prediction&nbsp;of&nbsp;short&nbsp;eukaryote&nbsp;genes,&nbsp;statistical&nbsp;modelling&nbsp;by&nbsp;Bayesian&nbsp;networks&nbsp;approach&nbsp;of&nbsp;signal&nbsp; transduction&nbsp;pathways&nbsp;and&nbsp;statistical&nbsp;analysis&nbsp;of&nbsp;human&nbsp;sequence&nbsp;variation&nbsp;data&nbsp;(haplotype&nbsp; reconstruction&nbsp;and&nbsp;linkage&nbsp;disequilibrium).&nbsp;Activities&nbsp;of&nbsp;the&nbsp;Bioinformatics&nbsp;unit&nbsp;could&nbsp;be&nbsp;found&nbsp;at&nbsp; the&nbsp;website:&nbsp;http://www.cbs.rnrt.tn/&nbsp;and&nbsp;the&nbsp;research&nbsp;activity&nbsp;report&nbsp;is&nbsp;available&nbsp;under&nbsp;request&nbsp;to&nbsp; Bioinformatics@cbs.rnrt.tn.&nbsp;Although&nbsp;the&nbsp;computing&nbsp;facilities&nbsp;are&nbsp;good,&nbsp;there&nbsp;is&nbsp;still&nbsp;a&nbsp;need&nbsp;for&nbsp; trained&nbsp;human&nbsp;resources&nbsp;to&nbsp;strengthen&nbsp;bioinformatics&nbsp;capacities&nbsp;at&nbsp;CBS,&nbsp;particularly&nbsp;in&nbsp;structural&nbsp; bioinformatics.</p><p>Web site and links: http://www.cbs.rnrt.tn</p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/43272/bioinformatics-head-bioinformatics-manager-iii-cancer-genomics-research-laboratory-at-frederick-national-laboratory</guid>
  <pubDate>Wed, 18 Aug 2021 00:19:48 -0500</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatics Head (Bioinformatics Manager III), Cancer Genomics Research Laboratory at  Frederick National Laboratory]]></title>
  <description><![CDATA[
<p>Frederick National Laboratory seeking an enthusiastic, creative, and seasoned bioinformatics professional to join our leadership team and direct the exceptional Bioinformatics Group at the Cancer Genomics Research Laboratory (CGR).  CGR has a diverse team of bioinformatics and computational scientists that support all areas of bioinformatics and data analysis (infrastructure, data QC, pipeline development and maintenance, data curation and sharing, methodology development, statistical analyses, machine learning approaches, and scientific interpretation).</p>

<p>More at https://leidosbiomed.csod.com/ats/careersite/jobdetails.aspx?site=4&amp;c=leidosbiomed&amp;id=2040</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43323/biostarhandbook</guid>
	<pubDate>Fri, 27 Aug 2021 01:31:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43323/biostarhandbook</link>
	<title><![CDATA[biostarhandbook]]></title>
	<description><![CDATA[<p>Nice book collection for bioinformatician ... highly recommended.</p><p>Address of the bookmark: <a href="https://www.biostarhandbook.com/" rel="nofollow">https://www.biostarhandbook.com/</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/10925/a-brief-bioinformatics-tutorial</guid>
	<pubDate>Wed, 21 May 2014 12:50:09 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/10925/a-brief-bioinformatics-tutorial</link>
	<title><![CDATA[A Brief Bioinformatics Tutorial]]></title>
	<description><![CDATA[<p>This is about how to use a computer to find what is known about a gene of interest and also how to get new insights about it.</p>
<p>The tutorial is divided in three main parts:</p>
<ul>
<li>In the <strong>Sequence </strong>part, you will see how to look efficiently for a particular protein sequence, how to blast it against the database of your choice to find homologues, how to perform a multiple alignment of the homologues you've selected and how to edit this alignment.</li>
<li>The <strong>Structure </strong>part is about molecular visualization, homology modeling and structural domain prediction.</li>
<li>In the <strong>Function </strong>part, you will be introduced to you 3 useful servers to investigate the function of a protein. i.e. finding interactors, co-expressed genes, see a phylogenetic profile, easily access papers citing your gene etc ...</li>
</ul>
<p>During all the three parts, we will use the <em>S. cerevisiae </em>VPS36 protein as an example.</p><p>Address of the bookmark: <a href="http://www.mrc-lmb.cam.ac.uk/rlw/text/bioinfo_tuto/introduction.html" rel="nofollow">http://www.mrc-lmb.cam.ac.uk/rlw/text/bioinfo_tuto/introduction.html</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/21703/coding-ground</guid>
	<pubDate>Tue, 17 Mar 2015 00:47:20 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/21703/coding-ground</link>
	<title><![CDATA[Coding Ground]]></title>
	<description><![CDATA[<p>Online coding group for most of the programming languages.</p>
<p>Code in almost all popular languages using Coding Ground.&nbsp;Edit, compile, execute and share your projects, 100% cloud.</p>
<p>http://www.tutorialspoint.com/codingground.htm</p><p>Address of the bookmark: <a href="http://www.tutorialspoint.com/codingground.htm" rel="nofollow">http://www.tutorialspoint.com/codingground.htm</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/37610/applied-statistics-for-bioinformatics-using-r</guid>
	<pubDate>Thu, 30 Aug 2018 03:45:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/37610/applied-statistics-for-bioinformatics-using-r</link>
	<title><![CDATA[Applied Statistics for Bioinformatics using R]]></title>
	<description><![CDATA[<p>The purpose of this book is to give an introduction into statistics in order to solve some problems of bioinformatics. Statistics provides procedures to explore and visualize data as well as to test biological hypotheses. The book intends to be introductory in explaining and programming elementary statistical concepts, thereby bridging the gap between high school levels and the specialized statistical literature</p>]]></description>
	<dc:creator>Neel</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/37610" length="1368378" type="application/pdf" />
</item>

</channel>
</rss>