<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/36281?offset=720</link>
	<atom:link href="https://bioinformaticsonline.com/related/36281?offset=720" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/21242/summer-intern-research-bioinformatics</guid>
  <pubDate>Mon, 16 Feb 2015 12:26:32 -0600</pubDate>
  <link></link>
  <title><![CDATA[Summer Intern - Research Bioinformatics]]></title>
  <description><![CDATA[
<p>Be proficient in LINUX, know perl or python, understand biology and Next Generation Sequencing.<br />The intern will port Agile Assay Design pipelines into Galaxy.<br />The intern will also learn to develope his/her own bioinformatics pipelines for PCR or NGS data analysis.</p>

<p>Who you are<br />You’re someone who wants to influence your own development. You’re looking for a company where you have the opportunity to pursue your interests across functions and geographies. Where a job title is not considered the final definition of who you are, but the starting point.</p>

<p>Qualifications:<br />Major: Bioinformatcis or biology major who is interested and wants to learn Biocomputing, At least 2 years of college.<br />Basic knowledge of LINUX and programming, e.g., perl, python, XML.</p>

<p>More at http://www.roche.com/careers/jobs/jobsearch/job.htm?id=E-00437679&amp;locale=en&amp;title=Summer%20Intern%20-%20Research%20Bioinformatics</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/21444/a-guide-for-complete-r-beginners-installing-r-packages</guid>
	<pubDate>Tue, 24 Feb 2015 20:23:34 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/21444/a-guide-for-complete-r-beginners-installing-r-packages</link>
	<title><![CDATA[A guide for complete R beginners :- Installing R packages]]></title>
	<description><![CDATA[<p>Part of the reason R has become so popular is the vast array of packages available at the <a href="http://cran.r-project.org/" target="_blank">cran</a> and <a href="http://www.bioconductor.org/" target="_blank">bioconductor</a> repositories. In the last few years, the number of packages has grown <a href="http://blog.revolutionanalytics.com/2010/09/what-can-other-languages-learn-from-r.html" target="_blank">exponentially</a>!</p><p>This is a short post giving steps on how to actually install R packages. Let&rsquo;s suppose you want to install the <a href="http://had.co.nz/ggplot2/" target="_blank">ggplot2</a> package. Well nothing could be easier. We just fire up an R shell and type:<br /><code><br />&gt; install.packages("ggplot2")</code></p><p>In theory the package should just install, however:</p><ul>
<li>if you are using Linux and don&rsquo;t have root access, this command won&rsquo;t work.</li>
<li>you will be asked to select your local mirror, i.e. which server should you use to download the package.</li>
</ul><h4>Installing packages without root access</h4><p>First, you need to designate a directory where you will store the downloaded packages. On my machine, I use the directory <code>/data/Rpackages/</code> After creating a package directory, to install a package we use the command:<br /><code><br />&gt; install.packages("ggplot2"</code><code>, lib="/data/Rpackages/")<br />&gt; library(ggplot2, lib.loc="/data/Rpackages/")<br /></code></p><p>It&rsquo;s a bit of a pain having to type <code>/data/Rpackages/</code> all the time. To avoid this burden,&nbsp; we create a file <code>.Renviron</code> in our home area, and add the line <code>R_LIBS=/data/Rpackages/</code> to it. This means that whenever you start R, the directory <code>/data/Rpackages/</code> is added to the list of places to look for R packages and so:</p><p><code>&gt; install.packages("ggplot2"</code><code>)<br />&gt; library(ggplot2)</code></p><p>just works!</p><h4>Setting the repository</h4><p>Every time you install a R package, you are asked which repository R should use. To set the repository and avoid having to specify this at every package install, simply:</p><ul>
<li>create a file <code>.Rprofile</code> in your home area.</li>
<li>Add the following piece of code to it:</li>
</ul><p><code><br />cat(".Rprofile: Setting UK repositoryn")<br />r = getOption("repos") # hard code the UK repo for CRAN<br />r["CRAN"] = "http://cran.uk.r-project.org"<br />options(repos = r)<br />rm(r)<br /></code></p><p>I found this tip in a stackoverflow <a href="http://stackoverflow.com/questions/1189759/expert-r-users-whats-in-your-rprofile/1189826#1189826" target="_blank">answer </a>.</p>]]></description>
	<dc:creator>Archana Malhotra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/33629/list-of-universities-offering-bachelor-master-or-phd-bioinformatics-degree-in-malaysia</guid>
	<pubDate>Thu, 22 Jun 2017 01:34:02 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/33629/list-of-universities-offering-bachelor-master-or-phd-bioinformatics-degree-in-malaysia</link>
	<title><![CDATA[List of universities offering Bachelor,  Master or PhD bioinformatics degree in Malaysia]]></title>
