<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/35923?</link>
	<atom:link href="https://bioinformaticsonline.com/related/35923?" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34600/converting-blast-output-into-csv</guid>
	<pubDate>Mon, 11 Dec 2017 04:17:58 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34600/converting-blast-output-into-csv</link>
	<title><![CDATA[Converting BLAST output into CSV]]></title>
	<description><![CDATA[<p>Suppose we wanted to do something with all this BLAST output. Generally, that&rsquo;s the case - you want to retrieve all matches, or do a reciprocal BLAST, or something.</p><p>As with most programs that run on UNIX, the text output is in some specific format. If the program is popular enough, there will be one or more parsers written for that format &ndash; these are just utilities written to help you retrieve whatever information you are interested in from the output.</p><p>Let&rsquo;s conclude this tutorial by converting the BLAST output in out.txt into a spreadsheet format, using a Python script.&nbsp;</p><p>First, we need to get the script. We&rsquo;ll do that using the &lsquo;git&rsquo; program:</p><div><div><pre>git clone <a href="https://github.com/ngs-docs/ngs-scripts.git">https://github.com/ngs-docs/ngs-scripts.git</a> /root/ngs-scripts
</pre></div></div><p>We&rsquo;ll discuss &lsquo;git&rsquo; more later; for now, just think of it as a way to get ahold of a particular set of files. In this case, we&rsquo;ve placed the files in /root/ngs-scripts/, and you&rsquo;re looking to run the script blast/blast-to-csv.py using Python:</p><div><div><pre>python /root/ngs-scripts/blast/blast-to-csv.py out.txt
</pre></div></div><p>This outputs a spread-sheet like list of names and e-values. To save this to a file, do:</p><div><div><pre>python /root/ngs-scripts/blast/blast-to-csv.py out.txt &gt; ~out.csv
</pre></div></div><p>If you have Excel installed, try double clicking on it.</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/42370/ncbi-blast-have-added-new-columns-to-the-descriptions</guid>
	<pubDate>Tue, 01 Dec 2020 09:56:07 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/42370/ncbi-blast-have-added-new-columns-to-the-descriptions</link>
	<title><![CDATA[NCBI BLAST have added new columns to the Descriptions]]></title>
	<description><![CDATA[<p><span>NCBI BLAST have added new columns to the Descriptions Table for web BLAST output. The new columns are&nbsp; Scientific Name, Common Name, Taxid, and Accession Length. Common Name and Accession Length are now part of the default display. You can click 'Select columns' or 'Manage columns' to add or remove columns from the display Your preferences will be saved for your next visit to BLAST, and when you download your results, whatever columns you have displayed will be saved. See the NCBI Insights post (</span><a href="https://go.usa.gov/x7fPE" target="_blank">https://go.usa.gov/x7fPE</a><span>) for more details.</span></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44709/a-step-by-step-guide-to-running-blast-offline</guid>
	<pubDate>Sat, 07 Dec 2024 22:32:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44709/a-step-by-step-guide-to-running-blast-offline</link>
	<title><![CDATA[A Step-by-Step Guide to Running BLAST Offline]]></title>
	<description><![CDATA[<p>BLAST (Basic Local Alignment Search Tool) is a powerful algorithm used to compare nucleotide or protein sequences to sequence databases, identifying regions of similarity. Running BLAST offline provides more control, ensures data security, and allows customization for specific research needs. Here&rsquo;s a detailed guide to set up and run BLAST locally on your system.</p><hr><h3>Step 1: <strong>Install BLAST</strong></h3><ol>
<li>
<p><strong>Download BLAST</strong>:</p>
<ul>
<li>Visit the <a href="https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/">NCBI BLAST+ download page</a> to download the appropriate version for your operating system (Windows, macOS, or Linux).</li>
</ul>
</li>
<li>
<p><strong>Install BLAST</strong>:</p>
<ul>
