<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/35983?offset=1000</link>
	<atom:link href="https://bioinformaticsonline.com/related/35983?offset=1000" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/8265/list-of-generic-simulation-softwaretoolsresource-with-brief-description-and-homepage</guid>
	<pubDate>Mon, 10 Feb 2014 05:57:29 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/8265/list-of-generic-simulation-softwaretoolsresource-with-brief-description-and-homepage</link>
	<title><![CDATA[List of generic simulation software/tools/resource with brief description and homepage !!!]]></title>
	<description><![CDATA[<p>List of generic simulation software/tools/resource with brief description and homepage</p><p><img src="http://www.evolution-of-life.com/fileadmin/images/carousel/genetic.PNG" alt="image" style="border: 0px;"></p><p>ALF <br />A Simulation Framework for Genome Evolution <br />http://www.cbrg.ethz.ch/alf<br /><br />Bayesian Serial SimCoal <br />Bayesian Serial SimCoal, (BayeSSC) is a modification of SIMCOAL 1.0, a program written by Laurent Excoffier, John Novembre, and Stefan Schneider. <br />http://www.stanford.edu/group/hadlylab/ssc/index.html<br /><br />BEERS <br />BEERS was designed to benchmark RNA-Seq alignment algorithms and also algorithms that aim to reconstruct different isoforms and alternate splicing from RNA-Seq data <br />http://cbil.upenn.edu/beers/<br /><br />BOTTLENECK <br />Bottleneck is a program for detecting recent effective population size reductions from allele data frequencies <br />http://www.ensam.inra.fr/urlb/bottleneck/bottleneck.html<br /><br />BottleSim <br />BottleSim is a computer simulation program for simulating the process of population bottlenecks <br />http://chkuo.name/software/bottlesim.html<br /><br />CASS <br />Protein Sequence Simulation <br />http://www.wyomingbioinformatics.org/liberlesgroup/cass/<br /><br />CDPOP <br />CDPOP is a landscape genetics tool for simulating the emergence of spatial genetic structure in populations resulting from specified landscape processes governing organism movement behavior. <br />http://cel.dbs.umt.edu/cdpop<br /><br />CoalFace <br />CoalFace is a simulation of the coalescent process with the visual display of gene genealogies. <br />http://web.up.ac.za/default.asp?ipkcategoryid=3283<br /><br />CoaSim <br />CoaSim is a tool for simulating the coalescent process with recombination and geneconversion under various demographic models. <br />http://users-birc.au.dk/mailund/coasim/index.html<br /><br />cosi <br />The cosi package is written in C and is available as a tar file. <br />http://www.broadinstitute.org/~sfs/cosi/<br /><br />CS-PSeq-Gen <br />A program to simulate the evolution of protein sequences under the constraints of the information of a particular reconstructed phylogeny <br />http://bioserv.rpbs.univ-paris-diderot.fr/software/cs-pseq-gen.html<br /><br />DAWG <br />An application designed to simulate the evolution of recombinant DNA sequences in continuous time <br />http://scit.us/projects/dawg<br /><br />Easypop <br />EASYPOP is an individual based model intended to simulate datasets under a very broad range of conditions <br />http://www.unil.ch/dee/page36926_fr.html<br /><br />EggLib <br />EggLib is a C++/Python library and program package for evolutionary genetics and genomics. <br />http://egglib.sourceforge.net/<br /><br />EvolSimulator <br />A simulation test bed for hypotheses of genome evolution <br />http://acb.qfab.org/acb/evolsim/<br /><br />EvolveAGene <br />A realistic coding sequence simulation program that separates mutation from selection and allows the user to set selection conditions <br />http://bellinghamresearchinstitute.com/software/index.html<br /><br />fastsimcoal <br />A continuous-&not;‐time coalescent simulator of genomic diversity under arbitrarily complex evolutionary scenarios <br />http://cmpg.unibe.ch/software/fastsimcoal/<br /><br />FastSLINK <br />Simulation of Marker and Phenotype Data in Pedigrees <br />http://watson.hgen.pitt.edu/<br /><br />FFPopSim <br />C++/Python library for population genetics. <br />http://webdav.tuebingen.mpg.de/ffpopsim/<br /><br />FLUX SIMULATOR <br />The Flux