<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/36533?offset=240</link>
	<atom:link href="https://bioinformaticsonline.com/related/36533?offset=240" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/43419/senior-bioinformatician-assembly-moore-aquatic-symbiosis-project-tree-of-life</guid>
  <pubDate>Sat, 02 Oct 2021 00:28:30 -0500</pubDate>
  <link></link>
  <title><![CDATA[Senior Bioinformatician (Assembly) Moore Aquatic Symbiosis Project Tree of Life]]></title>
  <description><![CDATA[
<p>You will have some previous experience with genome bioinformatics or other large scale scientific data analysis, or a newly qualified graduate student with data science skills interested in DNA sequence data. While desirable, previous experience with DNA sequencing data is not strictly necessary for the position. We have a strong publication record and culture of producing open data resources and open source software development. This role requires an investigative and solution-oriented mindset and excellent communication skills to work effectively within large national and international consortia. </p>

<p>More at https://jobs.sanger.ac.uk/vacancy/senior-bioinformatician-assembly-moore-aquatic-symbiosis-project-tree-of-life-458923.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36817/kwip-the-k-mer-weighted-inner-product-a-de-novo-estimator-of-genetic-similarity</guid>
	<pubDate>Tue, 29 May 2018 08:37:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36817/kwip-the-k-mer-weighted-inner-product-a-de-novo-estimator-of-genetic-similarity</link>
	<title><![CDATA[kWIP: The k-mer weighted inner product, a de novo estimator of genetic similarity]]></title>
	<description><![CDATA[<p>The k-mer Weighted Inner Product.</p>
<p>This software implements a <em>de novo</em>, <em>alignment free</em> measure of sample genetic dissimilarity which operates upon raw sequencing reads. It is able to calculate the genetic dissimilarity between samples without any reference genome, and without assembling one.</p>
<p> </p>

