BOL: Related items

Fundamentals of Data Visualization by Claus O. Wilke

Abhi — Sat, 08 Jun 2024 16:07:19 -0500

The book is meant as a guide to making visualizations that accurately reflect the data, tell a story, and look professional. It has grown out of my experience of working with students and postdocs in my laboratory on thousands of data visualizations. Over the years, I have noticed that the same issues arise over and over. I have attempted to collect my accumulated knowledge from these interactions in the form of this book.

The entire book is written in R Markdown, using RStudio as my text editor and the bookdown package to turn a collection of markdown documents into a coherent whole. The book’s source code is hosted on GitHub, at https://github.com/clauswilke/dataviz.

Address of the bookmark: https://clauswilke.com/dataviz/

Bandage: interactive visualization of de novo genome assemblies

Shruti Paniwala — Mon, 04 Dec 2017 10:09:37 -0600

Bandage (a Bioinformatics Application for Navigating De novo Assembly Graphs Easily) is a tool for visualizing assembly graphs with connections. Users can zoom in to specific areas of the graph and interact with it by moving nodes, adding labels, changing colors and extracting sequences. BLAST searches can be performed within the Bandage graphical user interface and the hits are displayed as highlights in the graph. By displaying connections between contigs, Bandage presents new possibilities for analyzing de novo assemblies that are not possible through investigation of contigs alone.

Availability and implementation: Source code and binaries are freely available at https://github.com/rrwick/Bandage. Bandage is implemented in C++ and supported on Linux, OS X and Windows. A full feature list and screenshots are available at http://rrwick.github.io/Bandage.

Address of the bookmark: http://rrwick.github.io/Bandage/

xmatchview: smith-waterman alignment visualization

Rahul Nayak — Thu, 28 Dec 2017 09:00:58 -0600

xmatchview and xmatchview-conifer are imaging tools for comparing the synteny between DNA sequences. It allows users to align 2 DNA sequences in fasta format using cross_match and displays the alignment in a variety of image formats. xmatchview and xmatchview-conifer are written in python and run on linux and windows. They serve as visual tools for analyzing cross_match alignments. Cross_match (Green, P. (1994) http://www.phrap.org) uses an implementation of the Smith-Waterman algorithm for comparing DNA sequences that is sensitive.

http://www.bcgsc.ca/platform/bioinfo/software/xmatchview

Address of the bookmark: https://github.com/warrenlr/xmatchview

G-compass: a comparative genome browser

Jit — Thu, 12 Apr 2018 10:00:27 -0500

G-compass (http://www.h-invitational.jp/g-compass/) is a comparative genome browser. It visualizes evolutionarily conserved genomic regions between human and other 12 vertebrates based on original genome alignments pursuing higher coverage (1,2). Annotations of human genes/transcripts and their ortholog information were derived from H-InvDB and its subdatabase Evola, respectively. G-compass is available for free of charge. [ Sample ]

Address of the bookmark: http://www.h-invitational.jp/g-compass/

NanoPack: visualizing and processing long-read sequencing data

Jit — Fri, 10 Aug 2018 18:41:34 -0500

The NanoPack tools are written in Python3 and released under the GNU GPL3.0 License. The source code can be found at https://github.com/wdecoster/nanopack, together with links to separate scripts and their documentation. The scripts are compatible with Linux, Mac OS and the MS Windows 10 subsystem for Linux and are available as a graphical user interface, a web service at http://nanoplot.bioinf.be and command line tools.

https://academic.oup.com/bioinformatics/article/34/15/2666/4934939

Address of the bookmark: https://github.com/wdecoster/nanoQC

ZENBU: a collaborative, omics data integration and interactive visualization system

BioJoker — Fri, 04 Jan 2019 13:35:26 -0600

ZENBU is a data integration, data analysis, and visualization system enhanced for RNAseq, ChipSeq, CAGE and other types of next-generation-sequence-tag (NGS) based data. ZENBU allows for novel data exploration through "on-demand" data processing and interactive linked-visualizations and is able to make many-views from the same primary sequence alignment data which users can uploaded from BAM, BED, GFF and tab-text files.
Please check our documentation wiki for details on how to use the system, or check out some of the views above.

Address of the bookmark: http://fantom.gsc.riken.jp/zenbu/

PANEV: an R package for a pathway-based network visualization

Jit — Sun, 09 Feb 2020 12:41:52 -0600

PANEV (PAthway NEtwork Visualizer) is an R package set for gene/pathway-based network visualization. Based on information available on KEGG, it visualizes genes within a network of multiple levels (from 1 to n) of interconnected upstream and downstream pathways. The network graph visualization helps to interpret functional profiles of a cluster of genes.

https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-020-3371-7

Address of the bookmark: https://github.com/vpalombo/PANEV

Proksee: in-depth characterization and visualization of bacterial genomes

LEGE — Tue, 09 May 2023 19:38:52 -0500

Proksee is an expert system for genome assembly, annotation and visualization. To begin using Proksee, provide a complete genome sequence, sequencing reads or a CGView/Proksee map JSON file.

Address of the bookmark: https://proksee.ca/

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

ChopStitch: exon annotation and splice graph construction using transcriptome assembly and whole genome sequencing data

Rahul Nayak — Tue, 03 Jul 2018 04:14:52 -0500

ChopStitch is a new method for finding putative exons and constructing splice graphs using an assembled transcriptome and whole genome shotgun sequencing (WGSS) data. ChopStitch identifies exon-exon boundaries in de novo assembled RNA-seq data with the help of a Bloom filter that represents the k-mer spectrum of WGSS reads. The algorithm also detects base substitutions in transcript sequences corresponding to sequencing or assembly errors, haplotype variations, or putative RNA editing events. The primary output of our tool is a FASTA file containing putative exons. Further, exon edges are interrogated for alternative exon-exon boundaries to detect transcript isoforms, which are reported as splice graphs in dot output format.

Address of the bookmark: https://github.com/bcgsc/ChopStitch