Simulator aims at providing a deterministic in silico reproduction of the experimental pipelines for RNA-Seq, employing a minimal set of parameters. <br />http://flux.sammeth.net/simulator.html<br /><br />ForSim <br />ForSim: A Forward Evolutionary Computer Simulation <br />http://www.anthro.psu.edu/weiss_lab/research.shtml<br /><br />ForwSim <br />The program given below is based on the algorithm described in Padhukasahasram et al. 2008 to simulate genetic drift in a standard Wright-Fisher process. <br />http://badri-populationgeneticsimulators.blogspot.com/<br /><br />FPG <br />Forward Population Genetic simulation <br />http://genfaculty.rutgers.edu/hey/software#fpg<br /><br />FREGENE <br />FREGENE is a C++ program that simulates sequence-like data over large genomic regions in large diploid populations. <br />http://www.ebi.ac.uk/projects/bargen/download/fregen/documentation_html.html<br /><br />GAMETES <br />Genetic Architecture Model Emulator for Testing and Evaluating Software: Simulates complex SNP models with pure, strict epistatic interactions with n-loci. <br />http://sourceforge.net/projects/gametes/?source=navbar<br /><br />GASP <br />Genometric Analysis Simulation Program. A software tool for testing and investigating methods in statistical genetics by generating samples of family data based on user specified models. <br />http://research.nhgri.nih.gov/gasp/<br /><br />GemSIM <br />Next generation sequencing read simulator <br />http://sourceforge.net/projects/gemsim/<br /><br />GeneArtisan <br />Simulation of Markers in Case-Control Study Designs <br />http://www.rannala.org/?page_id=241<br /><br />GENOME <br />A rapid coalescent-based whole genome simulator <br />http://www.sph.umich.edu/csg/liang/genome/<br /><br />GenomePop2 <br />GenomePop2 is a specialization of the program GenomePop just to manage SNPs under more flexible and useful settings. If you need models with more than 2 alleles please use the GenomePop program version. <br />http://webs.uvigo.es/acraaj/genomepop2.htm<br /><br />GenomeSimla <br />GenomeSIMLA is currently under development- however, we have a beta release that we are asking to be tested <br />http://chgr.mc.vanderbilt.edu/genomesimla/<br /><br />GENS2 <br />Simulates interactions among two genetic and one environmental factor and also allows for epistatic interactions. <br />https://sourceforge.net/projects/gensim/<br /><br />GWAsimulator <br />A rapid whole genome simulation program <br />http://biostat.mc.vanderbilt.edu/wiki/main/gwasimulator<br /><br />HAP-SAMPLE <br />An association simulator for candidate regions or genome scans <br />http://www.hapsample.org/<br /><br />HAPGEN <br />A simulator for the simulation of case control datasets at SNP markers <br />https://mathgen.stats.ox.ac.uk/genetics_software/hapgen/hapgen2.html<br /><br />HapSim <br />A simulation tool for generating haplotype data with pre-specified allele frequencies and LD coefficients <br />http://cran.r-project.org/web/packages/hapsim/index.html<br /><br />HAPSIMU <br />A program that simulates heterogeneous populations with various known and controllable structures under the continuous migration model or the discrete model <br />http://l.web.umkc.edu/liujian/<br /><br />IBDsim <br />IBDSim is a computer package for the simulation of genotypic data under general isolation by distance models. <br />http://raphael.leblois.free.fr/<br /><br />indel-Seq-Gen <br />A biological sequence simulation program that simulates highly divergent DNA sequences and protein superfamilies <br />http://bioinfolab.unl.edu/~cstrope/isg/<br /><br />Indelible <br />A powerful and flexible simulator of biological evolution <br />http://abacus.gene.ucl.ac.uk/software/indelible/<br /><br />invertFREGENE <br />InvertFREGENE is a forward-in-time simulator of inversions in population genetic data <br />http://www.ebi.ac.uk/projects/bargen/<br /><br />kernalPop <br />A spatially explicit population genetic simulation engine <br />http://cran.r-project.org/src/contrib/archive/kernelpop/<br /><br />MaCS <br />Markovian Coalescent Simulator <br />http://www-hsc.usc.edu/~garykche/<br /><br />Mason <br />A package for the simulation of nucleotide data. <br />http://www.seqan.de/projects/mason/<br /><br />mbs <br />modifying Hudson's ms software to generate samples of DNA sequences with a biallelic site under selection <br />http://www.sendou.soken.ac.jp/esb/innan/innanlab/software.html<br /><br />Mendel's Accountant <br />Mendel's Accountant (MENDEL) is an advanced numerical simulation program for modeling genetic change over time and was developed collaboratively by Sanford, Baumgardner, Brewer, Gibson and ReMine <br />http://mendelsaccount.sourceforge.net/<br /><br />MetaSim <br />A tool to generate collections of synthetic reads that reflect the diverse taxonomical composition of typical metagenome data sets <br />http://ab.inf.uni-tuebingen.de/software/metasim/<br /><br />mlcoalsim <br />Multilocus Coalescent Simulations <br />http://code.google.com/p/mlcoalsim-v1/<br /><br />ms <br />The purpose of this program is to allow one to investigate the statistical properties of such samples, to evaluate estimators or statistical tests, and generally to aid in the interpretation of polymorphism data sets. <br />http://home.uchicago.edu/~rhudson1/source/mksamples.html<br /><br />msHOT <br />The purpose of this program is to allow one to investigate the statistical properties of such samples, to evaluate estimators or statistical tests, and generally to aid in the interpretation of polymorphism data sets. <br />http://home.uchicago.edu/~rhudson1/<br /><br />msms <br />A coalescent Simlation tool with selection. <br />http://www.mabs.at/ewing/msms/index.shtml<br /><br />MySSP <br />A program for the simulation of DNA sequence evolution across a phylogenetic tree <br />http://www.rosenberglab.net/software.php<br /><br />Nemo <br />A forward-time, individual-based, genetically explicit, and stochastic simulation program designed to study the evolution of genetic markers, life history traits, and phenotypic traits in a flexible (meta-)population framework. <br />http://nemo2.sourceforge.net/<br /><br />NetRecodon <br />Coalescent simulation of coding DNA sequences with recombination (inter and intracodon), migration and demography <br />http://code.google.com/p/netrecodon/<br /><br />PEDAGOG <br />Software for simulating eco-evolutionary population dynamics <br />https://bcrc.bio.umass.edu/pedigreesoftware/node/5<br /><br />phenosim <br />A tool to add phenotypes to simulated genotypes <br />http://evoplant.uni-hohenheim.de/doku.php?id=software:software<br /><br />PhyloSim <br />An R package for the Monte Carlo simulation of sequence evolution <br />http://bit.ly/rlsim-git<br /><br />pIRS <br />Profile-based Illumina pair-end reads simulator <br />https://code.google.com/p/pirs/<br /><br />ProteinEvolver <br />Simulation of protein evolution along phylogenies under structure-based substitution models <br />http://code.google.com/p/proteinevolver/<br /><br />QMSim <br />QTL and Marker Simulator <br />http://www.aps.uoguelph.ca/~msargol/qmsim/<br /><br />quantiNEMO <br />An individual-based program for the analysis of quantitative traits with explicit genetic architecture potentially under selection in a structured population <br />http://www2.unil.ch/popgen/softwares/quantinemo/<br /><br />RECOAL <br />Simulates new haplotype data from a reference population of haplotypes. <br />ftp://popgen.usc.edu/<br /><br />Recodon <br />Coalescent simulation of coding DNA sequences with recombination, migration and demography <br />http://code.google.com/p/recodon/<br /><br />rlsim <br />A package for simulating RNA-seq library preparation with parameter estimation <br />http://bit.ly/rlsim-git<br /><br />Rmetasim <br />Rmetasim is a front-end for the metasim engine that is implemented as a package that runs in the statistical computing environment R <br />http://linum.cofc.edu/software.html#metasim<br /><br />RNA Seq Simulator <br />RSS takes SAM alignment files from RNA-Seq data and simulates over dispersed, multiple replica, differential, non-stranded RNA-Seq datasets. <br />http://useq.sourceforge.net/cmdlnmenus.html#rnaseqsimulator<br /><br />Rose <br />Random model of sequence evolution <br />http://bibiserv.techfak.uni-bielefeld.de/rose/<br /><br />SelSim <br />SelSim is a program for Monte Carlo simulation