De novo estimates of genetic relatedness from next-gen sequencing data https://kwip.readthedocs.org<p>Address of the bookmark: <a href="https://github.com/kdmurray91/kwip" rel="nofollow">https://github.com/kdmurray91/kwip</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34482/ribbon-visualizing-complex-genome-alignments-and-structural-variation</guid>
	<pubDate>Wed, 29 Nov 2017 07:40:22 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34482/ribbon-visualizing-complex-genome-alignments-and-structural-variation</link>
	<title><![CDATA[Ribbon: Visualizing complex genome alignments and structural variation:]]></title>
	<description><![CDATA[<p>Ribbon can be used for long reads, short reads, paired-end reads, and assembly/genome alignments. Instructions for each data format are available by clicking on "instructions" in each tab on the right.</p>
<p>Local installation:</p>
<p>You can install Ribbon locally from Github by following the instructions here:&nbsp;<a href="https://github.com/MariaNattestad/ribbon" target="_blank">https://github.com/MariaNattestad/Ribbon</a></p><p>Address of the bookmark: <a href="http://genomeribbon.com/" rel="nofollow">http://genomeribbon.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34571/mugsy-multiple-whole-genome-alignment-tool</guid>
	<pubDate>Fri, 08 Dec 2017 17:41:14 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34571/mugsy-multiple-whole-genome-alignment-tool</link>
	<title><![CDATA[Mugsy: multiple whole genome alignment tool]]></title>
	<description><![CDATA[<p><span>Mugsy is a multiple whole genome aligner. Mugsy uses Nucmer for pairwise alignment, a custom graph based segmentation procedure for identifying collinear regions, and the segment-based progressive multiple alignment strategy from Seqan::TCoffee. Mugsy accepts draft genomes in the form of multi-FASTA files and does not require a reference genome.</span></p>
<p>To cite Mugsy, use:</p>
<p>Angiuoli SV and Salzberg SL.&nbsp;<a href="http://bioinformatics.oxfordjournals.org/content/27/3/334">Mugsy: Fast multiple alignment of closely related whole genomes.</a><em>Bioinformatics</em>&nbsp;2011 27(3):334-4</p><p>Address of the bookmark: <a href="http://mugsy.sourceforge.net/" rel="nofollow">http://mugsy.sourceforge.net/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/37411/my-commonly-used-commands-in-bioinformatics</guid>
	<pubDate>Thu, 26 Jul 2018 04:58:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/37411/my-commonly-used-commands-in-bioinformatics</link>
	<title><![CDATA[My commonly used commands in Bioinformatics]]></title>
	<description><![CDATA[<p>FYI, I've found it useful to use MUMmer to extract the specific changes that Racon makes, so I can evaluate them individually:</p><pre><code>minimap -t 24 assembly.fasta long_reads.fastq.gz | racon -t 24 long_reads.fastq.gz - assembly.fasta racon_assembly.fasta
nucmer -p nucmer assembly.fasta racon_assembly.fasta
show-snps -C -T -r nucmer.delta
</code></pre><p>This reports Racon's changes in a table. You can exclude indels with the&nbsp;<code>-I</code>&nbsp;option in&nbsp;<code>show-snps</code>.&nbsp;</p><p>This process (Racon -&gt; MUMmer -&gt; SNP table) solves the problem I originally raised in this issue. So as far as I'm concerned, you can close this issue (or keep it open if you still want to implement some kind of variant table).</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</guid>
	<pubDate>Thu, 25 Oct 2018 09:38:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</link>
	<title><![CDATA[Scribl : HTML5 canvas genomics graphic library]]></title>
	<description><![CDATA[<p>Scribl is a javascript, Canvas-based graphics library that easily generates biological visuals of genomic regions, alignments, and assembly data. Scribl can also be used in conventional offline pipelines, since everything needed to generate charts can be contained in a single html file.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="http://chmille4.github.io/Scribl/" rel="nofollow">http://chmille4.github.io/Scribl/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</guid>
	<pubDate>Fri, 09 Nov 2018 13:50:04 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</link>
	<title><![CDATA[ASCIIGenome: genome browser based on command line interface and designed for running from console terminals.]]></title>
	<description><![CDATA[<p><code>ASCIIGenome</code>&nbsp;is a genome browser based on command line interface and designed for running from console terminals.</p>
<p>Since&nbsp;<code>ASCIIGenome</code>&nbsp;does not require a graphical interface it is particularly useful for quickly visualizing genomic data on remote servers while offering flexibility similar to popular GUI viewers like&nbsp;<a href="https://www.broadinstitute.org/igv/">IGV</a>.</p>
<p><span>Documentation</span>&nbsp;is at&nbsp;<a href="http://asciigenome.readthedocs.io/en/latest/">readthedocs/asciigenome</a>.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://github.com/dariober/ASCIIGenome" rel="nofollow">https://github.com/dariober/ASCIIGenome</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38475/purge-haplotigs-pipeline-to-help-with-curating-heterozygous-diploid-genome-assemblies</guid>
	<pubDate>Mon, 17 Dec 2018 03:17:20 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38475/purge-haplotigs-pipeline-to-help-with-curating-heterozygous-diploid-genome-assemblies</link>
	<title><![CDATA[Purge Haplotigs: Pipeline to help with curating heterozygous diploid genome assemblies]]></title>
	<description><![CDATA[<p>Some parts of a genome may have a very high degree of heterozygosity. This causes contigs for both haplotypes of that part of the genome to be assembled as separate primary contigs, rather than as a contig and an associated haplotig. This can be an issue for downstream analysis whether you're working on the haploid or phased-diploid assembly.</p>
<p><span>Identify pairs of contigs that are syntenic and move one of them to the haplotig 'pool'. The pipeline uses mapped read coverage and Minimap2 alignments to determine which contigs to keep for the haploid assembly. Dotplots are optionally produced for all flagged contig matches, juxtaposed with read-coverage, to help the user determine the proper assignment of any remaining ambiguous contigs. The pipeline will run on either a haploid assembly (i.e. Canu, FALCON or FALCON-Unzip primary contigs) or on a phased-diploid assembly (i.e. FALCON-Unzip primary contigs + haplotigs). Here are&nbsp;</span><a href="https://bitbucket.org/mroachawri/purge_haplotigs/wiki/Examples">two examples</a><span>&nbsp;of how Purge Haplotigs can improve a haploid and diploid assembly.</span></p><p>Address of the bookmark: <a href="https://bitbucket.org/mroachawri/purge_haplotigs" rel="nofollow">https://bitbucket.org/mroachawri/purge_haplotigs</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38670/ltr-finder-an-efficient-program-for-finding-full-length-ltr-retrotranspsons-in-genome-sequences</guid>
	<pubDate>Sun, 13 Jan 2019 07:05:53 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38670/ltr-finder-an-efficient-program-for-finding-full-length-ltr-retrotranspsons-in-genome-sequences</link>
	<title><![CDATA[LTR_Finder: an efficient program for finding full-length LTR retrotranspsons in genome sequences.]]></title>
	<description><![CDATA[<p>LTR_Finder is an efficient program for finding full-length LTR retrotranspsons in genome sequences.</p>
<p>The Program first constructs all exact match pairs by a suffix-array based algorithm and extends them to long highly similar pairs. Then Smith-Waterman algorithm is used to adjust the ends of LTR pair candidates to get alignment boundaries. These boundaries are subject to re-adjustment using supporting information of TG..CA box and TSRs and reliable LTRs are selected. Next, LTR_FINDER tries to identify PBS, PPT and RT inside LTR pairs by build-in aligning and counting modules. RT identification includes a dynamic programming to process frame shift. For other protein domains, LTR_FINDER calls ps_scan (from PROSITE,&nbsp;<a href="http://www.expasy.org/prosite/">http://www.expasy.org/prosite/</a>) to locate cores of important enzymes if they occur.</p><p>Address of the bookmark: <a href="https://github.com/xzhub/LTR_Finder" rel="nofollow">https://github.com/xzhub/LTR_Finder</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

</channel>
</rss>