<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/36384?offset=460</link>
	<atom:link href="https://bioinformaticsonline.com/related/36384?offset=460" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7362/junior-research-fellow-jrf-project-fellow-kalasalingam-university</guid>
  <pubDate>Thu, 19 Dec 2013 13:23:39 -0600</pubDate>
  <link></link>
  <title><![CDATA[Junior Research Fellow (JRF) / Project Fellow @ Kalasalingam University]]></title>
  <description><![CDATA[
<p>Applications are invited from interested candidates for the post of one Junior Research Fellow / Project Fellow on a purely temporary basis in a time bound research project (3 years) sponsored by Science and Engineering Research Board, Government of India, New Delhi.</p>

<p>Name of the fellowship: Junior Research Fellow (JRF) / Project Fellow</p>

<p>Title of the project: Genome-wide Mapping of Murine Specific Dengue T-cell Epitopes: Computational Prediction, Identification and use as Candidate Vaccines</p>

<p>Duration: 3 years</p>

<p>Fellowship: Rs. 18,000 for first 2 years and Rs. 20,000 for 3rdyear (for M.Tech. candidates)</p>

<p>Rs. 16,000 for first 2 years and Rs. 18,000 for 3rdyear (for M.Sc. candidates with NET qualification)</p>

<p>Rs. 8,000 for first 2 years and Rs. 10,000 for 3rdyear (for M.Sc. candidates without NET qualification)</p>

<p>Qualifications: M.Tech. in Biotechnology / M.Sc. in any branch of Life Sciences</p>

<p>Desirable Experience: Minimum of two years research experience in any of the following areas: Immunology / Microbiology / Gene Manipulation / Bioinformatics</p>

<p>Interested and eligible candidates may apply with their resume along with relevant documents and a passport size photograph to the Principal Investigator by post (or e-mail) on or before December 31, 2013. Only short listed candidates will be called for written test and/or interview. Selected candidate may register for PhD in Kalasalingam University. No TA/DA will be paid for attending interview.</p>

<p>Dr. K. Sundar<br />Principal Investigator (SERB Project)<br />Department of Biotechnology<br />Kalasalingam University<br />Krishnankoil – 626126, Tamil Nadu<br />sundarkr@klu.ac.in</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/7812/bioinformatics-infrastructure-speed-up-indian-agriculture</guid>
	<pubDate>Tue, 07 Jan 2014 12:44:44 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/7812/bioinformatics-infrastructure-speed-up-indian-agriculture</link>
	<title><![CDATA[Bioinformatics infrastructure speed up Indian agriculture]]></title>
	<description><![CDATA[<p>"<span>Realizing the paradigm shift it can bring about, the government is focusing on increased bioinformatics intervention in agri-sciences. Currently under process, the national grid on bioinformatics is expected make much better sense out of huge genomic" - </span></p><p><span></span><a href="http://www.biospectrumindia.com/biospecindia/features/203849/supercomputing-indian-agriculture-fast-track-mode/page/1">http://www.biospectrumindia.com/biospecindia/features/203849/supercomputing-indian-agriculture-fast-track-mode/page/1</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7567/asst-professor-jaipur-national-university</guid>
  <pubDate>Fri, 27 Dec 2013 19:54:40 -0600</pubDate>
  <link></link>
  <title><![CDATA[Asst. Professor @ JAIPUR NATIONAL UNIVERSITY]]></title>
  <description><![CDATA[
<p>JAIPUR NATIONAL UNIVERSITY</p>

<p>Established by Government of Rajasthan</p>

<p>Approved by UGC under Sec 2(f) of UGC Act 1956</p>

<p>ADVERTISEMENT FOR FACULTY POSITION AT JAIPUR NATIONAL UNIVERSITY,JAIPUR</p>

<p>Jaipur National University, Jaipur is a premier centre of learning, providing various integrated and interdisciplinary programmes of study and research in the country. With the opening of the School of Distance Education &amp; Learning, JNU has taken education to the doorsteps of those aspirants who, for some reason, could not be a part of regular stream of education. In this era of competition &amp; ambition for excellence, it has become imperative to have quality education &amp; an alert mind coupled with the right attitude to carry onself, and for this, JNU happens to be the most sought after destination.</p>

<p>School Of Life Sciences: Bioinformatics, Chemistry</p>

<p>Total no of Post: 04</p>

<p>Education:</p>

<p>PG – M.Sc /M.Tech Bioinformatics</p>

<p>PG – M.Sc /M.Tech Chemistry</p>

<p>Experience:</p>

<p>Candidate with 1-2 years of teaching experience in college/ University will be preffered. Freshers may also apply.</p>