of DNA polymorphism data for a recom- bining region within which a single bi-allelic site has experienced natural selection <br />http://www.well.ox.ac.uk/~spencer/selsim/<br /><br />Seq-Gen <br />An application for the Monte Carlo simulation of molecular sequence evolution along phylogenetic trees. <br />http://tree.bio.ed.ac.uk/software/seqgen/<br /><br />SEQPower <br />Statistical power analysis for sequence-based association studies <br />http://bioinformatics.org/spower/<br /><br />SeqSIMLA <br />SeqSIMLA can simulate sequence data with user-specified disease and quantitative trait models. Family or unrelated case-control data can be simulated. <br />http://seqsimla.sourceforge.net/<br /><br />Serial NetEvolve <br />A flexible utility for generating serially-sampled sequences along a tree or recombinant network <br />http://biorg.cis.fiu.edu/sne/<br /><br />SFS_CODE <br />SFS_CODE can perform forward population genetic simulations under a general Wright-Fisher model with arbitrary migration, demographic, selective, and mutational effects. <br />http://sfscode.sourceforge.net/sfs_code/index/index.html<br /><br />SIBSIM <br />Quantitative phenotype simulation in extended pedigrees <br />http://sourceforge.net/projects/sibsim/<br /><br />SIMCOAL2 <br />A coalescent program for the simulation of complex recombination patterns over large genomic regions under various demographic models <br />http://cmpg.unibe.ch/software/simcoal2/<br /><br />SimCopy <br />An R package simulating the evolution of copy number profiles along a tree. <br />http://bit.ly/simcopy<br /><br />SIMLA <br />SIMLA is a SIMuLAtion program that generates data sets of families for use in Linkage and Association studies. <br />http://www.chg.duke.edu/research/simla.html<br /><br />SimPed <br />A Simulation Program to Generate Haplotype and Genotype Data for Pedigree Structures <br />http://www.hgsc.bcm.tmc.edu/content/simped<br /><br />Simprot <br />A program to simulate protein evolution by substitution, insertion and deletion <br />http://www.uhnresearch.ca/labs/tillier/software.htm#3<br /><br />SimRare <br />Rare variant simulation and analysis tool <br />http://code.google.com/p/simrare/<br /><br />simuGWAS <br />A forward-time simulator that simulates realistic samples for genome-wide association studies. <br />http://simupop.sourceforge.net/cookbook/simucomplexdisease<br /><br />simuPOP <br />simuPOP is a general-purpose individual-based forward-time population genetics simulation environment. <br />http://simupop.sourceforge.net/<br /><br />SISSI <br />A software tool to generate data of related sequences along a given phylogeny, taking into account user defined system of neighbourhoods and instantaneous rate matrices. <br />http://www.cibiv.at/software/sissi/<br /><br />SNPsim <br />Coalescent simulation of hotspot recombination <br />http://code.google.com/p/phylosoftware/<br /><br />SPIP <br />SPIP simulates the transmission of genes from parents to offspring in a population having demographic structure defined by the user <br />http://swfsc.noaa.gov/textblock.aspx?division=fed&amp;id=3434<br /><br />Splatche <br />Spatial and Temporal Coalescences in Heterogeneous Environment <br />http://www.splatche.com/<br /><br />srv <br />Simulator of Rare Varaints (srv) is a simulator for the simulation of the introduction and evolution of (rare) genetic variants. <br />http://simupop.sourceforge.net/cookbook/simurarevariants<br /><br />SUP <br />SLINK/FastSLINK utility program <br />http://mlemire.freeshell.org/software.html<br /><br />TreesimJ <br />A flexible, forward-time population genetic simulator <br />http://code.google.com/p/treesimj/<br /><br />Vortex <br />VORTEX is an individual-based simulation model for population viability analysis (PVA). <br />http://www.vortex9.org/vortex.html<br /><br />References:</p><p>Image www.evolution-of-life.com</p><p>www.cancer.gov</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8520/rcb-gurgaon-bioinformatics-rapa-openings</guid>
  <pubDate>Thu, 27 Feb 2014 08:42:15 -0600</pubDate>
  <link></link>
  <title><![CDATA[RCB Gurgaon Bioinformatics RA/PA Openings]]></title>
  <description><![CDATA[
<p>Advt. No.1/2014</p>