<li>Extract the downloaded archive. For Linux/Mac, use:
<pre><code>tar -xvzf ncbi-blast-*.tar.gz
cd ncbi-blast-*
</code></pre>
</li>
<li>Add the BLAST binary folder to your system PATH for easier access:
<pre><code>export PATH=$PATH:/path/to/ncbi-blast-*/bin
</code></pre>
</li>
</ul>
</li>
<li>
<p><strong>Verify Installation</strong>:<br /> Run the following command to ensure BLAST is installed correctly:</p>
<pre><code>blastn -version
</code></pre>
</li>
</ol><hr><h3>Step 2: <strong>Prepare a Local Database</strong></h3><p>To run BLAST offline, you&rsquo;ll need a sequence database.</p><ol>
<li>
<p><strong>Download a Pre-Built Database (Optional)</strong>:</p>
<ul>
<li>NCBI provides ready-to-use databases such as <code>nt</code>, <code>nr</code>, and <code>Swiss-Prot</code>. Use the <code>update_blastdb.pl</code> script (bundled with BLAST) to download these:
<pre><code>update_blastdb.pl --decompress nt
</code></pre>
</li>
</ul>
</li>
<li>
<p><strong>Create a Custom Database</strong>:<br /> If you have specific sequences to use as a database:</p>
<ul>
<li>Prepare a FASTA file containing the sequences.</li>
<li>Use <code>makeblastdb</code> to create a database:
<pre><code>makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
</code></pre>
Replace <code>[nucl|prot]</code> with <code>nucl</code> for nucleotide sequences or <code>prot</code> for protein sequences.</li>
</ul>
</li>
</ol><hr><h3>Step 3: <strong>Prepare the Query Sequence</strong></h3><ul>
<li>Save your query sequence(s) in FASTA format.</li>
<li>Ensure the file is properly formatted, with a header line starting with <code>&gt;</code> followed by the sequence name, and the sequence on subsequent lines.</li>
</ul><p>Example:</p><pre><code>&gt;query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA
</code></pre><hr><h3>Step 4: <strong>Run BLAST</strong></h3><ol>
<li>
<p><strong>Choose the Appropriate BLAST Tool</strong>:<br /> Depending on your data type:</p>
<ul>
<li><strong>blastn</strong>: For nucleotide-nucleotide searches.</li>
<li><strong>blastp</strong>: For protein-protein searches.</li>
<li><strong>blastx</strong>: Translates nucleotide sequences into proteins and compares them to a protein database.</li>
<li><strong>tblastn</strong>: Compares protein sequences to a nucleotide database.</li>
<li><strong>tblastx</strong>: Translates both nucleotide query and database sequences.</li>
</ul>
</li>
<li>
<p><strong>Run the Command</strong>:<br /> Example command for <code>blastn</code>:</p>
<pre><code>blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
</code></pre>
<p><strong>Explanation of Parameters</strong>:</p>
<ul>
<li><code>-query</code>: Specifies the query file.</li>
<li><code>-db</code>: Points to the local database.</li>
<li><code>-out</code>: Output file name.</li>
<li><code>-outfmt</code>: Output format (e.g., 6 for tabular format).</li>
<li><code>-evalue</code>: E-value cutoff for significance.</li>
</ul>
</li>
</ol><hr><h3>Step 5: <strong>Interpret Results</strong></h3><ol>
<li>
<p><strong>Output Formats</strong>:</p>
<ul>
<li><strong>Default (outfmt 0)</strong>: Human-readable format.</li>
<li><strong>Tabular (outfmt 6)</strong>: Includes fields like query ID, subject ID, percent identity, alignment length, etc.</li>
</ul>
</li>
<li>
<p><strong>Analyze Results</strong>:<br /> Use tools like <code>grep</code>, Python, or R to parse and filter results for downstream analysis.</p>
</li>
</ol><hr><h3>Step 6: <strong>Optimize Performance</strong></h3><p>For large datasets, BLAST can be resource-intensive. To improve performance:</p><ol>
<li>
<p><strong>Multithreading</strong>:<br /> Use the <code>-num_threads</code> option to leverage multiple CPU cores:</p>
<pre><code>blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
</code></pre>
</li>
<li>
<p><strong>Database Subsetting</strong>:<br /> Split large databases into smaller chunks for faster searches.</p>
</li>
<li>
<p><strong>Adjust Parameters</strong>:</p>
<ul>
<li>Lower the <code>-evalue</code> threshold for stricter matches.</li>
<li>Use <code>-max_target_seqs</code> to limit the number of results per query.</li>
</ul>
