<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/36525?offset=530</link>
	<atom:link href="https://bioinformaticsonline.com/related/36525?offset=530" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/33856/assembly-course</guid>
	<pubDate>Mon, 10 Jul 2017 09:38:05 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/33856/assembly-course</link>
	<title><![CDATA[Assembly Course]]></title>
	<description><![CDATA[<p>https://ocw.mit.edu/courses/biology/7-91j-foundations-of-computational-and-systems-biology-spring-2014/lecture-slides/MIT7_91JS14_Lecture6.pdf</p><p>Address of the bookmark: <a href="https://ocw.mit.edu/courses/biology/7-91j-foundations-of-computational-and-systems-biology-spring-2014/lecture-slides/MIT7_91JS14_Lecture6.pdf" rel="nofollow">https://ocw.mit.edu/courses/biology/7-91j-foundations-of-computational-and-systems-biology-spring-2014/lecture-slides/MIT7_91JS14_Lecture6.pdf</a></p>]]></description>
	<dc:creator>Shruti Paniwala</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/42626/spades-team-announce-new-version-spades-v315</guid>
	<pubDate>Fri, 15 Jan 2021 10:24:27 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/42626/spades-team-announce-new-version-spades-v315</link>
	<title><![CDATA[SPADes team announce new version SPADes v3.15]]></title>
	<description><![CDATA[<p>New SPAdes 3.15.0.0. announced by the SPADes team This release includes such new features as:&nbsp;<br />- CoronaSPAdes pipeline for the assembly of transcriptomic and metatranscriptomic data of full-length coronaviridae genomes;&nbsp;<br />- Meta-Viral and RNA-Viral pipelines for metagenomic and metatranscriptomic data defining viral genomes;&nbsp;<br />-New trusted contiguous use algorithm;&nbsp;<br />-Switched to the memory allocator mimalloc;&nbsp;<br />- PlasmidSPAdes and bgcSPAdes are now provided as an input assembly graph;&nbsp;<br />- Important improvements and corrections to the metaplasmid pipeline;&nbsp;<br />- Multiple performance improvements in procedures for simplification and repeat resolving.&nbsp;<br />Please, consider updating.</p><p>Check out more at&nbsp;https://cab.spbu.ru/software/spades/</p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42987/public-databases-for-bioinformatics</guid>
	<pubDate>Tue, 23 Mar 2021 05:32:15 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42987/public-databases-for-bioinformatics</link>
	<title><![CDATA[Public Databases for Bioinformatics !]]></title>
	<description><![CDATA[<pre>https://www.nature.com/articles/s41467-020-17155-y<br><br>Server Infrastructure:

File Server:

dhara: Synology 3614 Storage Appliance
4 Core Xeon
108TB disk storage
10Gb ethernet to SCG3
Access atx: dhara:5000
Has btsync server (try it - its much better than dropbox)

Compute Servers:

nandi: Kundaje and Phi Server
24 intel cores
256GB RAM
500GB of SSD storage 
36TB RAID6 local storage
4 Intel Phi's (space for 4 more GPU's)


durga: Montgomery and sensitive data
24 intel cores
256GB RAM
500GB of SSD RAID0 storage 
60TB RAID6 local storage

mitra: Bassik and Web/DB Server
24 core
256GB RAM 
500GB of SSD RAID0 storage 
36TB RAID6 local storage

vayu: Kundaje GPU server
4 core
64GB RAM 
200GB of SSD storage 
8TB RAID10 local storage
4 Nvidia GTX 970 4GB GPUs

amold: Bickel and SGE server
32 AMD core
128GB RAM 
200GB of SSD storage 
12TB RAID5 local storage

wotan: Bickel and SGE server
64 AMD core
256GB RAM 
200GB of SSD storage 
12TB RAID5 local storage

Filesystem:

/users/$USER
default home directory
full backups nightly 
nfs mount to dhara
should store code, papers, and other highly processed data here