<p>Recruitment for Research Associate and Project Assistant positions</p>

<p>Regional Centre for Biotechnology (RCB) is an autonomous academic institution established by the Department of Biotechnology, Govt. of India with regional and global partnerships synergizing with the programmes of UNESCO as a Category II Centre. The primary focus of RCB is to provide world class education, training and conduct innovative research at the interface of multiple disciplines to create high quality human resource in disciplinary and interdisciplinary areas of biotechnology in a globally competitive research milieu. </p>

<p>Research Associate (02 Position)</p>

<p>Consolidated emoluments Rs.22000/- + 30% H.R.A. p.m.</p>

<p>Essential: Ph.D. in Natural Sciences, minimum 60% marks in all qualifying exams and below 35 years of age.</p>

<p>Desirable: Prior experience at the PhD level in Biochemistry, Bioinformatics and Proteomics with a strong motivation for a career in research is highly desirable.</p>

<p>Strong PhD level training with proteins chemistry, protein purification and statistical analysis of proteomics or genomics dataset will be preferred. Either/ both qualifications should be substantiated by published papers.</p>

<p>Inter-Institutional Program for  Maternal, Neonatal and Infant  Sciences: A translational approach to studying preterm birth. </p>

<p>Principal Investigator: Dr. Dinakar M. Salunke </p>

<p>Applicants may apply along with the requisite documents (attested copies) pertaining to proof of date of birth, academic/professional qualifications, experience (if any), in the prescribed format available on our websites: www.rcb.res.in and www.rcb.ac.in. Applications should be sent to the Registrar, Regional Centre for Biotechnology, 180 Udyog Vihar Phase 1, Gurgaon-122016, Haryana, India, through Registered Post on or before Feb 28, 2014. A soft copy of the application should be sent by email to registrar@rcb.res.in. Incomplete applications or applications received after Feb 28, 2014 will not be entertained. </p>