</li>
</ol><hr><h3>Step 7: <strong>Update Databases (Optional)</strong></h3><p>If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:</p><pre><code>update_blastdb.pl --decompress nt
</code></pre><hr><h3>Conclusion</h3><p>Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.</p><p>For advanced use cases, explore BLAST&rsquo;s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!</p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43952/elastic-blast</guid>
	<pubDate>Tue, 06 Sep 2022 18:14:57 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43952/elastic-blast</link>
	<title><![CDATA[Elastic BLAST !]]></title>
	<description><![CDATA[<p><a href="https://blast.ncbi.nlm.nih.gov/doc/elastic-blast/elasticblast.html?utm_source=ncbi_insights&amp;utm_medium=referral&amp;utm_campaign=elasticblast-top3-20220823">ElasticBLAST</a>&nbsp;is a new way to&nbsp;<a href="https://blast.ncbi.nlm.nih.gov/?utm_source=ncbi_insights&amp;utm_medium=referral&amp;utm_campaign=elasticblast-top3-20220823">BLAST</a>&nbsp;large numbers of queries, faster and on the cloud. Here are the top three reasons you should use ElasticBLAST:</p>
<h6><strong><img src="https://i0.wp.com/ncbiinsights.ncbi.nlm.nih.gov/wp-content/uploads/2022/08/ElasticBLAST_Larger-e1659978198941.png?resize=150%2C120&amp;ssl=1" alt="" width="150" height="120" style="border: 0px;">1. ElasticBLAST can handle much LARGER queries!&nbsp;</strong></h6>
<p>ElasticBLAST can search query sets that have&nbsp;<em>hundreds to millions of sequences</em>&nbsp;and against BLAST databases of all sizes.</p>
<h6><span><img src="https://i0.wp.com/ncbiinsights.ncbi.nlm.nih.gov/wp-content/uploads/2022/08/ElasticBLAST_Faster.png?resize=150%2C120&amp;ssl=1" alt="" width="150" height="120" style="border: 0px;">2. ElasticBLAST is FASTER</span></h6>
<p>ElasticBLAST distributes your searches across multiple cloud instances to process them simultaneously. The ability to scale resources in this way allows you to process large numbers of queries in a shorter time than you could with BLAST+.</p>
<h6><img src="https://i0.wp.com/ncbiinsights.ncbi.nlm.nih.gov/wp-content/uploads/2022/08/ElasticBLAST_Easy.png?resize=150%2C120&amp;ssl=1" alt="" width="150" height="120" style="border: 0px;">3. ElasticBLAST is EASY to run on the cloud<strong><br></strong></h6>
<p>ElasticBLAST is easy to set up using our step-by-step instructions&nbsp;<span>(</span><a href="https://blast.ncbi.nlm.nih.gov/doc/elastic-blast/quickstart-aws.html?utm_source=ncbi_insights&amp;utm_medium=referral&amp;utm_campaign=elasticblast-top3-20220823" target="_blank"><span><span>Amazon Web&nbsp;</span><span>Services (AWS)</span></span></a><span>,&nbsp;</span><a href="https://blast.ncbi.nlm.nih.gov/doc/elastic-blast/quickstart-gcp.html?utm_source=ncbi_insights&amp;utm_medium=referral&amp;utm_campaign=elasticblast-top3-20220823" target="_blank"><span>Google Cloud Platform (GCP)</span></a><span><span>)</span>&nbsp;<span>and</span>&nbsp;<span>allows&nbsp;</span><span>you&nbsp;</span><span>to leverage the power of</span><span>&nbsp;the&nbsp;</span><span>cloud. Once configured, i</span><span>t</span>&nbsp;<span>manages the software and database installation, handles partitioning of the BLAST workload among the various instances, and deallocates cloud resources when the searches are done.</span></span></p>
<p><span><span>ElasticBLAST</span>&nbsp;<span>also&nbsp;</span><span>selects the instance (</span><span>i.e.,</span><span>&nbsp;machine) type for you based on database size. Of course, you can also choose the instance type manually if you prefer</span><span>.&nbsp;</span></span></p><p>Address of the bookmark: <a href="https://blast.ncbi.nlm.nih.gov/doc/elastic-blast/" rel="nofollow">https://blast.ncbi.nlm.nih.gov/doc/elastic-blast/</a></p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44616/basics-of-blast-programs</guid>
	<pubDate>Fri, 26 Jul 2024 06:04:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44616/basics-of-blast-programs</link>
	<title><![CDATA[Basics of BLAST Programs !]]></title>