<p>Compensation: Compensation will not be a problem for the right candidate</p>

<p>HOW TO APPLY:</p>

<p>SEND THE UPDATED RESUME THROUGH MAIL OR POST AT</p>

<p>dsbhatia5@yahoo.com</p>

<p>contact no: 7568246839</p>

<p>Website: http://www.jnujaipur.ac.in</p>

<p>Please mail your resume to Prof.D.S.Bhatia</p>

<p>Email Address: dsbhatia5@yahoo.com</p>

<p>Ph:, +917568246839</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/17885/international-conference-on-bioinformatics-models-methods-and-algorithms</guid>
	<pubDate>Sun, 05 Oct 2014 11:42:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/17885/international-conference-on-bioinformatics-models-methods-and-algorithms</link>
	<title><![CDATA[International Conference on Bioinformatics Models, Methods and Algorithms]]></title>
	<description><![CDATA[<p><span>The purpose of the International Conference on Bioinformatics Models, Methods and Algorithms is to bring together researchers and practitioners interested in the application of computational systems and information technologies to the field of molecular biology, including for example the use of statistics and algorithms to understanding biological processes and systems, with a focus on new developments in genome bioinformatics and computational biology. Areas of interest for this community include sequence analysis, biostatistics, image analysis, scientific data management and data mining, machine learning, pattern recognition, computational evolutionary biology, computational genomics and other related fields.</span></p>
<p><span><span>Position Paper Submission Extension:</span><span>&nbsp;</span><span>October 9, 2014</span><span>&nbsp;</span><br><span>Regular Paper Authors Notification:</span><span>&nbsp;</span><span>November 3, 2014</span><span>&nbsp;</span><br><span>Position Paper Authors Notification:</span><span>&nbsp;</span><span>November 6, 2014</span><span>&nbsp;</span><br><span>Regular and Position Paper Camera Ready and Registration:</span><span>&nbsp;</span><span>November 17, 2014</span><span>&nbsp;</span></span></p><p>Address of the bookmark: <a href="http://www.bioinformatics.biostec.org/" rel="nofollow">http://www.bioinformatics.biostec.org/</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7933/senior-programmer-biotech-park</guid>
  <pubDate>Mon, 20 Jan 2014 04:50:36 -0600</pubDate>
  <link></link>
  <title><![CDATA[SENIOR PROGRAMMER @ Biotech Park]]></title>
  <description><![CDATA[
<p>Advt. No. (1)/BP/2014<br />A walk-in-interview will be held in the Biotech Park Office at Sector G, Jankipuram, Kursi Road, Lucknow (U.P.) January 31, 2014 at 11.00 A.M. for the following posts of DBT sponsored project tenable at Biotech Park. Interested candidates fulfilling the requisite qualifications, experience and age as given below, on the date of interview, may appear before the Selection Committee. The candidate will have to join immediately. Appointment will be made initially for six months extendable on satisfactory performance till the duration of the project.<br />INTERVIEW ON January 31, 2014 at 11.00 A.M.<br /> <br />SENIOR PROGRAMMER (ONE POST)<br />Educational Qualification<br />M.Sc./B. Tech Bioinformatics with minimum 60% marks with two years of relevant experience	<br />Job Requirement	<br />Development of databases in multi user environment and application softwares, updating and maintenance of website, Drug designing and QSAR study etc.<br />Desirable<br />Knowledge of Bioinformatics tools, Windows, Linux, C++, JAVA / JAVA Script, Visual Basic, CGI, DBMS/RDBMS and HTML. Experience in various domains of bioinformatics such as structure based drug designing, Newtonian dynamics and QSAR studies.<br />Age<br />Below 35 years (as on the date of interview)<br />Emoluments<br />Rs. 12,000/- per month fixed.<br />Note: All the candidates should report for interview on or before 10.30 A.M<br />General Conditions<br />The aforesaid positions are purely temporary and do not give the incumbent any right whatsoever for appointment on regular basis.<br />The applicant will have to submit typed and duly signed application on plain paper on the day of interview stating:<br />    (a) Advertisement No.<br />    (b) Position applied for<br />    (c) Name of Applicant (in Block letters)<br />    (d) Father’s Name<br />    (e) Date of Birth<br />    (f) Sex<br />    (g) Age as on the date of interview (dd / mm / yy )<br />    (h) Address (Permanent &amp; correspondence)<br />    (i) Educational Qualifications (High School onwards) with examination passed, year, % marks, subjects<br />    (j) Employment experience, if any i.e. Name of employer, nature of employment, date of joining and leaving.<br />Applications must be accompanied by a latest passport size photograph and attested copies of certificates<br />Original certificates/degree and testimonials should be produced by the candidate for verification at the time of interview.</p>