<p>More at https://www.rcb.res.in/Advt-1._for_websites_PTB-revised.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</guid>
	<pubDate>Wed, 11 Apr 2018 13:31:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</link>
	<title><![CDATA[Project-based approach to improve bioinformatics education with skilled and meaningful access to omics data]]></title>
	<description><![CDATA[<p>Pine Biotech has been collaborating with Loyola University of New Orleans on piloting a new approach to bioinformatics education using the intuitive and logic-drive bioinformatics platform T-BioInfo.</p><p>https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/8504/update-genome-workbench-2715-released</guid>
	<pubDate>Wed, 26 Feb 2014 16:12:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/8504/update-genome-workbench-2715-released</link>
	<title><![CDATA[Update Genome Workbench 2.7.15 released]]></title>
	<description><![CDATA[<p>NCBI Genome Workbench is an integrated application for viewing and analyzing sequence data. With Genome Workbench, you can view data in publically available sequence databases at NCBI, and mix this data with your own private data.</p><p><img src="http://www.ncbi.nlm.nih.gov/core/assets/gbench/images/firstscreen_still.gif" alt="Introductory screen shot" style="border: 0px; border: 0px;"></p><p>Genome Workbench can display sequence data in many ways, including graphical sequence views, various alignment views, phylogenetic tree views, and tabular views of data. It can also align your private data to data in public databases, display your data in the context of public data, and retrieve BLAST results.</p><p>Genome Workbench is built on the NCBI C++ ToolKit and uses cross-platform APIs for graphics. It runs on your local machine, and is available for Windows 2000/XP, Linux, MacOS X, and various flavors of Unix.</p><p>NCBI Genome Workbench is an integrated application for viewing and analyzing sequence data. Genome Workbench was developed entirely in-house at NCBI and makes use of the NCBI C++ ToolKit. The C++ ToolKit provides a convenient and flexible cross-platform API for managing system internals, database connections, network sockets, and the NCBI data model. In addition, the C++ ToolKit provides the Object Manager, which abstracts handling of sequences and sequence-related objects.</p><p>&nbsp;New Features in Genome Workbench 2.7.15 <br /><br /></p><ul>
<li>Multiple Alignment View: implemented adaptive feature display when zooming in</li>
<li>Active Objects Inspector replaces Selection Inspector. New View should offer an improved selection context examination. See Using Active Objects Inspector tutorial for more details.</li>
<li>Binary packages for Linux OpenSUSE 13.1 are now available</li>
</ul><p><br />Bug Fixes and Improvements in Genome Workbench 2.7.15 <br /><br /></p><ul>
<li>Fixed major issue with OpenGL overlay/scrolling. Could cause crashes or view scrolling irregularities</li>
<li>Multiple Pane View: fixed crash on loading BLAST results</li>
<li>Graphical Sequence View: fixed crash on zooming in and out, related to SNP track</li>
<li>Graphical Sequence View: fixed Go To Position dialog to give better diagnostics in case of a user error</li>
<li>Graphical Sequence View: PDF export fixed rendering of Markers with commas in the name</li>
<li>Text View / Flat File: fixed Mac OS rendering issues</li>
<li>Text View / Flat File: performance optimization, extended capabilities of real-time rendering of molecules to tens of thousands</li>
<li>File Import: optimization improvement to speed up load of files containing multiple project items</li>
<li>File Import: remapping stage now shows accession.version and description of molecules, instead of plain GI numbers</li>
<li>Mac OS: improved tooltips for toolbar buttons</li>
<li>Phylogenetic Tree Builder Tool: improved diagnostics of errors</li>
<li>Multiple Alignment View: optimizations to avoid main GUI freezes</li>
<li>Open Dialog: removed duplicate elements in table of genomes (load Genome)</li>
<li>PDF export: fixed issue with XREF table errors</li>
<li>Tree View: fixed issues with showing Force Layout progress on Mac OS</li>
<li>Tree View: PDF export fixed issues for showing labels of collapsed nodes</li>
<li>Tree View: added an option to stop layout</li>
<li>Tree View: broadcasting mechanism fixed not to accumulate selected nodes</li>
</ul><p>Reference:</p><p>NCBI news</p><p>http://www.ncbi.nlm.nih.gov/tools/gbench/</p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</guid>
	<pubDate>Mon, 29 Oct 2018 04:23:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</link>
	<title><![CDATA[Biologist versus computational biologist !]]></title>
	<description><![CDATA[<p>This is how it work :)</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38029" length="69305" type="image/png" />
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8857/junior-research-fellow-at-iari</guid>
  <pubDate>Mon, 10 Mar 2014 13:10:56 -0500</pubDate>
  <link></link>
  <title><![CDATA[Junior Research Fellow at IARI]]></title>
  <description><![CDATA[
<p>DIVISION OF NEMATOLOGY<br />INDIAN AGRICULTURAL RESEARCH INSTITUTE<br />NEW DELHI 110012</p>

<p>Applications are invited for the posts of one Junior Research Fellow in the DBT funded project entitled “Plant parasitic nematode genome informatics - insilico resource development”. The project is for a period of three years.</p>

<p>Essential qualifications for JRF: First class M. Sc. / M. Tech in Bioinformatics. Knowledge of programming language, pearl, Statistics and database – HTML, CSS, Java script.</p>

<p>Desirable qualifications: Experience in handling next generation sequencing data</p>

<p>Age limit: 35 years maximum (5 year relaxation for SC/ST and women candidates) Emoluments: 16,000 + 30% HRA.</p>

<p>The post is purely temporary in nature and is co-terminus with the project. The appointment would be initially for one year and may be extended further upon satisfactory performance.</p>

<p>Those who are interested in pursuing Ph.D with strong research aptitude are preferred.</p>

<p>Interested candidates may attend the Walk in interview on 25th March 2014 along with the duly filled application forms (format in the following page) with all the relevant documents.</p>

<p>Venue: Division of Nematology, Indian Agricultural Research Institute, New Delhi 110012 (Room No. 306, 3rd floor, LBS building)</p>

<p>Reporting Time: Interested candidates should report strictly between 10.00 to 10.30 AM.</p>

<p>Interview time: 10.30 AM</p>

<p>Short-listed candidates will be called for interview at New Delhi. However, no TA and DA will be paid for attending the interview.</p>