/mnt/data/
globally accessible data
should store common data here
e.g. genomes and indexes, annotations, ENCODE data  
if you dont want this to count towards your quote you must chown

/mnt/lab_data/$LAB/
lab accessible data
should store lab project data here 
e.g. ATAC-seq prediction data, enhancer prediction, motif calls

/srv/scratch/$USER
fast local storage
not backed up, but on raid and data will never be deleted
most analysis should be performed here

/srv/persistent/$USER
fast local storage
synced nightly, but not backed up
       ie if the hard drives fail or you delete something and notice 
       within 24 hours we can recover. Otherwise not. (vs home which is 
       properly backed up )  
intermediate analysis products that would be hard to recover should be stored here 
       e.g. stochastic analysis results that need to be kept so that paper 
       results can be reproduced

/srv/www/$LABNAME/
web accessible from mitra.stanford.edu
*NOT BACKED UP*

Some parallel programming patterns:

# gzip a bunch of files
parallel gzip -- *.FILESTOGZIP

# fork example in python:
(for more detailed examples look at 
 https://github.com/nboley/grit/ grit/lib/multiprocessing_utils.py)

import os
import time
import random

import multiprocessing

class ProcessSafeOPStream( object ):
    def __init__( self, writeable_obj ):
        self.writeable_obj = writeable_obj
        self.lock = multiprocessing.Lock()
        self.name = self.writeable_obj.name
        return
    
    def write( self, data ):
        self.lock.acquire()
        self.writeable_obj.write( data )
        self.writeable_obj.flush()
        self.lock.release()
        return
    
    def close( self ):
        self.writeable_obj.close()

def worker(queue, ofp):
    # Try without this
    random.seed()
    while True:
        i = queue.get()
        if i == 'FINISHED': return
        # simulate an expensive function
        x = random.random()
        time.sleep(x/10)
        print i, x
        ofp.write("%i\t%s\n" % (i, x))

NSIMS = 10000
NPROC = 25

# populate queue
todo = multiprocessing.Queue()
for i in xrange(NSIMS): todo.put(i)
for i in xrange(NPROC): todo.put('FINISHED')

ofp = ProcessSafeOPStream( open("output.txt", "w") )

pids = []
for i in xrange(NPROC):
    pid = os.fork()
    if pid == 0:
       worker(todo, ofp)
       os._exit(0)
    else:
       pids.append(pid)  

for pid in pids:
    os.waitpid(pid, 0)

ofp.close()