	<description><![CDATA[<p>The Basic Local Alignment Search Tool (BLAST) is a powerful bioinformatics program used to compare an input sequence (such as DNA, RNA, or protein sequences) against a database of sequences to find regions of similarity. Developed by the National Center for Biotechnology Information (NCBI), BLAST is widely used for identifying species, finding functional and evolutionary relationships between sequences, and predicting the function of novel sequences.</p><p>Key Features of BLAST:<br />1. Sequence Comparison: BLAST searches for local alignments between the query sequence and sequences in a database. It identifies regions of similarity, which can help infer functional and evolutionary relationships.</p><p>2. Speed and Efficiency: BLAST uses heuristic algorithms, making it faster than exhaustive search methods, suitable for large-scale database searches.</p><p>3. Versatility: There are several versions of BLAST for different types of sequence comparisons:<br /> - blastn: Compares a nucleotide query sequence against a nucleotide sequence database.<br /> - blastp: Compares a protein query sequence against a protein sequence database.<br /> - blastx: Compares a nucleotide query sequence translated in all reading frames against a protein sequence database.<br /> - tblastn: Compares a protein query sequence against a nucleotide sequence database translated in all reading frames.<br /> - tblastx: Compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database.</p><p>4. Scoring and E-value: BLAST results are scored based on the quality and length of the alignments. The E-value (expect value) indicates the number of alignments one can expect to find by chance, with lower E-values representing more significant matches.</p><p>5. Output Formats: BLAST provides results in various formats, including plain text, HTML, XML, and JSON, making it adaptable for different types of analyses and integrations with other tools.</p><p>Applications of BLAST:<br />- Genomic Research: Identifying genes, understanding genetic diversity, and mapping genome sequences.<br />- Protein Function Prediction: Inferring the function of unknown proteins by comparing them to known protein sequences.<br />- Evolutionary Studies: Exploring evolutionary relationships between organisms by comparing their genetic material.<br />- Medical Research: Identifying pathogens, understanding disease mechanisms, and developing treatments by comparing sequences of interest.</p><p>Overall, BLAST is an essential tool in bioinformatics, offering a reliable and efficient way to analyze and interpret biological sequence data.</p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/37198/understanding-blastn-output-format-6</guid>
	<pubDate>Wed, 27 Jun 2018 18:38:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/37198/understanding-blastn-output-format-6</link>
	<title><![CDATA[Understanding BLASTn output format 6 !]]></title>
	<description><![CDATA[<h3 id="sites-page-title-header" style="text-align: left;"><span>BLASTn output format 6</span></h3><div id="sites-canvas-main"><div id="sites-canvas-main-content"><div dir="ltr"><div><div><em>BLASTn</em> maps DNA against DNA, for example gene sequences against a reference genome<br /><br /><code><strong>blastn</strong>  -query <span>genes.ffn</span>  -subject <span>genome.fna</span>  -outfmt <strong>6</strong></code></div><h2>BLASTn tabular output format 6</h2>
<p><strong>Column headers:</strong><br /><code>qseqid sseqid pident length mismatch gapopen qstart qend sstart send evalue bitscore</code><br /></p>
<table border="1" cellspacing="0">
<tbody>
<tr>
<td> 1.</td>
<td> qseqid</td>
<td> query (e.g., gene) sequence id</td>
</tr>
<tr>
<td> 2.</td>
<td> sseqid</td>
<td> subject (e.g., reference genome) sequence id</td>
</tr>
<tr>
<td> 3.</td>
<td> pident</td>
<td> percentage of identical matches</td>
</tr>
<tr>
<td> 4.</td>
<td> length</td>
<td> alignment length</td>
</tr>
<tr>
<td> 5.</td>
<td> mismatch</td>
<td> number of mismatches</td>
</tr>
<tr>
<td> 6.</td>
<td> gapopen</td>
<td> number of gap openings</td>
</tr>
<tr>
<td> 7.</td>
<td> qstart</td>
<td> start of alignment in query</td>
