• the Damerau–Levenshtein distance allows insertion, deletion, substitution, and the transposition of two adjacent characters;
• the longest common subsequence (LCS) distance allows only insertion and deletion, not substitution;
• the Hamming distance allows only substitution, hence, it only applies to strings of the same length.
• the Jaro distance allows only transposition.

use Text::Levenshtein qw(distance);

 print distance("foo","four");
 # prints "2"

 my @words     = qw/ four foo bar /;
 my @distances = distance("foo",@words);

 print "@distances";
 # prints "2 0 3"

use Algorithm::LCSS qw( LCSS CSS CSS_Sorted );
    my $lcss_ary_ref = LCSS( \@SEQ1, \@SEQ2 );  # ref to array
    my $lcss_string  = LCSS( $STR1, $STR2 );    # string
    my $css_ary_ref = CSS( \@SEQ1, \@SEQ2 );    # ref to array of arrays
    my $css_str_ref = CSS( $STR1, $STR2 );      # ref to array of strings
    my $css_ary_ref = CSS_Sorted( \@SEQ1, \@SEQ2 );  # ref to array of arrays
    my $css_str_ref = CSS_Sorted( $STR1, $STR2 );    # ref to array of strings

There are many different modules on CPAN for calculating the edit distance between two strings. Here's just a selection.

Text::LevenshteinXS and Text::Levenshtein::XS are both versions of the Levenshtein algorithm that require a C compiler, but will be a lot faster than this module.

The Damerau-Levenshtein edit distance is like the Levenshtein distance, but in addition to insertion, deletion and substitution, it also considers the transposition of two adjacent characters to be a single edit. The module Text::Levenshtein::Damerau defaults to using a pure perl implementation, but if you've installed Text::Levenshtein::Damerau::XS then it will be a lot quicker.

Text::WagnerFischer is an implementation of the Wagner-Fischer edit distance, which is similar to the Levenshtein, but applies different weights to each edit type.

Text::Brew is an implementation of the Brew edit distance, which is another algorithm based on edit weights.

Text::Fuzzy provides a number of operations for partial or fuzzy matching of text based on edit distance. Text::Fuzzy::PP is a pure perl implementation of the same interface.

String::Similarity takes two strings and returns a value between 0 (meaning entirely different) and 1 (meaning identical). Apparently based on edit distance.

Text::Dice calculates Dice's coefficient for two strings. This formula was originally developed to measure the similarity of two different populations in ecological research.

Bioinformatician are not anti-social; We are just genome friendly.

Bioinformatician would love to change the biological world, but they won't give us the genetic code :P

If at first you don't succeed; call it version 1.0

The glass is neither half-full nor half-empty: it's actually have several genomes.

I'm BioGeek.

Fedup with LIPS, try God script.

Idiot, Go ahead, make my data!

Thank god, my genome just compiled.

Error message: "Out of space on genome drive:"

Shut up mobile elements, or i'll flush you out.

Never underestimate the internet bandwidth, u gotta incomplete.

Applied fuzzy logic to understand God's logic?

Warning! Overflow, delete chromosome !

Be nice to the BioGeek, for all you know they might be the next curator!

Beware of computational biologist they screw genes and protein.

Warning! Your genome is full of garbage, delete it !

Bad or missing mouse genome. Spank the cat? (Y/N)

Genome make very fast, very accurate mistakes.

Let's BLAST it.

Some genome never has transposons. It just develops random features.

Go watch CINEMA and have BLAST.

awk '/pattern1/ {Actions}
/pattern2/ {Actions}' file

The working of Awk is as follows
Awk reads the input files one line at a time.
For each line, it matches with given pattern in the given order, if matches performs the corresponding action.
If no pattern matches, no action will be performed.
In the above syntax, either search pattern or action are optional, But not both.
If the search pattern is not given, then Awk performs the given actions for each line of the input.
If the action is not given, print all that lines that matches with the given patterns which is the default action.
Empty braces with out any action does nothing. It wont perform default printing operation.
Each statement in Actions should be delimited by semicolon.
Say you have data.tsv with the following contents:

$ cat data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
By default Awk prints every line from the file.

$ awk '{print;}' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
We print the line which matches the pattern contig3

$ awk '/contig3/' data/test.tsv
contig3 ACTTATATATATATA
Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.

