BOL: Related items

Mulan: Multiple-sequence local alignment and visualization for studying function and evolution

Jit — Fri, 24 Aug 2018 09:50:01 -0500

Mulan: Multiple-sequence local alignment and visualization for studying function and evolution

Mulan (http://mulan.dcode.org/), a novel method and a network server for comparing multiple draft and finished-quality sequences to identify functional elements conserved over evolutionary time. Mulan brings together several novel algorithms: the TBA multi-aligner program for rapid identification of local sequence conservation, and the multiTF program for detecting evolutionarily conserved transcription factor binding sites in multiple alignments. In addition, Mulan supports two-way communication with the GALA database; alignments of multiple species dynamically generated in GALA can be viewed in Mulan, and conserved transcription factor binding sites identified with Mulan/multiTF can be integrated and overlaid with extensive genome annotation data using GALA.

Address of the bookmark: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC540288/

GfaViz: flexible and interactive visualization of GFA sequence graphs

Jit — Thu, 23 Jan 2020 07:33:46 -0600

GFA (Graphical Fragment Assembly) is an emerging standard format for representing sequence graphs. Although it was originally conceived as a format for sequence assembly (hence the name), and this remains its core application, it is more general, and able to represent many different types of sequence graphs, including scaffolding graphs, alignment graphs, variant graphs and splicing graphs.

Address of the bookmark: https://github.com/ggonnella/gfaviz

Circos visualization !

BioStar — Mon, 06 Mar 2023 06:01:32 -0600

Circos visualization

https://wlcb.oit.uci.edu/modules/index.html

Address of the bookmark: https://wlcb.oit.uci.edu/NG-Circos

GenoFig: a user-friendly application for the visualization and comparison of genomic regions

BioStar — Mon, 05 Aug 2024 23:06:58 -0500

Tool for graphical vizualisation of annotated genetic regions, and homologous regions comparison. It is an independent recoding of Easyfig 2 initially developped by at the S. Beatson Lab [https://mjsull.github.io/Easyfig/]

Download the GenoFig source code using the 'Download' button on top of this page. Cloning is currently not available for people not member of the INRAE French Institution. After decompression, open a terminal in the folder containing the decompressed files and run:

conda env create -f extras/requirements.yml
extras/SETUP.sh

Address of the bookmark: https://forgemia.inra.fr/public-pgba/genofig

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

MEGAHIT: an ultra-fast single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph

Jit — Wed, 14 Nov 2018 04:50:27 -0600

MEGAHIT is a single node assembler for large and complex metagenomics NGS reads, such as soil. It makes use of succinct de Bruijn graph (SdBG) to achieve low memory assembly. MEGAHIT can optionally utilize a CUDA-enabled GPU to accelerate its SdBG contstruction. The GPU-accelerated version of MEGAHIT has been tested on NVIDIA GTX680 (4G memory) and Tesla K40c (12G memory) with CUDA 5.5, 6.0 and 6.5. MEGAHIT v1.0 or greater also supports IBM Power PC and has been tested on IBM POWER8.

https://academic.oup.com/bioinformatics/article/31/10/1674/177884

Address of the bookmark: https://github.com/voutcn/megahit

GraphUnzip: Phases an assembly graph using Hi-C data and/or long reads.

Jit — Fri, 05 Feb 2021 21:22:24 -0600

GraphUnzip, a fast, memory-efficient and accurate tool to unzip assembly graphs into their constituent haplotypes using long reads and/or Hi-C data. As GraphUnzip only connects sequences in the assembly graph that already had a potential link based on overlaps, it yields high-quality gap-less supercontigs. To demonstrate the efficiency of GraphUnzip, we tested it on a simulated diploid Escherichia coli genome, and on two real datasets for the genomes of the rotifer Adineta vaga and the potato Solanum tuberosum. In all cases, GraphUnzip yielded highly continuous phased assemblies.

https://www.biorxiv.org/content/biorxiv/early/2021/02/01/2021.01.29.428779.full.pdf

Address of the bookmark: https://github.com/nadegeguiglielmoni/GraphUnzip

GraphPath: A graph attention model for molecular stratification with interpretability based on the pathway-pathway interaction network

LEGE — Wed, 27 Mar 2024 20:51:21 -0500

Achieving accurate and interpretable clinical predictions requires paramount attention to thoroughly characterizing patients at both the molecular and biological pathway levels. In this paper, we present GraphPath, a biological knowledge-driven graph neural network with multi-head self-attention mechanism that implements the pathway-pathway interaction network. We train GraphPath to classify the cancer status of patients with prostate cancer based on their multi-omics profiling.

Address of the bookmark: https://github.com/amazingma/GraphPath

dcGOR

Martin Jones — Sat, 08 Nov 2014 14:54:28 -0600

An R package for analysing ontologies and protein domain annotations has been published in PLoS Computational Biology (http://dx.doi.org/10.1371/journal.pcbi.1003929). The package is distributed as part of CRAN (http://cran.r-project.org/package=dcGOR), and also at GitHub for version control.

The dedicated website is available in http://supfam.org/dcGOR, from which several demos are also provided:

1. Analysing SCOP domains: http://supfam.org/dcGOR/demo-Fang.html

2. Analysing Pfam domains: http://supfam.org/dcGOR/demo-Basu.html

3. Analysing InterPro domains: http://supfam.org/dcGOR/demo-Customisation.html

CANU: Assembling Large Genomes with Single-Molecule Sequencing and Locality Sensitive Hashing.

Jit — Tue, 26 Apr 2016 11:38:10 -0500

Canu is a fork of the Celera Assembler designed for high-noise single-molecule sequencing (such as the PacBio RSII or Oxford Nanopore MinION). The software is currently alpha level, feel free to use and report issues encountered.

Canu is a hierachical assembly pipeline which runs in four steps:

Detect overlaps in high-noise sequences using MHAP
Generate corrected sequence consensus
Trim corrected sequences
Assemble trimmed corrected sequences

Read the documentation

New release https://github.com/marbl/canu/releases

Address of the bookmark: https://github.com/marbl/canu