<p>Advertisement:</p>

<p>https://www.iari.res.in/files/JRF_Nema-07032014-20140307-170017.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</guid>
	<pubDate>Wed, 05 Jun 2019 15:04:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</link>
	<title><![CDATA[Bioinformatics for Precision Oncology - Online Training Program, Summer 2019]]></title>
	<description><![CDATA[<p><img src="https://edu.t-bio.info/wp-content/uploads/2019/05/OncologyBioinformatics.jpeg" width="600" height="337.5" alt="image" style="border: 0px;"></p><p>The bioinforamtics for precision oncology online course provides an opportunity to learn about bioinformatics methods used in precision oncology research and practice. As a subset of precision medicine, precision oncology deals with molecular factors involved in the biological rpocesses that lead to cancer and can help diagnose, treat or prevent this disease. Oncology is driven by data, often times generated using Next Generation Sequencing (NGS) that helps us study the genomic and transcriptomic sub-cellular processes. Learn more and register:&nbsp;https://edu.t-bio.info/bioinformatics-training-precision-oncology/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8972/bioinformaticcomputational-postdoc-at-south-dakota-state-university</guid>
  <pubDate>Wed, 12 Mar 2014 10:02:30 -0500</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatic/computational postdoc at South Dakota State University]]></title>
  <description><![CDATA[
<p>We seek an enthusiastic postdoctoral researcher to work with the Plant Science team within the Biochemical Spatio-temporal NeTwork Resource (BioSNTR). Bio-SNTR</p>

<p>is a state-funded virtual research center aimed at promoting imaging and informatics research infrastructure in South Dakota. BioSNTR research foci include analysis of large-scale genomics and imaging data, application of novel microscopy technologies to study signaling pathways, and identification of new compounds to manipulate signaling pathways.<br />Responsibilities: This person will be part of Plant Science team with research focus in bioinformatic and molecular network analyses of high throughput data (transcriptomic, proteomic, metabolomics, miRNA). The individual will be integrated into functional genomic projects encompassing grapevine dormancy and freezing tolerance (Fennell) and regulation of soybean nodulation (Subramanian). The successful candidate will perform computational analysis of high throughput, next-generation sequence data and possess the ability to use bioinformatics analytical tools on HPC clusters.</p>

<p> <br />Required Qualifications:<br />• Ph.D. in plant computational biology or bioinformatics.<br />• Experience in a high performance computing environment.<br />• Perl, Python and Java programming experience<br />• Data management and database development experience</p>

<p>Desired Qualifications:<br />• Parallel computing experience<br />• Experience working in a multidisciplinary environment</p>

<p>Contact Information<br />South Dakota State University<br />Plant Science<br />Anne Fennell<br />anne.fennell@sdstate.edu<br />Tel. Number: 605-688-6373<br />http://www.biosntr.org</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/40204/iitm-tokyo-tech-joint-symposium</guid>
	<pubDate>Thu, 24 Oct 2019 10:30:25 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/40204/iitm-tokyo-tech-joint-symposium</link>
	<title><![CDATA[IITM-Tokyo Tech Joint Symposium]]></title>
	<description><![CDATA[<p>The IITM-Tokyo Tech Joint Symposium is a biannual international symposium held in Indian Institute of Technology Madras (IITM), India in collaboration with Tokyo Institute of Technology (Tokyo-Tech), Japan. During the symposium, experts in various domains of Bioinformatics gather from India and Japan under one roof to discuss and present their works. This provides an unique opportunity to the researchers and students to learn the frontiers and interact with eminent scientists in Bioinformatics. The 5th IITM - Tokyo Tech Joint Symposium titled "Current trends in Bioinformatics: Big data analysis, machine learning and drug design", will be held on 6th - 7th March 2020 in IITM, Chennai, India.</p><p>The symposium will focus on topics in the below mentioned areas.</p><p>Topics: Algorithms for biomolecular sequences / structures Bioinformatics databases and tools Protein function Structure based drug design Machine learning Deep learning Large scale data analysis Big Data NGS Analysis Protein interactions/network Molecular modelling/docking/screening Biomolecular structure and function More</p><p>Info: https://web.iitm.ac.in/bioinfo2/symposium2020/home</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>