<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/36191?offset=280</link>
	<atom:link href="https://bioinformaticsonline.com/related/36191?offset=280" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/20672/jrfra-structuralcomputational-biology-at-icgeb</guid>
  <pubDate>Thu, 29 Jan 2015 11:52:40 -0600</pubDate>
  <link></link>
  <title><![CDATA[JRF/RA Structural/Computational Biology at ICGEB]]></title>
  <description><![CDATA[
<p>Research Associate and JRF positions in the Structural and Computational Biology Group starting 1st March 2015. Collaborative projects include work on:</p>

<p>a) bioinformatics, systems and computational biology <br />b) malaria <br />c) drug discovery <br />d) genomics <br />e) microbiology <br />f) metabolic disorders <br />g) molecular medicine</p>

<p>Eligibility: Applicants must have one of the following :</p>

<p>1) INSPIRE award for undertakig either PhD or Postdoctoral research; <br />2) SPM award for PhD; <br />3) JRF for pursuing PhD from CSIR/DBT/ICMR</p>

<p>Interest and experience in Biochemistry/Bioinformatics/Biophysics/ Chemistry/Genomics/Molecular Biology/ is essential.</p>

<p>Submit curriculum vitae to sb.icgeb@gmail.com by 20 February 2015</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/21453/ra-research-associate-bioinformaticscomputational-biologist</guid>
  <pubDate>Thu, 26 Feb 2015 03:44:24 -0600</pubDate>
  <link></link>
  <title><![CDATA[RA / Research Associate Bioinformatics/Computational Biologist]]></title>
  <description><![CDATA[
<p>The following posts are urgently required to be filled for the Department of Biotechnology, Government of India funded project entitled "Computational Core for Plant Metabolomics" administrated by Prof Indira Ghosh, School of Computational and Integrative Sciences, Jawaharlal Nehru University, New Delhi-110 067 </p>

<p>RA / Research Associate (Bioinformatics/Computational Biologist) <br />Salary: Rs. 23000/- + HRA <br />Vacancy: 1 <br />Essential Qualifications: PhD, preferably in plant biotechnology/biochemistry/Bioinformatics with experience in analyzing high throughput omics-based data. Desired Skills: Prior experience in handling and guiding bioinformatics, metabolomics data, managing the project portal, preparing and filing reports etc. Will be expected to communicate with user groups and coordinate with LIMS group in Hyderabad and the Cheminformatics group in Delhi.</p>

<p>Address:	Prof Indira Ghosh, room #12 Project Investigator, (Core Metabolomics) School of Computational and Integrative Sciences, Jawaharlal Nehru University, New Delhi-110 067.</p>