print "FINISHED"<br><br></pre>
<p>For use case 1 we obtained the following ENCODE and ROADMAP datasets&nbsp;<a href="https://www.encodeproject.org/files/ENCFF446WOD/@@download/ENCFF446WOD.bed.gz">https://www.encodeproject.org/files/ENCFF446WOD/@@download/ENCFF446WOD.bed.gz</a>,&nbsp;<a href="https://www.encodeproject.org/files/ENCFF546PJU/@@download/ENCFF546PJU.bam">https://www.encodeproject.org/files/ENCFF546PJU/@@download/ENCFF546PJU.bam</a>,&nbsp;<a href="https://www.encodeproject.org/files/ENCFF059BEU/@@download/ENCFF059BEU.bam">https://www.encodeproject.org/files/ENCFF059BEU/@@download/ENCFF059BEU.bam</a>. Blacklisted regions were obtained from&nbsp;<a href="http://mitra.stanford.edu/kundaje/akundaje/release/blacklists/hg38-human/hg38.blacklist.bed.gz">http://mitra.stanford.edu/kundaje/akundaje/release/blacklists/hg38-human/hg38.blacklist.bed.gz</a>. The human genome version hg38 was obtained from&nbsp;<a href="http://hgdownload.cse.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz">http://hgdownload.cse.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz</a>.</p>
<p>For use case 2 we used the set of narrowPeak files summarized in&nbsp;<a href="https://github.com/wkopp/janggu_usecases/tree/master/extra/urls.txt">https://github.com/wkopp/janggu_usecases/tree/master/extra/urls.txt</a>&nbsp;(archived version v1.0.1). The human genome version hg19 was obtained from&nbsp;<a href="http://hgdownload.cse.ucsc.edu/goldenPath/hg19/bigZips/hg19.fa.gz">http://hgdownload.cse.ucsc.edu/goldenPath/hg19/bigZips/hg19.fa.gz</a></p>
<p>For use case 3 we used the ENCODE datasets&nbsp;<a href="https://www.encodeproject.org/files/ENCFF591XCX/@@download/ENCFF591XCX.bam">https://www.encodeproject.org/files/ENCFF591XCX/@@download/ENCFF591XCX.bam</a>,&nbsp;<a href="https://www.encodeproject.org/files/ENCFF736LHE/@@download/ENCFF736LHE.bigWig">https://www.encodeproject.org/files/ENCFF736LHE/@@download/ENCFF736LHE.bigWig</a>,&nbsp;<a href="https://www.encodeproject.org/files/ENCFF177HHM/@@download/ENCFF177HHM.bam">https://www.encodeproject.org/files/ENCFF177HHM/@@download/ENCFF177HHM.bam</a>&nbsp;as we as the GENCODE annotation v29 from&nbsp;<a href="ftp://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_29/gencode.v29.annotation.gtf.gz">ftp://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_29/gencode.v29.annotation.gtf.gz</a>.</p><p>Address of the bookmark: <a href="http://mitra.stanford.edu/" rel="nofollow">http://mitra.stanford.edu/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34567/jobtree-based-python-wrapper-to-run-the-genome-simulation-tool-suite-evolver</guid>
	<pubDate>Fri, 08 Dec 2017 16:26:32 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34567/jobtree-based-python-wrapper-to-run-the-genome-simulation-tool-suite-evolver</link>
	<title><![CDATA[jobTree based python wrapper to run the genome simulation tool suite Evolver]]></title>
	<description><![CDATA[<p><span>evolverSimControl</span><span>&nbsp;(</span><span>eSC</span><span>) can be used to simulate multi-chromosome genome evolution on an arbitrary phylogeny (</span><a href="http://evolution.genetics.washington.edu/phylip/newicktree.html">Newick format</a><span>). In addition to simply running evolver,&nbsp;</span><span>eSC</span><span>&nbsp;also automatically creates statistical summaries of the simulation as it runs including text and image files. Also included are convenience scripts to: check on a running simulation and see detailed status and logging information; extract fasta sequence files from the leaf nodes of a completed simulation; extract pairwise multiple alignment files (</span><a href="http://genome.ucsc.edu/FAQ/FAQformat.html#format5">.maf</a><span>) from leaf and branch nodes from a completed simulation and with the help of&nbsp;</span><a href="https://github.com/dentearl/mafTools/">mafJoin</a><span>, join them together into a single maf covering the entire simulation.</span></p><p>Address of the bookmark: <a href="https://github.com/dentearl/evolverSimControl" rel="nofollow">https://github.com/dentearl/evolverSimControl</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34620/mash-fast-genome-and-metagenome-distance-estimation-using-minhash</guid>
	<pubDate>Tue, 12 Dec 2017 17:30:12 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34620/mash-fast-genome-and-metagenome-distance-estimation-using-minhash</link>
	<title><![CDATA[Mash: fast genome and metagenome distance estimation using MinHash]]></title>
	<description><![CDATA[<p>Mash is normally distributed as a dependency-free binary for Linux or OSX (see&nbsp;<a href="https://github.com/marbl/Mash/releases">https://github.com/marbl/Mash/releases</a>). This source distribution is intended for other operating systems or for development. Mash requires c++11 to build, which is available in and GCC &gt;= 4.8 and OSX &gt;= 10.7.</p>
<p>See&nbsp;<a href="http://mash.readthedocs.org/">http://mash.readthedocs.org</a>&nbsp;for more information.</p><p>Address of the bookmark: <a href="https://github.com/marbl/Mash/releases" rel="nofollow">https://github.com/marbl/Mash/releases</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35135/alitv%E2%80%94interactive-visualization-of-whole-genome-comparisons</guid>
	<pubDate>Wed, 10 Jan 2018 07:08:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35135/alitv%E2%80%94interactive-visualization-of-whole-genome-comparisons</link>
	<title><![CDATA[AliTV—interactive visualization of whole genome comparisons]]></title>
	<description><![CDATA[<p>AliTV, which provides interactive visualization of whole genome alignments. AliTV reads multiple whole genome alignments or automatically generates alignments from the provided data. Optional feature annotations and phylo- genetic information are supported. The user-friendly, web-browser based and highly customizable interface allows rapid exploration and manipulation of the visualized data as well as the export of publication-ready high-quality figures. AliTV is freely available at&nbsp;<a href="https://github.com/AliTVTeam/AliTV">https://github.com/AliTVTeam/AliTV</a></p>
<p>https://alitvteam.github.io/AliTV/</p><p>Address of the bookmark: <a href="https://github.com/AliTVTeam/AliTV" rel="nofollow">https://github.com/AliTVTeam/AliTV</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35543/genometools-the-versatile-open-source-genome-analysis-software</guid>
	<pubDate>Wed, 07 Feb 2018 10:44:18 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35543/genometools-the-versatile-open-source-genome-analysis-software</link>
	<title><![CDATA[GenomeTools: The versatile open source genome analysis software]]></title>
	<description><![CDATA[<p>The&nbsp;<em>GenomeTools</em>&nbsp;genome analysis system is a&nbsp;<a href="http://genometools.org/license.html">free</a>&nbsp;collection of bioinformatics&nbsp;<a href="http://genometools.org/tools.html">tools</a>&nbsp;(in the realm of genome informatics) combined into a single binary named&nbsp;<em>gt</em>. It is based on a C library named &ldquo;libgenometools&rdquo; which consists of several modules.</p>
<p>If you are interested in gene prediction, have a look at&nbsp;<a href="http://genomethreader.org/" title="GenomeThreader gene prediction        software"><em>GenomeThreader</em></a>.</p><p>Address of the bookmark: <a href="http://genometools.org/" rel="nofollow">http://genometools.org/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</guid>
	<pubDate>Mon, 11 Jun 2018 03:08:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</link>
	<title><![CDATA[PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.]]></title>
	<description><![CDATA[We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler.

