<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/36384?offset=530</link>
	<atom:link href="https://bioinformaticsonline.com/related/36384?offset=530" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8384/post-doc-in-genomics-of-fungi</guid>
  <pubDate>Tue, 18 Feb 2014 13:47:08 -0600</pubDate>
  <link></link>
  <title><![CDATA[Post-doc in Genomics of Fungi]]></title>
  <description><![CDATA[
<p>Post-doc in Genomics of Fungi</p>

<p>Fungi are of central importance for the global carbon cycle because of<br />their role in the degredation of complex organic matter such as plant<br />material. Fungi also represent one of the last frontiers of<br />biodiversity, as their taxonomic diversity and metabolic potential<br />remain poorly understood. This is particularly true for those fungi that<br />are abundant in freshwaters.</p>

<p>\"MycoLink\" (Linking aquatic mycodiversity to ecosystem function) is an interdisciplinary project integrating the expertise of 4 Leibniz Institutes: IGB, ZALF, DSMZ, the Leibniz-Institute of Freshwater Ecology and Inland Fisheries (IGB), the Leibniz Centre for Agricultural Landscape Research (ZALF), and the Leibniz-Institute of Zoo- and Wildlife Research in Berlin (IZW). We are seeking to recruit outstanding young scientists to establish an innovative research program, and currently invite applications for:</p>

<p>PostDoc will focus on global biodiversity and evolutionary genomics of freshwater fungi, using second- and third-generation sequencing and bioinformatics to analyse natural populations and experimental cultures. For further information, contact Michael T. Monaghan (monaghan@igb-berlin.de) (http://monaghanlab.org).</p>

<p>PostDoc will focus on the ecological and functional role of aquatic fungi by combining state-of-the-art biochemical analyses with modeling in experimental and natural ecosystems. For further information, contact Hans-Peter Grossart &amp; Katrin Premke (hgrossart@igb-berlin.de; premke@igb-berlin.de)</p>

<p>Applicants must hold a PhD in a relevant field. Positions are available for up to three years. Salary is according to the German TvD. Positions will be based at IGB Berlin, IGB Neuglobsow, and at the Berlin Centre for Genomics in Biodiversity Research. The institutes of the Leibniz Association strive to increase the proportion of female scientists. Therefore, female candidates are specifically encouraged to apply. Disabled applicants with identical technical and personal qualification will be preferentially selected.</p>

<p>Please submit a curriculum vitae (including publication list), a brief statement of motivation and research interests, and the names and contact information of two referees. Please send all documents as a single pdf file to monaghan@igb-berlin.de. </p>

<p>Review of the applications will start on 21 February 2014 and continue until the positions are filled. Interviews for shortlisted applicants will take place in March.</p>

<p>Biodiversity, Ecology, and Genomics of Aquatic Fungi<br />Leibniz-Institute of Freshwater Ecology and Inland Fisheries (IGB), Berlin, Germany</p>

<p>Deadline for applications : unknown.</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/17885/international-conference-on-bioinformatics-models-methods-and-algorithms</guid>
	<pubDate>Sun, 05 Oct 2014 11:42:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/17885/international-conference-on-bioinformatics-models-methods-and-algorithms</link>
	<title><![CDATA[International Conference on Bioinformatics Models, Methods and Algorithms]]></title>
	<description><![CDATA[<p><span>The purpose of the International Conference on Bioinformatics Models, Methods and Algorithms is to bring together researchers and practitioners interested in the application of computational systems and information technologies to the field of molecular biology, including for example the use of statistics and algorithms to understanding biological processes and systems, with a focus on new developments in genome bioinformatics and computational biology. Areas of interest for this community include sequence analysis, biostatistics, image analysis, scientific data management and data mining, machine learning, pattern recognition, computational evolutionary biology, computational genomics and other related fields.</span></p>
<p><span><span>Position Paper Submission Extension:</span><span>&nbsp;</span><span>October 9, 2014</span><span>&nbsp;</span><br><span>Regular Paper Authors Notification:</span><span>&nbsp;</span><span>November 3, 2014</span><span>&nbsp;</span><br><span>Position Paper Authors Notification:</span><span>&nbsp;</span><span>November 6, 2014</span><span>&nbsp;</span><br><span>Regular and Position Paper Camera Ready and Registration:</span><span>&nbsp;</span><span>November 17, 2014</span><span>&nbsp;</span></span></p><p>Address of the bookmark: <a href="http://www.bioinformatics.biostec.org/" rel="nofollow">http://www.bioinformatics.biostec.org/</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8122/internships-indian-institute-of-science</guid>
  <pubDate>Sun, 02 Feb 2014 03:05:58 -0600</pubDate>
  <link></link>
  <title><![CDATA[Internships @ Indian Institute of Science]]></title>
  <description><![CDATA[
<p>Internships available for Bachelors and Masters students</p>