<p>Apply Details	<br />Last Date: March 3rd 2015 <br />Web/Notification URL	http://www.jnu.ac.in/Career/currentjobs. htm</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/21312/r-for-microsoft-excel</guid>
	<pubDate>Wed, 18 Feb 2015 00:43:27 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/21312/r-for-microsoft-excel</link>
	<title><![CDATA[R for Microsoft Excel]]></title>
	<description><![CDATA[<div><p>If you currently use a spreadsheet like Microsoft Excel for data analysis, you might be interested in taking a look at this <a href="https://districtdatalabs.silvrback.com/intro-to-r-for-microsoft-excel-users" target="_blank">tutorial on how to transition from Excel to R</a>&nbsp;by Tony Ojeda. The tutorial explains how to use R functions in place of Excel formulas, including tools like =AVERAGE and =VLOOKUP. For the most part, it uses modern R packages to keep the R code clear and concise.</p><p>You'll likely still be using Excel as a data source, though, so you'll also want to check out this <a href="http://www.milanor.net/blog/?p=779" target="_blank">guide to importing data from Excel to R</a> from MilanoR.</p></div><p>Reference http://www.r-bloggers.com/an-r-tutorial-for-microsoft-excel-users/</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/21444/a-guide-for-complete-r-beginners-installing-r-packages</guid>
	<pubDate>Tue, 24 Feb 2015 20:23:34 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/21444/a-guide-for-complete-r-beginners-installing-r-packages</link>
	<title><![CDATA[A guide for complete R beginners :- Installing R packages]]></title>
	<description><![CDATA[<p>Part of the reason R has become so popular is the vast array of packages available at the <a href="http://cran.r-project.org/" target="_blank">cran</a> and <a href="http://www.bioconductor.org/" target="_blank">bioconductor</a> repositories. In the last few years, the number of packages has grown <a href="http://blog.revolutionanalytics.com/2010/09/what-can-other-languages-learn-from-r.html" target="_blank">exponentially</a>!</p><p>This is a short post giving steps on how to actually install R packages. Let&rsquo;s suppose you want to install the <a href="http://had.co.nz/ggplot2/" target="_blank">ggplot2</a> package. Well nothing could be easier. We just fire up an R shell and type:<br /><code><br />&gt; install.packages("ggplot2")</code></p><p>In theory the package should just install, however:</p><ul>
<li>if you are using Linux and don&rsquo;t have root access, this command won&rsquo;t work.</li>
<li>you will be asked to select your local mirror, i.e. which server should you use to download the package.</li>
</ul><h4>Installing packages without root access</h4><p>First, you need to designate a directory where you will store the downloaded packages. On my machine, I use the directory <code>/data/Rpackages/</code> After creating a package directory, to install a package we use the command:<br /><code><br />&gt; install.packages("ggplot2"</code><code>, lib="/data/Rpackages/")<br />&gt; library(ggplot2, lib.loc="/data/Rpackages/")<br /></code></p><p>It&rsquo;s a bit of a pain having to type <code>/data/Rpackages/</code> all the time. To avoid this burden,&nbsp; we create a file <code>.Renviron</code> in our home area, and add the line <code>R_LIBS=/data/Rpackages/</code> to it. This means that whenever you start R, the directory <code>/data/Rpackages/</code> is added to the list of places to look for R packages and so:</p><p><code>&gt; install.packages("ggplot2"</code><code>)<br />&gt; library(ggplot2)</code></p><p>just works!</p><h4>Setting the repository</h4><p>Every time you install a R package, you are asked which repository R should use. To set the repository and avoid having to specify this at every package install, simply:</p><ul>
<li>create a file <code>.Rprofile</code> in your home area.</li>
<li>Add the following piece of code to it:</li>
</ul><p><code><br />cat(".Rprofile: Setting UK repositoryn")<br />r = getOption("repos") # hard code the UK repo for CRAN<br />r["CRAN"] = "http://cran.uk.r-project.org"<br />options(repos = r)<br />rm(r)<br /></code></p><p>I found this tip in a stackoverflow <a href="http://stackoverflow.com/questions/1189759/expert-r-users-whats-in-your-rprofile/1189826#1189826" target="_blank">answer </a>.</p>]]></description>
	<dc:creator>Archana Malhotra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/22017/binc-2015</guid>
	<pubDate>Sat, 11 Apr 2015 20:35:27 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/22017/binc-2015</link>
	<title><![CDATA[BINC 2015 !!!]]></title>
	<description><![CDATA[<p>Pondicherry University,Puducherry,on behalf of Department of Biotechnology, Government of India, will conduct the BINC examination in2015. The objective of this examination is to certify bioinformatics professionals, trained formally as well as self-trained.Registration will open from March 9,2015 to April 30,2015. Pondicherry University, Puducherry has been identified as a nodal agency by the Department of Biotechnology, Govt. of India to coordinate this examination along with nine centres namely, Pune University, Pune; Anna University, Chennai; Calcutta University, Kolkata; Institute of Bioinformatics &amp; Applied Biotechnology, Bangalore; North-Eastern Hill University, Shillong, University of Hyderabad, Hyderabad; University of Kerala, Thiruvananthapuram; Jawaharlal Nehru University, New Delhi and Assam Agricultural University, Guwahati. In the BINC 2013 examination,17 candidates were certified. DBT has agreed to fund Research fellowships for all the BINC qualified Indian nationals to pursue Ph.D. in Indian Institutes/Universities. Note that the candidate must possess a postgraduate degree(or equivalent) &amp; meet the criteria of the institutes/universities in order to avail research fellowship. In addition, cash prize of Rs. 10,000/- will be awarded to the top 10 BINC qualifiers.</p><p>More at http://www.binc.co.in/College/Index_New.aspx</p><p>BINC notification http://www.binc.co.in/PdfDocuments/Notification.pdf</p><p>Few dates to remember:</p><p>Starting of online submission of application: March 9, 2015<br />Last date for submission of application: April 30,2015<br />Examination consists of two parts:<br />Part I (Paper I) : June 7, 2015 (10 AM-12 PM)<br />Part II ( Paper II &amp; III) :June 28, 2015 (9 AM-12 PM &amp; 2 PM-4 PM)</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/22053/binc-sample-question-paper</guid>
	<pubDate>Thu, 16 Apr 2015 09:16:18 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/22053/binc-sample-question-paper</link>
	<title><![CDATA[BINC Sample Question Paper !!!]]></title>
	<description><![CDATA[<p>BINC sample question paper. Wish you all the best for BINC examination.</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/22053" length="4041" type="text/plain" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/22769/ensembl-27</guid>
	<pubDate>Tue, 16 Jun 2015 16:10:36 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/22769/ensembl-27</link>
	<title><![CDATA[Ensembl 27]]></title>
	<description><![CDATA[<h3>What is new?</h3><ul>
<li>Expansion of Protists and Fungi with hundreds of annotated genomes</li>
<li>Variation data for bread wheat, rice, <em>Aedes aegypti</em>, and <em>Ixodes scapularis</em></li>
<li>Whole genome alignments for <em>O. longistaminata</em> and <em>T. cacao</em></li>
<li>Non-coding RNA gene models in <a href="http://bacteria.ensembl.org">Bacteria</a></li>
<li>New assembly of tomato (version 2.50)</li>
<li>Full support for UCSC Track Hub format for hosting your own data in Ensembl</li>
</ul><p>More at http://www.ensembl.info/blog/2015/06/16/ensembl-genomes-release-27-is-out/</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/poll/view/22920/how-long-have-you-been-a-bioinformatics-scientist-for</guid>
	<pubDate>Tue, 23 Jun 2015 10:55:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/poll/view/22920/how-long-have-you-been-a-bioinformatics-scientist-for</link>
	<title><![CDATA[How long have you been a bioinformatics scientist for?]]></title>
	<description><![CDATA[<p>Most of the researcher have been a scientist whole life, but infact they actually started paying&nbsp; it with at certain time.So, how long have you been in bioinformatics domain now?</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>