</tr>
<tr>
<td> 8.</td>
<td> qend</td>
<td> end of alignment in query</td>
</tr>
<tr>
<td> 9.</td>
<td> sstart</td>
<td> start of alignment in subject</td>
</tr>
<tr>
<td> 10.</td>
<td> send</td>
<td> end of alignment in subject</td>
</tr>
<tr>
<td> 11.</td>
<td> evalue</td>
<td> <a href="http://www.metagenomics.wiki/tools/blast/evalue">expect value</a></td>
</tr>
<tr>
<td> 12.</td>
<td> bitscore</td>
<td> <a href="http://www.metagenomics.wiki/tools/blast/evalue"><strong>bit score</strong></a></td>
</tr>
</tbody>
</table>
<p><strong><br /></strong></p>
</div><h2><a name="TOC-Define-your-own-output-format" id="TOC-Define-your-own-output-format"></a>Define your own output format</h2><div><em>by adding the option -outfmt, as for example: </em><strong><br /></strong></div>
<p><code><strong>-outfmt</strong> <strong>"6</strong> <span>qseqid sseqid pident qlen length mismatch gapope evalue bitscore</span><strong>"</strong></code><br /><br /><em><strong>supported format specifiers are:</strong></em><br /><code>qseqid    </code>Query Seq-id<br /><code>qgi       </code>Query GI<br /><code>qacc      </code>Query accesion<br /><code>qaccver   </code>Query accesion.version<br /><code>qlen      </code>Query sequence length<br /><code>sseqid    </code>Subject Seq-id<br /><code>sallseqid </code>All subject Seq-id(s), separated by a ';'<br /><code>sgi       </code>Subject GI<br /><code>sallgi    </code>All subject GIs<br /><code>sacc      </code>Subject accession<br /><code>saccver   </code>Subject accession.version<br /><code>sallacc   </code>All subject accessions<br /><code>slen      </code>Subject sequence length<br /><code>qstart    </code>Start of alignment in query<br /><code>qend      </code>End of alignment in query<br /><code>sstart    </code>Start of alignment in subject<br /><code>send      </code>End of alignment in subject<br /><code>qseq      </code>Aligned part of query sequence<br /><code>sseq      </code>Aligned part of subject sequence<br /><code>evalue    </code>Expect value<br /><code>bitscore  </code>Bit score<br /><code>score     </code>Raw score<br /><code>length    </code>Alignment length<br /><code>pident    </code>Percentage of identical matches<br /><code>nident    </code>Number of identical matches<br /><code>mismatch  </code>Number of mismatches<br /><code>positive  </code>Number of positive-scoring matches<br /><code>gapopen   </code>Number of gap openings<br /><code>gaps      </code>Total number of gaps<br /><code>ppos      </code>Percentage of positive-scoring matches<br /><code>frames    </code>Query and subject frames separated by a '/'<br /><code>qframe    </code>Query frame<br /><code>sframe    </code>Subject frame<br /><code>btop      </code>Blast traceback operations (BTOP)<br /><code>staxids   </code>Subject Taxonomy ID(s), separated by a ';'<br /><code>sscinames </code>Subject Scientific Name(s), separated by a ';'<br /><code>scomnames </code>Subject Common Name(s), separated by a ';'<br /><code>sblastnames </code>Subject Blast Name(s), separated by a ';'   (in alphabetical order)<br /><code>sskingdoms  </code>Subject Super Kingdom(s), separated by a ';'     (in alphabetical order) <br /><code>stitle      </code>Subject Title<br /><code>salltitles  </code>All Subject Title(s), separated by a '&lt;&gt;'<br /><code>sstrand   </code>Subject Strand<br /><code>qcovs     </code>Query Coverage Per Subject<br /><code>qcovhsp   </code>Query Coverage Per HSP<br /><strong><br /><em>default values are:</em></strong><br /><code><code>-outfmt "</code>6 qseqid sseqid pident length mismatch gapopen qstart qend sstart send evalue bitscore"</code></p>
</div></div></div>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/40400/blast-2100-released</guid>
	<pubDate>Wed, 18 Dec 2019 20:44:11 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/40400/blast-2100-released</link>
	<title><![CDATA[BLAST+ 2.10.0 released]]></title>
	<description><![CDATA[<p>The BLAST+ 2.10.0 release is now available from at&nbsp;<a href="https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST" target="_blank">FTP site</a>.&nbsp; The new version offers the following improvements:<span style="text-decoration: underline;"></span><span style="text-decoration: underline;"></span></p><ul>