<p>Each node will host student interns interested in pursuing a research career in mathematical or computational biology at institutions located in its region.</p>

<p>Eligibility: Bachelors (3rd or 4th year) and Masters students</p>

<p>Average duration: 3 months (could be more in certain cases). These internships can be availed at any time during 2014 subject to consent from the faculty mentor.</p>

<p>Fellowship amount: Rs. 10,000 per month. In addition, outstation interns can receive up to Rs. 5000 per month for accommodation and Rs. 3000 for travel from and to their home place.</p>

<p>Application procedure: Apply online at http://nnmcb.appzone.co.in/</p>

<p>Deadline: February 10, 2014</p>

<p>Contact Information:</p>

<p>National Network for Mathematical and Computational Biology</p>

<p>Department of Mathematics</p>

<p>Indian Institute of Science</p>

<p>Bangalore 560 012</p>

<p>Tel: 080-2293 2893</p>

<p>Email: nnmcb@math.iisc.ernet.in</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23121/senior-sas-programmer-urgent-role-permanant-welwyn-garden-city-uk</guid>
  <pubDate>Fri, 03 Jul 2015 08:14:23 -0500</pubDate>
  <link></link>
  <title><![CDATA[Senior SAS Programmer - URGENT ROLE - Permanant - Welwyn Garden City - UK]]></title>
  <description><![CDATA[
<p>SAS Programmer URGENTLY required !! My client is looking for an experienced Senior SAS Programmer, to join their bubbly dynamic team in Welwyn Garden City. You must have experience within SAS and/or R programming language. I am looking for someone with a background within either Life Sciences, Statistics, Computer Science, Bioinformatics etc. I am looking for someone with leadership qualities, you must have excellent analyst skills. Please call Dareen Evans on 01772 278050 or email your cv to dareen.evans@itworkshealth.co.uk</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8520/rcb-gurgaon-bioinformatics-rapa-openings</guid>
  <pubDate>Thu, 27 Feb 2014 08:42:15 -0600</pubDate>
  <link></link>
  <title><![CDATA[RCB Gurgaon Bioinformatics RA/PA Openings]]></title>
  <description><![CDATA[
<p>Advt. No.1/2014</p>

<p>Recruitment for Research Associate and Project Assistant positions</p>

<p>Regional Centre for Biotechnology (RCB) is an autonomous academic institution established by the Department of Biotechnology, Govt. of India with regional and global partnerships synergizing with the programmes of UNESCO as a Category II Centre. The primary focus of RCB is to provide world class education, training and conduct innovative research at the interface of multiple disciplines to create high quality human resource in disciplinary and interdisciplinary areas of biotechnology in a globally competitive research milieu. </p>

<p>Research Associate (02 Position)</p>

<p>Consolidated emoluments Rs.22000/- + 30% H.R.A. p.m.</p>

<p>Essential: Ph.D. in Natural Sciences, minimum 60% marks in all qualifying exams and below 35 years of age.</p>

<p>Desirable: Prior experience at the PhD level in Biochemistry, Bioinformatics and Proteomics with a strong motivation for a career in research is highly desirable.</p>

<p>Strong PhD level training with proteins chemistry, protein purification and statistical analysis of proteomics or genomics dataset will be preferred. Either/ both qualifications should be substantiated by published papers.</p>

<p>Inter-Institutional Program for  Maternal, Neonatal and Infant  Sciences: A translational approach to studying preterm birth. </p>

<p>Principal Investigator: Dr. Dinakar M. Salunke </p>

<p>Applicants may apply along with the requisite documents (attested copies) pertaining to proof of date of birth, academic/professional qualifications, experience (if any), in the prescribed format available on our websites: www.rcb.res.in and www.rcb.ac.in. Applications should be sent to the Registrar, Regional Centre for Biotechnology, 180 Udyog Vihar Phase 1, Gurgaon-122016, Haryana, India, through Registered Post on or before Feb 28, 2014. A soft copy of the application should be sent by email to registrar@rcb.res.in. Incomplete applications or applications received after Feb 28, 2014 will not be entertained. </p>

<p>More at https://www.rcb.res.in/Advt-1._for_websites_PTB-revised.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</guid>
	<pubDate>Thu, 07 Dec 2017 08:46:51 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</link>
	<title><![CDATA[Edit distance application in bioinformatics !]]></title>
	<description><![CDATA[<p>There are other popular measures of&nbsp;<a href="https://en.wikipedia.org/wiki/Edit_distance" title="Edit distance">edit distance</a>, which are calculated using a different set of allowable edit operations. For instance,</p><ul>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Damerau%E2%80%93Levenshtein_distance" title="Damerau&ndash;Levenshtein distance">Damerau&ndash;Levenshtein distance</a>&nbsp;allows insertion, deletion, substitution, and the&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>&nbsp;of two adjacent characters;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Longest_common_subsequence_problem" title="Longest common subsequence problem">longest common subsequence</a>&nbsp;(LCS) distance allows only insertion and deletion, not substitution;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Hamming_distance" title="Hamming distance">Hamming distance</a>&nbsp;allows only substitution, hence, it only applies to strings of the same length.</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Jaro_distance" title="Jaro distance">Jaro distance</a>&nbsp;allows only&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>.</li>
</ul><p>&nbsp;</p><pre><span>use</span> Text<span>::</span>Levenshtein <span>qw</span><span>(</span>distance<span>);</span>