$ awk '{print $1","$2;}' data/test.tsv
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT

$ awk '{print $1","$NF;}' data/test.tsv
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT

Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:

BEGIN { Actions before reading the file}
{Actions for everyline in the file}
END { Actions after reading the file }

For example,
$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv
Header,Sequence
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT
-------
We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths > 14:

$ awk '{print (length($2)>14) ? $0">14" : $0"<=14";}' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG>14
contig2 ACTTTATATATT<=14
contig3 ACTTATATATATATA>14
contig4 ACTTATATATATATA>14
contig5 ACTTTATATATT<=14
We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:

$ awk 'NR==3{$0=$1}1' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),

$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv
contig1 contig1 contig1
contig2 contig2 contig2
contig3 contig3 contig3
contig4 contig4 contig4
contig5 contig5 contig5
Although, we can also skip executing later blocks for a given line by using next keyword:

$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv
contig1 contig1
contig2 contig2
contig3
contig4 contig4
contig5 contig5

$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv
contig1 contig1
contig2 contig2

contig4 contig4
contig5 contig5
You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:

$ awk 'BEGIN{while((getline k <"data/test.tsv")>0) print "BEGIN:"k}{print}' data/test.tsv
BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
BEGIN:contig2 ACTTTATATATT
BEGIN:contig3 ACTTATATATATATA
BEGIN:contig4 ACTTATATATATATA
BEGIN:contig5 ACTTTATATATT
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:

$ awk '{i[$1]=1}END{for (j in i) print j"<="i[j]}' data/test.tsv
contig1<=1
contig2<=1
contig3<=1
contig4<=1
contig5<=1

1. Update new things continuously
As per my personal experience, it’s not always easy to work as a bioinformatician!  There are couple of reasons to say that; First computational part of biology make our life’s a little harder compared to other professional categories. The fact - for instance - that the technology cycle in the bioinformatics world is very short, the actual knowledge becomes outdated in a few months or years. Therefore, we need to learn continuously - new things get important. Second, to stay on top of things we really need the strong will to be good at our job. That's probably the most important characteristic to bioinformatician. They are usually an excellent knowledge worker with great technical abilities, and have the will to be that over decades!

2. Avoid the sentence "I did not know what to do!"
In our computational biology lab, we generally face lots of technical problems. But as you know, it's impossible to know everything to do the computational biology jobs ( Yup.. because you need diverse and multidisciplinary knowledge to understand biological problems and resolve their respective solutions), therefore it's absolutely necessary that a bioinformatician finds its way through a new topic. How I typically do that is I use google and I talk to other experts in our laboratory or online biostar community to find out what they think. "I did not know what to do!" should not be an argument for us.

3. To make oneself useful
Several time it does happen, you finished our task earlier than expected; in such cases if you have some time left then: Take a coffee and play chess; reversi, etc. In my case I take a rest. Afterwards I think about what I could do that helps the team to achieve its targets, 'cause some of my team mates probably didn't finish! (at least if I didn't met them at coffee bar !!)

4. Care for all
During my rigorous research duration; I attended several workshop organized by my University departments. I had a discussion with other research fellow, professors; I generally ask … what it really takes to make a team successful or to be a successful research leader. They always said: "Well, you need some caring people!" I think there is a lot truth in that statement. If we do not care about quality, timelines, good team culture, respectful communication (!!), clean code, if all this doesn’t matter to us, then I believe the probability is higher that we fail in research and analysis.

5. Be good with people
Because bioinformatician and computational biologist jobs typically involves to work in a (most wanted J cross-departmental!) team, therefore it's important that we're (more or less) good in dealing with other individuals. Everyone have their own strengths and weaknesses, just like us. It's important to treat all the research team mates with respect, regardless of their technical competence or contributions. Of course, sometimes people deserve a clear statement (!!!), but try to do these things one-on-one. Make sure nobody loses his face. Attend the meetings at the coffee bar; be good at table top soccer and go out once in a while to have a beer with your team. You know what I'm talking about.

At the end of a week I look back and I ask myself what I have produced. This could be paperwork, community days or (best!!) programming code. Always remember there is always a solution to a problem. Most of the times there are at least three solutions. So, don’t just blame, suggest a solution.