<li>updated composition-based statistics for protein-protein (including translated BLAST) comparisons to provide stable results when you request fewer than the default number of results<span style="text-decoration: underline;"></span><span style="text-decoration: underline;"></span></li>
<li>an experimental Adaptive Composition Based Statistics option that increases the likelihood of finding novel results.&nbsp; To enable this option set the environment variable ADAPTIVE_CBS to 1.&nbsp; We welcome your&nbsp;<a href="mailto:blast-help@ncbi.nlm.nih.gov?subject=BLAST2.10.0%20NCBI%20Insights%20Dec%2017%202019" target="_blank">feedback</a>&nbsp;on this new option.<span style="text-decoration: underline;"></span><span style="text-decoration: underline;"></span></li>
</ul><p>See the&nbsp;<a href="https://www.ncbi.nlm.nih.gov/books/NBK131777/" target="_blank">release notes</a>&nbsp;for details on more&nbsp;&nbsp;improvements and bug fixes with this release.<span style="text-decoration: underline;"></span><span style="text-decoration: underline;"></span></p><p>BLAST+ is also available in docker, please&nbsp;<a href="https://github.com/ncbi/docker/blob/master/blast/README.md" target="_blank">read more</a>&nbsp;for details.<span style="text-decoration: underline;"></span><span style="text-decoration: underline;"></span></p><p>The new version fully supports the version 5 (v5) databases with built in taxonomy and other improvements.&nbsp;For more information on v5 databases (<a href="https://ftp.ncbi.nlm.nih.gov/blast/db/v5/blastdbv5.pdf" target="_blank">download</a>), see the previous&nbsp;<a href="https://ncbiinsights.ncbi.nlm.nih.gov/2019/01/04/blast-2-8-1-with-new-databases-and-better-performance/" target="_blank">NCBI Insights article</a>&nbsp;and the&nbsp;<a href="https://youtu.be/ZZ_K_7-rZj4" target="_blank">recording</a>&nbsp;of our webinar.&nbsp; If you are still using the older version 4 (v4) databases, we recommend you begin using the v5 version as soon as possible.&nbsp; We will discontinue updates to the older v4 databases in early 2020.</p><p>BLAST+ Team</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38381/repeatmasker-compatible-blast-tool</guid>
	<pubDate>Fri, 07 Dec 2018 08:13:03 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38381/repeatmasker-compatible-blast-tool</link>
	<title><![CDATA[RepeatMasker compatible blast tool]]></title>
	<description><![CDATA[<p><span>RMBlast is a RepeatMasker compatible version of the standard NCBI blastn program. The primary difference between this distribution and the NCBI distribution is the addition of a new program "rmblastn" for use with RepeatMasker and RepeatModeler.</span></p>
<p>RMBlast supports RepeatMasker searches by adding a few necessary features to the stock NCBI blastn program. These include:</p>
<ul>
<li>Support for custom matrices ( without KA-Statistics ).</li>
<li>Support for cross_match-like complexity adjusted scoring. Cross_match is Phil Green's seeded smith-waterman search algorithm.</li>
<li>Support for cross_match-like masklevel filtering.</li>
</ul>
<p>https://anaconda.org/bioconda/rmblast</p><p>Address of the bookmark: <a href="http://www.repeatmasker.org/RMBlast.html" rel="nofollow">http://www.repeatmasker.org/RMBlast.html</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/2791/ncbi-psi-blast-tutorial</guid>
	<pubDate>Fri, 23 Aug 2013 02:25:02 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/2791/ncbi-psi-blast-tutorial</link>
	<title><![CDATA[NCBI PSI-BLAST Tutorial]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/T3kHEieyylk" frameborder="0" allowfullscreen></iframe>http:--www.biotechnology.jhu.edu-
Tutorial for PSI-BLAST, an extension of BLAST that uses matrix algebra. BLAST is a cornerstone bioinformatics tool at NCBI. BLAST is the
Basic Local Alignment Search tool and will protein and DNA sequences that
are related to a sequence that the user provides.]]></description>
	
</item>

</channel>
</rss>