	<description><![CDATA[<p>Bioinformatics is a newly emerging interdisciplinary research area, which may be defined as the ―interface between biological and computational sciences. Most of the Bioinformatics work that is done can be described as analyzing biological data, although a growing number of projects deal with the organization of biological information. The global Bioinformatics industry has grown at a double-digit growth rate in the past and is expected to follow the same pattern in the next four years. US remains the largest market in the world, but Asia-Pacific countries, particularly India and China, are witnessing the fastest growth and are anticipated to emerge as the dominating forces in future. The Comparison of Bioinformatics Industry between Malaysia, India and other countries&nbsp;are discussed in this&nbsp;<span>http://ijbssnet.com/journals/Vol.%202_No._10;_June_2011/11.pdf paper.</span></p><p>Bioinformatics is full of opportunities. The sector is poised to open new avenues for the other related sectors also. But the biggest opportunity area in the Bioinformatics market will be in the drug discovery sector. Reduction of both the cost and time taken to discover a new drug due to fast development in the Bioinformatics tools and software zone is also making drug discovery an attractive field to venture in. Malaysian bioinformatics growth and future are discuss in this https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2723929/ paper.&nbsp;Keeping all such inportance in mind, following universities in Malaysia offering bioinformatics cources:</p><p><strong>3 program(s) at AIMST University<strong>, Malaysia</strong></strong></p><p>Master of Science in Biotechnology (MSc) - Bioinformatics by Research</p><p>Master of Science (M.Sc) in Medical Microbiology (Bioinformatics) by Research</p><p>Doctor of Philosophy in Biotechnology (PhD) - Bioinformatics by Research</p><p>&nbsp;</p><p><strong>1 program(s) at INTI International University and Colleges<strong>, Malaysia</strong></strong></p><p>American Degree Transfer Program (Biosciences) in Bioinformatics</p><p>&nbsp;</p><p><strong>3 program(s) at Management and Science University (MSU)<strong>, Malaysia</strong></strong></p><p>Master in Bioinformatics (By Research)</p><p>PhD in Bioinformatics</p><p>Bachelor in Bioinformatics (Hons)</p><p>&nbsp;</p><p><strong>1 program(s) at Multimedia University (MMU)<strong>, Malaysia</strong></strong></p><p>Bachelor of Science (Honours) Bioinformatics</p><p>&nbsp;</p><p><strong>1 program(s) at Universiti Industri Selangor (UNISEL) Bestari Jaya Campus<strong>, Malaysia</strong></strong></p><p>Bachelor of Bioinformatics (Hons)</p><p>&nbsp;</p><p><strong>2 program(s) at Universiti Malaysia Sabah (UMS)<strong>, Malaysia</strong></strong></p><p>PhD - Doctor of Philosophy in Bioinformatics (By Research)</p><p>MSc - Master of Science in Bioinformatics (By Research)</p><p>&nbsp;</p><p><strong>6 program(s) at Universiti Putra Malaysia (UPM)<strong>, Malaysia</strong></strong></p><p>MSc - Master of Science in Bioinformatics by Research</p><p>Master of Science in Bioinformatics and System Biology by Research</p><p>Master of Science (M.Sc) in Bioinformatics and Systems Biology (With Thesis)</p><p>PhD - Doctor of Philosophy in Bioinformatics by Research</p><p>PhD - Doctor of Philosophy in Bioinformatics and Systems Biology (With Thesis)</p><p>PhD - Doctor of Philosophy in Bioinformatics and System Biology by Research</p><p>&nbsp;</p><p><strong>1 program(s) at Universiti Selangor (UNISEL)<strong>, Malaysia</strong></strong></p><p>Bachelor of Bioinformatics (Hons)</p><p>&nbsp;</p><p><strong>3 program(s) at Universiti Teknologi Malaysia (UTM)<strong>, Malaysia</strong></strong></p><p>M.Sc - Master of Science (Bioscience) in Bioinformatics Research Group (BIRG) By Research</p><p>PhD - Doctor of Philosophy (Bioscience) in Bioinformatics Research Group (BIRG) By Research</p><p>Bachelor of Computer Science (BioInformatics)</p><p>&nbsp;</p><p><strong>4 program(s) at University of Malaya (UM)<strong>, Malaysia</strong></strong></p><p>MSc - Master of Science in Bioinformatics by Research</p><p>Master in Bioinformatics by Coursework</p><p>PhD - Doctor of Philosophy in Bioinformatics by Research</p><p>Bachelor of Science (BSc) in Bioinformatics</p><p>&nbsp;</p><p><strong>3 program(s) at Perdana University<strong>, Malaysia</strong></strong></p><p>Master in Bioinformatics (By Research)</p><p>PhD in Bioinformatics</p><p>Bachelor in Bioinformatics (Hons)</p><p>&nbsp;</p><p><strong>3 program(s) at&nbsp;Monash University, Malaysia</strong></p><p>Master in Bioinformatics (By Research)</p><p>PhD in Bioinformatics</p><p>Bachelor in Bioinformatics (Hons)</p><p>&nbsp;</p><p><span>The real bioinformatics scope lies if there are research labs which work in this field. One has to take account of that. If so then try to get information of those labs and visit them to get a hang of the work they pursue. For detail Bioinformatics in Malaysia: Hope, Initiative, Effort, Reality, and Challenges are discussed in&nbsp;<span>https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2723929/ paper.</span></span></p>]]></description>
	<dc:creator>sahabuddin</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/21685/uiar-short-term-trainingfinal-year-dissertation-project-in-life-sciencesbioinformaticsbiotech</guid>
  <pubDate>Mon, 16 Mar 2015 23:56:25 -0500</pubDate>
  <link></link>
  <title><![CDATA[UIAR Short-Term Training/Final Year Dissertation Project in Life Sciences/Bioinformatics/Biotech]]></title>
  <description><![CDATA[
<p>Short-term training/Final year dissertation project</p>