 <span>print</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>"four"</span><span>);</span>
 <span># prints "2"</span>

 <span>my</span> <span>@words</span>     <span>=</span> <span>qw</span><span>/ four foo bar /</span><span>;</span>
 <span>my</span> <span>@distances</span> <span>=</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>@words</span><span>);</span>

 <span>print</span> <span>"@distances"</span><span>;</span>
 <span># prints "2 0 3"</span><br /><br /><br /></pre><pre><span>use</span> Algorithm<span>::</span>LCSS <span>qw</span><span>(</span> LCSS CSS CSS_Sorted <span>);</span>
    <span>my</span> <span>$lcss_ary_ref</span> <span>=</span> <span>LCSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array</span>
    <span>my</span> <span>$lcss_string</span>  <span>=</span> <span>LCSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># string</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>    <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>      <span># ref to array of strings</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># ref to array of strings<br /><br /><br /><br /></span></pre><p>There are many different modules on CPAN for calculating the edit distance between two strings. Here's just a selection.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshteinXS">Text::LevenshteinXS</a>&nbsp;and&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3AXS">Text::Levenshtein::XS</a>&nbsp;are both versions of the Levenshtein algorithm that require a C compiler, but will be a lot faster than this module.</p><p>The Damerau-Levenshtein edit distance is like the Levenshtein distance, but in addition to insertion, deletion and substitution, it also considers the transposition of two adjacent characters to be a single edit. The module&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau">Text::Levenshtein::Damerau</a>&nbsp;defaults to using a pure perl implementation, but if you've installed&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau%3A%3AXS">Text::Levenshtein::Damerau::XS</a>&nbsp;then it will be a lot quicker.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AWagnerFischer">Text::WagnerFischer</a>&nbsp;is an implementation of the Wagner-Fischer edit distance, which is similar to the Levenshtein, but applies different weights to each edit type.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ABrew">Text::Brew</a>&nbsp;is an implementation of the Brew edit distance, which is another algorithm based on edit weights.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy">Text::Fuzzy</a>&nbsp;provides a number of operations for partial or fuzzy matching of text based on edit distance.&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy%3A%3APP">Text::Fuzzy::PP</a>&nbsp;is a pure perl implementation of the same interface.</p><p><a href="http://search.cpan.org/perldoc?String%3A%3ASimilarity">String::Similarity</a>&nbsp;takes two strings and returns a value between 0 (meaning entirely different) and 1 (meaning identical). Apparently based on edit distance.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ADice">Text::Dice</a>&nbsp;calculates&nbsp;<a href="https://en.wikipedia.org/wiki/S%C3%B8rensen%E2%80%93Dice_coefficient">Dice's coefficient</a>&nbsp;for two strings. This formula was originally developed to measure the similarity of two different populations in ecological research.</p><pre><span>&nbsp;</span></pre>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/8504/update-genome-workbench-2715-released</guid>
	<pubDate>Wed, 26 Feb 2014 16:12:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/8504/update-genome-workbench-2715-released</link>
	<title><![CDATA[Update Genome Workbench 2.7.15 released]]></title>
	<description><![CDATA[<p>NCBI Genome Workbench is an integrated application for viewing and analyzing sequence data. With Genome Workbench, you can view data in publically available sequence databases at NCBI, and mix this data with your own private data.</p><p><img src="http://www.ncbi.nlm.nih.gov/core/assets/gbench/images/firstscreen_still.gif" alt="Introductory screen shot" style="border: 0px; border: 0px;"></p><p>Genome Workbench can display sequence data in many ways, including graphical sequence views, various alignment views, phylogenetic tree views, and tabular views of data. It can also align your private data to data in public databases, display your data in the context of public data, and retrieve BLAST results.</p><p>Genome Workbench is built on the NCBI C++ ToolKit and uses cross-platform APIs for graphics. It runs on your local machine, and is available for Windows 2000/XP, Linux, MacOS X, and various flavors of Unix.</p><p>NCBI Genome Workbench is an integrated application for viewing and analyzing sequence data. Genome Workbench was developed entirely in-house at NCBI and makes use of the NCBI C++ ToolKit. The C++ ToolKit provides a convenient and flexible cross-platform API for managing system internals, database connections, network sockets, and the NCBI data model. In addition, the C++ ToolKit provides the Object Manager, which abstracts handling of sequences and sequence-related objects.</p><p>&nbsp;New Features in Genome Workbench 2.7.15 <br /><br /></p><ul>
<li>Multiple Alignment View: implemented adaptive feature display when zooming in</li>
<li>Active Objects Inspector replaces Selection Inspector. New View should offer an improved selection context examination. See Using Active Objects Inspector tutorial for more details.</li>
<li>Binary packages for Linux OpenSUSE 13.1 are now available</li>
</ul><p><br />Bug Fixes and Improvements in Genome Workbench 2.7.15 <br /><br /></p><ul>
<li>Fixed major issue with OpenGL overlay/scrolling. Could cause crashes or view scrolling irregularities</li>
<li>Multiple Pane View: fixed crash on loading BLAST results</li>
<li>Graphical Sequence View: fixed crash on zooming in and out, related to SNP track</li>
<li>Graphical Sequence View: fixed Go To Position dialog to give better diagnostics in case of a user error</li>
<li>Graphical Sequence View: PDF export fixed rendering of Markers with commas in the name</li>
<li>Text View / Flat File: fixed Mac OS rendering issues</li>
<li>Text View / Flat File: performance optimization, extended capabilities of real-time rendering of molecules to tens of thousands</li>
<li>File Import: optimization improvement to speed up load of files containing multiple project items</li>
<li>File Import: remapping stage now shows accession.version and description of molecules, instead of plain GI numbers</li>
<li>Mac OS: improved tooltips for toolbar buttons</li>
<li>Phylogenetic Tree Builder Tool: improved diagnostics of errors</li>
<li>Multiple Alignment View: optimizations to avoid main GUI freezes</li>
<li>Open Dialog: removed duplicate elements in table of genomes (load Genome)</li>
<li>PDF export: fixed issue with XREF table errors</li>
<li>Tree View: fixed issues with showing Force Layout progress on Mac OS</li>
<li>Tree View: PDF export fixed issues for showing labels of collapsed nodes</li>
<li>Tree View: added an option to stop layout</li>
<li>Tree View: broadcasting mechanism fixed not to accumulate selected nodes</li>
</ul><p>Reference:</p><p>NCBI news</p><p>http://www.ncbi.nlm.nih.gov/tools/gbench/</p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8857/junior-research-fellow-at-iari</guid>
  <pubDate>Mon, 10 Mar 2014 13:10:56 -0500</pubDate>
  <link></link>
  <title><![CDATA[Junior Research Fellow at IARI]]></title>
  <description><![CDATA[
<p>DIVISION OF NEMATOLOGY<br />INDIAN AGRICULTURAL RESEARCH INSTITUTE<br />NEW DELHI 110012</p>