<p>Tenure: Initially upto six months and extendable based on performance.<br />The upper age limit can be relaxed up to 5 years in the case of applicant belonging to SC/ST/Woman/Physically handicapped and 3 years for OBCs.<br />No TA/DA will be paid for attending the interview.<br />More at http://www.biotechpark.org.in/index1.htm</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8384/post-doc-in-genomics-of-fungi</guid>
  <pubDate>Tue, 18 Feb 2014 13:47:08 -0600</pubDate>
  <link></link>
  <title><![CDATA[Post-doc in Genomics of Fungi]]></title>
  <description><![CDATA[
<p>Post-doc in Genomics of Fungi</p>

<p>Fungi are of central importance for the global carbon cycle because of<br />their role in the degredation of complex organic matter such as plant<br />material. Fungi also represent one of the last frontiers of<br />biodiversity, as their taxonomic diversity and metabolic potential<br />remain poorly understood. This is particularly true for those fungi that<br />are abundant in freshwaters.</p>

<p>\"MycoLink\" (Linking aquatic mycodiversity to ecosystem function) is an interdisciplinary project integrating the expertise of 4 Leibniz Institutes: IGB, ZALF, DSMZ, the Leibniz-Institute of Freshwater Ecology and Inland Fisheries (IGB), the Leibniz Centre for Agricultural Landscape Research (ZALF), and the Leibniz-Institute of Zoo- and Wildlife Research in Berlin (IZW). We are seeking to recruit outstanding young scientists to establish an innovative research program, and currently invite applications for:</p>

<p>PostDoc will focus on global biodiversity and evolutionary genomics of freshwater fungi, using second- and third-generation sequencing and bioinformatics to analyse natural populations and experimental cultures. For further information, contact Michael T. Monaghan (monaghan@igb-berlin.de) (http://monaghanlab.org).</p>

<p>PostDoc will focus on the ecological and functional role of aquatic fungi by combining state-of-the-art biochemical analyses with modeling in experimental and natural ecosystems. For further information, contact Hans-Peter Grossart &amp; Katrin Premke (hgrossart@igb-berlin.de; premke@igb-berlin.de)</p>

<p>Applicants must hold a PhD in a relevant field. Positions are available for up to three years. Salary is according to the German TvD. Positions will be based at IGB Berlin, IGB Neuglobsow, and at the Berlin Centre for Genomics in Biodiversity Research. The institutes of the Leibniz Association strive to increase the proportion of female scientists. Therefore, female candidates are specifically encouraged to apply. Disabled applicants with identical technical and personal qualification will be preferentially selected.</p>

<p>Please submit a curriculum vitae (including publication list), a brief statement of motivation and research interests, and the names and contact information of two referees. Please send all documents as a single pdf file to monaghan@igb-berlin.de. </p>

<p>Review of the applications will start on 21 February 2014 and continue until the positions are filled. Interviews for shortlisted applicants will take place in March.</p>

<p>Biodiversity, Ecology, and Genomics of Aquatic Fungi<br />Leibniz-Institute of Freshwater Ecology and Inland Fisheries (IGB), Berlin, Germany</p>

<p>Deadline for applications : unknown.</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23121/senior-sas-programmer-urgent-role-permanant-welwyn-garden-city-uk</guid>
  <pubDate>Fri, 03 Jul 2015 08:14:23 -0500</pubDate>
  <link></link>
  <title><![CDATA[Senior SAS Programmer - URGENT ROLE - Permanant - Welwyn Garden City - UK]]></title>
  <description><![CDATA[
<p>SAS Programmer URGENTLY required !! My client is looking for an experienced Senior SAS Programmer, to join their bubbly dynamic team in Welwyn Garden City. You must have experience within SAS and/or R programming language. I am looking for someone with a background within either Life Sciences, Statistics, Computer Science, Bioinformatics etc. I am looking for someone with leadership qualities, you must have excellent analyst skills. Please call Dareen Evans on 01772 278050 or email your cv to dareen.evans@itworkshealth.co.uk</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8122/internships-indian-institute-of-science</guid>
  <pubDate>Sun, 02 Feb 2014 03:05:58 -0600</pubDate>
  <link></link>
  <title><![CDATA[Internships @ Indian Institute of Science]]></title>
  <description><![CDATA[
<p>Internships available for Bachelors and Masters students</p>

<p>Each node will host student interns interested in pursuing a research career in mathematical or computational biology at institutions located in its region.</p>

<p>Eligibility: Bachelors (3rd or 4th year) and Masters students</p>

<p>Average duration: 3 months (could be more in certain cases). These internships can be availed at any time during 2014 subject to consent from the faculty mentor.</p>