<p>Candidates desirous of doing a short-term training / final year dissertation project for MSc (Life Sciences/Bioinformatics/Biotechnology or any science discipline) at UIAR Biophysics and Bioinformatics department may please drop an email atanju@iiar.res.in along with their resume.</p>

<p>Selected candidates will be further intimated. There will be a fees charged for doing the project at UIAR. The projects will be experimental or computational or involve both.</p>

<p>The training scope will be in the following areas but not limited to:</p>

<p>Bioinformatics analysis, Docking and Virtual screening, Molecular Dynamics simulation, Cloning, expression and purification of proteins, Biophysical and Biochemical characterisation of proteins, Crystallization and Structural Studies.</p>

<p>Advertisement: www.iiar.res.in/?q=node/450</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/21894/bioinformatics-engineer-algorithm-development</guid>
  <pubDate>Wed, 01 Apr 2015 21:39:05 -0500</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatics Engineer -- Algorithm Development]]></title>
  <description><![CDATA[
<p>Centrillion Biosciences is a venture backed life sciences company located in Palo Alto, California. The company provides high quality genomic services to academic and industrial customers including top universities and research institutes. Centrillion Biosciences has an immediate opening for a full-time Bioinformatics Engineer. We're looking for an energetic, innovative, and motivated person who works well independently and on teams. The ideal candidate will have experience designing and implementing efficient algorithms to process large datasets. The role will involve collaborating with research scientists and other engineers, so strong communication skills are a must.</p>