<p>Applications are invited for the posts of one Junior Research Fellow in the DBT funded project entitled “Plant parasitic nematode genome informatics - insilico resource development”. The project is for a period of three years.</p>

<p>Essential qualifications for JRF: First class M. Sc. / M. Tech in Bioinformatics. Knowledge of programming language, pearl, Statistics and database – HTML, CSS, Java script.</p>

<p>Desirable qualifications: Experience in handling next generation sequencing data</p>

<p>Age limit: 35 years maximum (5 year relaxation for SC/ST and women candidates) Emoluments: 16,000 + 30% HRA.</p>

<p>The post is purely temporary in nature and is co-terminus with the project. The appointment would be initially for one year and may be extended further upon satisfactory performance.</p>

<p>Those who are interested in pursuing Ph.D with strong research aptitude are preferred.</p>

<p>Interested candidates may attend the Walk in interview on 25th March 2014 along with the duly filled application forms (format in the following page) with all the relevant documents.</p>

<p>Venue: Division of Nematology, Indian Agricultural Research Institute, New Delhi 110012 (Room No. 306, 3rd floor, LBS building)</p>

<p>Reporting Time: Interested candidates should report strictly between 10.00 to 10.30 AM.</p>

<p>Interview time: 10.30 AM</p>

<p>Short-listed candidates will be called for interview at New Delhi. However, no TA and DA will be paid for attending the interview.</p>

<p>Advertisement:</p>

<p>https://www.iari.res.in/files/JRF_Nema-07032014-20140307-170017.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</guid>
	<pubDate>Wed, 11 Apr 2018 13:31:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</link>
	<title><![CDATA[Project-based approach to improve bioinformatics education with skilled and meaningful access to omics data]]></title>
	<description><![CDATA[<p>Pine Biotech has been collaborating with Loyola University of New Orleans on piloting a new approach to bioinformatics education using the intuitive and logic-drive bioinformatics platform T-BioInfo.</p><p>https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>

</channel>
</rss>