<p>Fellowship amount: Rs. 10,000 per month. In addition, outstation interns can receive up to Rs. 5000 per month for accommodation and Rs. 3000 for travel from and to their home place.</p>

<p>Application procedure: Apply online at http://nnmcb.appzone.co.in/</p>

<p>Deadline: February 10, 2014</p>

<p>Contact Information:</p>

<p>National Network for Mathematical and Computational Biology</p>

<p>Department of Mathematics</p>

<p>Indian Institute of Science</p>

<p>Bangalore 560 012</p>

<p>Tel: 080-2293 2893</p>

<p>Email: nnmcb@math.iisc.ernet.in</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</guid>
	<pubDate>Thu, 07 Dec 2017 08:46:51 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</link>
	<title><![CDATA[Edit distance application in bioinformatics !]]></title>
	<description><![CDATA[<p>There are other popular measures of&nbsp;<a href="https://en.wikipedia.org/wiki/Edit_distance" title="Edit distance">edit distance</a>, which are calculated using a different set of allowable edit operations. For instance,</p><ul>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Damerau%E2%80%93Levenshtein_distance" title="Damerau&ndash;Levenshtein distance">Damerau&ndash;Levenshtein distance</a>&nbsp;allows insertion, deletion, substitution, and the&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>&nbsp;of two adjacent characters;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Longest_common_subsequence_problem" title="Longest common subsequence problem">longest common subsequence</a>&nbsp;(LCS) distance allows only insertion and deletion, not substitution;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Hamming_distance" title="Hamming distance">Hamming distance</a>&nbsp;allows only substitution, hence, it only applies to strings of the same length.</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Jaro_distance" title="Jaro distance">Jaro distance</a>&nbsp;allows only&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>.</li>
</ul><p>&nbsp;</p><pre><span>use</span> Text<span>::</span>Levenshtein <span>qw</span><span>(</span>distance<span>);</span>

 <span>print</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>"four"</span><span>);</span>
 <span># prints "2"</span>

 <span>my</span> <span>@words</span>     <span>=</span> <span>qw</span><span>/ four foo bar /</span><span>;</span>
 <span>my</span> <span>@distances</span> <span>=</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>@words</span><span>);</span>

 <span>print</span> <span>"@distances"</span><span>;</span>
 <span># prints "2 0 3"</span><br /><br /><br /></pre><pre><span>use</span> Algorithm<span>::</span>LCSS <span>qw</span><span>(</span> LCSS CSS CSS_Sorted <span>);</span>
    <span>my</span> <span>$lcss_ary_ref</span> <span>=</span> <span>LCSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array</span>
    <span>my</span> <span>$lcss_string</span>  <span>=</span> <span>LCSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># string</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>    <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>      <span># ref to array of strings</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># ref to array of strings<br /><br /><br /><br /></span></pre><p>There are many different modules on CPAN for calculating the edit distance between two strings. Here's just a selection.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshteinXS">Text::LevenshteinXS</a>&nbsp;and&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3AXS">Text::Levenshtein::XS</a>&nbsp;are both versions of the Levenshtein algorithm that require a C compiler, but will be a lot faster than this module.</p><p>The Damerau-Levenshtein edit distance is like the Levenshtein distance, but in addition to insertion, deletion and substitution, it also considers the transposition of two adjacent characters to be a single edit. The module&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau">Text::Levenshtein::Damerau</a>&nbsp;defaults to using a pure perl implementation, but if you've installed&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau%3A%3AXS">Text::Levenshtein::Damerau::XS</a>&nbsp;then it will be a lot quicker.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AWagnerFischer">Text::WagnerFischer</a>&nbsp;is an implementation of the Wagner-Fischer edit distance, which is similar to the Levenshtein, but applies different weights to each edit type.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ABrew">Text::Brew</a>&nbsp;is an implementation of the Brew edit distance, which is another algorithm based on edit weights.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy">Text::Fuzzy</a>&nbsp;provides a number of operations for partial or fuzzy matching of text based on edit distance.&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy%3A%3APP">Text::Fuzzy::PP</a>&nbsp;is a pure perl implementation of the same interface.</p><p><a href="http://search.cpan.org/perldoc?String%3A%3ASimilarity">String::Similarity</a>&nbsp;takes two strings and returns a value between 0 (meaning entirely different) and 1 (meaning identical). Apparently based on edit distance.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ADice">Text::Dice</a>&nbsp;calculates&nbsp;<a href="https://en.wikipedia.org/wiki/S%C3%B8rensen%E2%80%93Dice_coefficient">Dice's coefficient</a>&nbsp;for two strings. This formula was originally developed to measure the similarity of two different populations in ecological research.</p><pre><span>&nbsp;</span></pre>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

</channel>
</rss>