http://derisilab.ucsf.edu/software/price/<p>Address of the bookmark: <a href="http://derisilab.ucsf.edu/software/price/" rel="nofollow">http://derisilab.ucsf.edu/software/price/</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/37411/my-commonly-used-commands-in-bioinformatics</guid>
	<pubDate>Thu, 26 Jul 2018 04:58:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/37411/my-commonly-used-commands-in-bioinformatics</link>
	<title><![CDATA[My commonly used commands in Bioinformatics]]></title>
	<description><![CDATA[<p>FYI, I've found it useful to use MUMmer to extract the specific changes that Racon makes, so I can evaluate them individually:</p><pre><code>minimap -t 24 assembly.fasta long_reads.fastq.gz | racon -t 24 long_reads.fastq.gz - assembly.fasta racon_assembly.fasta
nucmer -p nucmer assembly.fasta racon_assembly.fasta
show-snps -C -T -r nucmer.delta
</code></pre><p>This reports Racon's changes in a table. You can exclude indels with the&nbsp;<code>-I</code>&nbsp;option in&nbsp;<code>show-snps</code>.&nbsp;</p><p>This process (Racon -&gt; MUMmer -&gt; SNP table) solves the problem I originally raised in this issue. So as far as I'm concerned, you can close this issue (or keep it open if you still want to implement some kind of variant table).</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

</channel>
</rss>