Reference@http://www.datasciencecentral.com/profiles/blogs/one-page-r-a-survival-guide-to-data-science-with-r

• Templates for the Data Scientist
  1. A Template for Preparing Data: *OnePageR - *R
  2. A Template for Building Models: *OnePageR - *R
• Getting Started as a Data Scientist
  1. Getting Started with R and Rattle: *Lecture - *Laboratory
  2. Introducing and Interacting with R: *Lecture - *Laboratory
  3. BasicR - OnePage(R) - Writing R scripts
• Dealing With Data
  1. Read Data into R: *OnePageR - *R
  2. Explore and Summarise Data: *OnePageR - *R
  3. Transform Data: *OnePageR - *R
  4. Dealing with Dates and Time: (PDF, R) Dates and Time
  5. Visualising Data with GGPlot2: *OnePageR - *R
  6. Visualising Data with Maps *OnePageR - *R
  7. Spatial (R) Spatial Analysis
  8. Handling Big Data *OnePageR - *R
• Descriptive Analytics
  1. Cluster Analysis: *Lecture - *OnePageR - *R
  2. Association Analysis: *Lecture
• Predictive Analytics
  1. Decision Trees: *Lecture - *OnePageR - *R - *Rattle
  2. Ensembles of Decision Trees: *Lecture - *OnePageR - *R
  3. SVM (R)
  4. KernLab (R)
  5. NeuralNetworks (R)
  6. NNet (R)
• Model Delivery
  1. Evaluating Models: *OnePageR - *R
  2. Evaluation (R)
  3. Scoring (R)
  4. PMML (R) Exporting Models for Deployment
• Advanced Topics
  1. Text Mining: *OnePageR - *R
• Advanced R Topics
  1. Plots (PDF, R) Miscellaneous Plots
  2. Functions (PDF, R) Writing Functions in R
  3. Parallel (PDF, R) Parallel Execution
  4. Packaging (R) Pulling it Together into a Package
  5. Doing R with Style: *OnePageR - *R
  6. Literate Data Mining with KnitR: *Lecture - *OnePageR - *

We are also interested in the large-scale integration of genomic, expression, methylation and proteomic data sets, as well as the application of whole genome sequence analysis in clinical diagnostics.

More at http://millslab.ccmb.med.umich.edu/index.html

What are SNPs?
SNPs (pronounced "snips") are positions in the genome where individuals differ by a single nucleotide. For example:

Reference: ...A T G C A T G A...
Variant:     ...A T G T A T G A...

Here, the C in the reference genome has been replaced by a T in the variant.

SNPs occur roughly every 300–1,000 bases in the human genome, meaning there are millions of them scattered throughout our DNA. Most SNPs have no effect on health, but some are linked to disease susceptibility, drug response, and other traits.

Why Do We Analyze SNPs?
1. Medical Genetics

Identify disease-associated variants (e.g., BRCA1/2 in breast cancer).

Predict drug response (pharmacogenomics).

Enable precision medicine by tailoring treatments.

2. Population Genetics & Ancestry

Trace human migration and ancestry.

Study genetic diversity within and between populations.

3. Agriculture & Animal Breeding

Select for desirable traits (drought resistance, yield, disease resistance).

Improve breeding efficiency in livestock.

4. Evolutionary Biology

Track natural selection.

Study adaptation in wild populations.

How is SNP Analysis Performed?
SNP analysis can be broadly divided into three steps:

SNP Detection
Genotyping arrays: Chips that test hundreds of thousands of known SNP positions simultaneously. Fast and affordable, widely used in consumer ancestry testing.

Whole-genome or whole-exome sequencing: Can detect known and novel SNPs across the genome.

Targeted sequencing or PCR: For focused analysis of specific regions.

Variant Calling
Sequencing data is aligned to a reference genome. Bioinformatics tools (e.g., GATK, bcftools) identify positions where the sequenced sample differs from the reference.

Annotation and Interpretation
Tools (e.g., SnpEff, VEP) predict the functional impact of SNPs.

Are the SNPs in coding regions? Do they cause amino acid changes? Are they known to be pathogenic?

Databases like dbSNP, ClinVar, and GWAS Catalog provide information on known associations.

Common Tools for SNP Analysis
Alignment: BWA, Bowtie2

Variant Calling: GATK, FreeBayes

Visualization: IGV, UCSC Genome Browser

Annotation: SnpEff, VEP

Statistical Analysis: PLINK, SNPTEST

Challenges in SNP Analysis
False positives/negatives: Sequencing errors, alignment issues.

Population stratification: Confounding in association studies.

Interpretation: Many SNPs have unknown or complex effects.

Researchers address these with rigorous quality control, large datasets, and increasingly sophisticated statistical models.

The Future of SNP Analysis
With advances in sequencing technology and AI-driven analysis, SNP studies are expanding:

Polygenic risk scores predict disease risk based on thousands of SNPs.

Large-scale biobanks (e.g., UK Biobank, All of Us) enable powerful genome-wide association studies (GWAS).

CRISPR and functional assays help validate SNP effects in the lab.

SNP analysis is at the heart of the genomic revolution, promising insights into biology, health, and evolution at unprecedented scale.

Conclusion
From diagnosing rare diseases to designing better crops, SNP analysis is a foundational tool in modern science. As our ability to sequence and interpret genomes improves, so will our understanding of these tiny—but mighty—variations in DNA.

Human genetic variation
Inference of human evolutionary history from genetic markers
Statistical analysis of population-genetic data
Mathematical models of gene genealogies
Theoretical population genetics
Combinatorics of evolutionary trees
The relationship between gene trees and species trees
The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility
More at https://web.stanford.edu/group/rosenberglab/index.html

1. FASTA
2. FASTQ
3. SAM
4. BAM
5. VCF
6. GFF
7. GTF

Address of the bookmark: https://bioinformatics.uconn.edu/resources-and-events/tutorials/file-formats-tutorial/

Pakyong

F.No:NRCO/Admn/DBT /136 /

Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.

‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”

Junior Research Fellow (One post)

Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.

Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques

2nd June 2015

Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Qualifications : Ph. D.

Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics

No. of Post : 03

Department : Genetics

Salary : Rs. 60,000/-
How to apply

The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.

Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&cntnt01articleid=5492&cntnt01returnid=83