That's it. I am looking forward to your thoughts and comments!

Bii.a-star.edu.sg

Bio research and development. Has course information and research information.

Isb-sib.ch

SIB operates the ExPASy proteomics server and the Swiss node of EMBnet. Teaching activities include a series of post-graduate courses given at the Universities of Geneva and Lausanne, as well as at the EPFL, and a Masters Degree in bioinformatics. Major research areas include the development of integrated databases and software resources in the field of proteomics.

Bioinformatics.ca

Provides information about bioinformatics in Canada. Workshops, certification and resources.

Chickscope.beckman.uiuc.edu

Students raise chicken embryos in the classroom and obtain magnetic resonance images through the Internet.

Bcb.iastate.edu

Graduate program at Iowa State University offering Undergraduate Major (BCBio) and the PhD program (BCB).

Bu.edu/bioinformatics/

Interdisciplinary PhD and Masters Programs that include an internship in the local industry companies. In conjunction with the NE masters program.

Bioinformatics.ubc.ca

A computational biology research centre covering many areas of genomics, proteomics, computer science and statistics. Research, training, news and events, resources and support, director's message, faculty and personnel.

Openhelix.com

Provides onsite training on specific bioinformatics databases and tools. Also offers bioinformatic software testing and research consulting services.

Igb.uci.edu

Specializing in making publicly available software and database services for computational biology.

Bioinformatics.pe.kr

Maintained by Dr. Seyeon Weon, Korea providing information on courses, a database archive, software archive and online resources.

Groups.yahoo.com/group/bimatics/

Bioinformatics group for students interested and/or working in the bioinformatics/computationalbiology fields. Offers opportunities to exchanging information and sharing ideas.

Ncbi.nlm.nih.gov/books/NBK22183/

Information about several medically important genes and related diseases. Illustrates the use of bioinformatics in their study.

Bioinfo.mbb.yale.edu/mbb452a/2003/

Bioinformatics course at Yale University. All course slides are available online.

Cs.iastate.edu/~honavar/comp-bio-courses.html

Listing of computational molecular biology course pages that have extensive online course materials.

Bioinf.manchester.ac.uk/dbbrowser/bioactivity/prefacefrm.html

A web-based tutorial associated with "Introduction to bioinformatics" published by Addison Wesley Longman.

Northeastern.edu/bioinformatics/

From the Biology department and in cooperation with Boston University. Emphasis on the ability to integrate knowledge from biological, computational, and mathematical disciplines.

Biocomp.unibo.it/lsbioinfo/

A two year, international master's programme in bioinformatics at the Universita di Bologna, Italy.

Cs.helsinki.fi/bioinformatiikka/mbi/programme.html

A two year Masters Degree Programme in Bioinformatics (MBI) offered by the University of Helsinki and Helsinki University of Technology, Finland.

Ornl.gov/sci/techresources/Human_Genome/education/education.shtml

A resource for introductory information on the Human Genome Project.

His.se/bioinformatics

A one-year, international master's programme in bioinformatics at the University of Skovde, Sweden.

Members.tripod.com/C.elegans/

Resources in biochemical, molecular, cellular, system, and organism biology, including over 25,000 indexed links, accumulated since 2000, from topic menus or from search interface.

Bioinformatics.org/faq/#contents

Summary of basics of bioinformatics for the intelligent newcomer.

Jiscmail.ac.uk/archives/bioinformatics.html

Forum featuring various aspects, events and developments in the bioinformatics field.

Biinoida.blogspot.com

Blog focusing on bioinformatics, biotechnology, pharma regulatory affairs, IPR and clinical trials.

Colorbasepair.com/bioinformatics_courses_tutorials.html

A list of on-line course materials and tutorials for bioinformatics and computational biology.

Geospiza.com/education/

Instructional materials for teaching bioinformatics. These include animated tutorials on topicssuch as BLAST, finding mutations in a protein, and graphing with MS-Excel.

Bioinformatics.fi

An international, two-year Master's programme jointly managed by the University of Tampere and the University of Turku, Finland.

Perlsource.net

Provides online courses in Perl programming for bioinformatic tools.