<p>Job Description</p>

<p>• Work within a fast-paced, collaborative environment with small project teams working on a variety of tasks ranging from new product development to DNA data processing<br />• Collaborate with Centrillion research scientists in order to bridge the gap between the laboratory and the digital world<br />• Develop tools to enable research projects to cope with the enormous amounts of data produced by modern DNA sequencing experiments<br />• Build simulation algorithms to help guide and analyze research done in the lab<br />• Solve challenging engineering problems that require the development of innovative algorithms</p>

<p>Requirements</p>

<p>• Strong background in mathematics/statistics with a degree in a related field<br />• Strong analytical, coding, communication, and organizational skills<br />• Experience with algorithm development, simulations, and data analysis<br />• Proficiency in at least one modern programming language (like Python or Perl)<br />• Experience analyzing genetic and biological data sets (e.g., DNA data analysis and image analysis)<br />• Experience with machine learning and pattern recognition is preferred</p>

<p>Please submit your resume at https://www.centrillionbio.com/career/ to apply for this position.</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22287/research-fellows-at-aimscs-hyderabad</guid>
  <pubDate>Wed, 06 May 2015 06:23:33 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Fellows at AIMSCS, Hyderabad]]></title>
  <description><![CDATA[
<p>C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS) - Hyderabad, Andhra Pradesh<br />Advertisement No.: 5/2015</p>

<p>Research Fellows Systems Biology job vacancy in C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS)</p>

<p>JRF : Qualification - M. Sc in Bioinformatics, Systems Biology, M. Sc statistics, or M. Tech in Bioinformatics,</p>

<p>Pay Scale : Rs. 25,000</p>

<p>SRF : Qualification- Qualification prescribed for JRF with 2 years of research experience.</p>

<p>Pay Scale : Rs. 28,000*</p>

<p>No.of Post: 2</p>

<p>Desirable: Candidates should have strong background in Computational biology, bioinformatics, statistics and algorithmic development. In addition to that previous experience of working on Linux, bio-informatics, NGS data analysis and Basic knowledge of biology is desirable. Programming on any one of the programming languages (C, C++, perl, python) and statistical framework (e.g. R, matlab, etc.) is highly desirable.</p>

<p>More at http://www.crraoaimscs.org/jrf_application_form_2015.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/22403/ryan-e-mills-lab</guid>
  <pubDate>Tue, 26 May 2015 09:29:24 -0500</pubDate>
  <link></link>
  <title><![CDATA[Ryan E. Mills Lab]]></title>
  <description><![CDATA[
<p>Our research group is primarily focused on the analysis of whole genome sequence data to identify genetic variation (primarily structural variation) and examine their potential functional impact in disease phenotypes. We are particularly interested in analyzing complex regions of the genome that are not easily resolved through modern sequencing approaches and which may exhibit interesting mechanistic origins.</p>

<p>We are also interested in the large-scale integration of genomic, expression, methylation and proteomic data sets, as well as the application of whole genome sequence analysis in clinical diagnostics. </p>

<p>More at http://millslab.ccmb.med.umich.edu/index.html</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/22416/rosenberg-lab</guid>
  <pubDate>Wed, 27 May 2015 17:52:24 -0500</pubDate>
  <link></link>
  <title><![CDATA[Rosenberg lab]]></title>
  <description><![CDATA[
<p>Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:</p>

<p>    Human genetic variation<br />    Inference of human evolutionary history from genetic markers<br />    Statistical analysis of population-genetic data<br />    Mathematical models of gene genealogies<br />    Theoretical population genetics<br />    Combinatorics of evolutionary trees<br />    The relationship between gene trees and species trees<br />    The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility <br />More at https://web.stanford.edu/group/rosenberglab/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>