For knowledge about Linux and their importance amongst bioinformatician plesae read this article "An introduction to Linux for bioinformatics" by Paul Stothard.

Linux cheat sheet at http://bioinformaticsonline.com/file/view/87/linux-cheat-sheet

Please browse for futher useful linux pages on right hand side ...

The programs and the package are free software for academic users. Permission to use, copy, and modify any part of this software for educational, research and non-profit purposes is hereby granted. In this package or Docker image, number of other supported software has been integrated which may be under other licenses, along with any direct or indirect dependencies of the primary software being contained. As for any pre-built image usage, it is the image user's responsibility to ensure that any use of this image complies with any relevant licenses for all software contained within.

All software packages are distributed in the hope that they will be useful but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. If you have any query, please contact at raghava@iiitd.ac.in.

Address of the bookmark: https://hub.docker.com/r/raghavagps/gpsrdocker/

Screen is like a window manager for your console. It will allow you to keep multiple terminal sessions running and easily switch between them. It also protects you from disconnection, because the screen session doesn’t end when you get disconnected.

You’ll need to make sure that screen is installed on the server you are connecting to. If that server is Ubuntu or Debian, just use this command:

sudo apt-get install screen

Now you can start a new screen session by just typing screen at the command line. You’ll be shown some information about screen. Hit enter, and you’ll be at a normal prompt.

To disconnect (but leave the session running)

Hit Ctrl + A and then Ctrl + D in immediate succession. You will see the message [detached]

To reconnect to an already running session

screen -r

To reconnect to an existing session, or create a new one if none exists

screen -D -r

To create a new window inside of a running screen session

Hit Ctrl + A and then C in immediate succession. You will see a new prompt.

To switch from one screen window to another

Hit Ctrl + A and then Ctrl + A in immediate succession.

To list open screen windows

Hit Ctrl + A and then W in immediate succession

Louisiana Biomedical Research Network (LBRN) announces registration for it's Summer 2019 Bioinformatics Training Program. The program will be focused on processing, analysis and interpretation of next generation sequecning data for biologists. Learn more:

https://edu.t-bio.info/louisiana-biomedical-research-network-summer-2019-lbrn-bioinformatics-training-program/

'du' – Check the size of a directory

$ du
This command ( du) gives you a list of directories that exist in the current working directory along with their sizes in kilobytes (default). The last line of the output gives you the total size of the current directory including its subdirectories.

$ du /home/jin1
The above command would give you the directory size of the directory /home/david

$ du -h
The same “du”command with some flag gives you a better output than the default one. The option '-h' stands for human readable format. Therefore, in order to print the sizes of the files / directories in your desire notation use this time suffixed with a 'k' if its kilobytes and 'M' if its Megabytes and 'G' if its Gigabytes.

$ du -ah
If you are interested in checking everything present in a folder use above mentioned command. It gives us not only the directories but also all the files that are present in the current directory. The “-a” flag displays the filenames along with the directory names in the output.

$ du -c
This gives you a grand total as the last line of the output. So if your directory occupies 30MB the last 2 lines of the output would be 30M.

$ du -s
Use this command to displays a summary of the directory size. It is the simplest way to know the total size of the current directory.

$ du -S
This would display the size of the current directory excluding the size of the subdirectories that exist within that directory. So it basically shows you the total size of all the files that exist in the current directory.

$ du --exculde=mp3
Several times it required to exclude some directory in our size calculation. In such cases the above command would display the size of the current directory along with all its subdirectories, but it would exclude all the files having the given pattern present in their filenames.

'df' - finding the disk free space / disk usage

$ df
Hmmm … now “df” command is really useful, and I guess you are going to use it over time. Typing the above command, outputs a table consisting of 6 columns. All the columns are very easy to understand. Remember that the 'Size', 'Used' and 'Avail' columns use kilobytes as the unit. The 'Use%' column shows the usage as a percentage which is also very useful.

$ df -h
Displays the same output as the previous command but the '-h' indicates human readable format. Hence instead of kilobytes as the unit the output would have 'M' for Megabytes and 'G' for Gigabytes.

Example: Linux installed on /dev/hda1
$ df -h | grep /dev/hda1

All right, this is not the only option to check the sizes and free spaces but there are a few more options that can be used with 'du' and 'df' . I will discuss it later.