<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/36597?offset=210</link>
	<atom:link href="https://bioinformaticsonline.com/related/36597?offset=210" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41691/genobuntu-package-for-next-generation-sequencing-and-genome-assembly</guid>
	<pubDate>Mon, 18 May 2020 16:47:56 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41691/genobuntu-package-for-next-generation-sequencing-and-genome-assembly</link>
	<title><![CDATA[Genobuntu: Package for Next Generation Sequencing and Genome Assembly]]></title>
	<description><![CDATA[<div>
<p>Genobuntu is a software package containing more than 70 software and packages oriented towards NGS. In its current version, Genobuntu supports pre assembly tools, genome assemblers as well as post assembly tools.<br><br>Commonly used biological software and example script files for different assembly pipelines have also been provided, where the example script files can be updated to suit one&rsquo;s experimental needs. Genobuntu attempts to reduce the amount of time and energy needed to build software workstations and it can also act as a good teaching source for a class room setting.<br><br>Therefore, Genobuntu offers a well-tailored environment for both novices and experts working in the field of genome assembly.</p>
</div>
<div>
<h3>Features</h3>
<ul>
<li>Velvet</li>
<li>MiB</li>
<li>SSAKE</li>
<li>EULER</li>
<li>VCAKE</li>
<li>ABySS</li>
<li>ALLPATHS</li>
<li>Celera</li>
<li>SHARCGS</li>
<li>Allpaths</li>
<li>IDBA</li>
<li>TAIPAN</li>
<li>Edena</li>
<li>SOAPdenovo</li>
<li>Maq</li>
<li>IDBA-UD</li>
<li>No. of Reads present in the Ref. Seq.</li>
<li>ART NGS Reads Simulator</li>
<li>HiTEC, FASTQC</li>
<li>Minimum Description Length</li>
<li>SOAPaligner</li>
<li>Sequencing Read Archive Toolkit</li>
</ul>
</div><p>Address of the bookmark: <a href="https://sourceforge.net/projects/genobuntu/" rel="nofollow">https://sourceforge.net/projects/genobuntu/</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43110/quasimodo-quasispecies-metric-determination-on-omics</guid>
	<pubDate>Sat, 26 Jun 2021 15:22:56 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43110/quasimodo-quasispecies-metric-determination-on-omics</link>
	<title><![CDATA[QuasiModo - Quasispecies Metric Determination on Omics]]></title>
	<description><![CDATA[<p><span>This repository contains the scripts and pipeline that reproduces the results of the HCMV benchmarking study. In this study we evaluated genome assemblers and variant callers on 10 in vitro generated, mixed strain HCMV sequence samples, each consisting of two lab strains in different abundance ratios. This tool can also be used to evaluate assemblies and variant calling results on other similar datasets.</span></p>
<p><span>https://academic.oup.com/bib/article/22/3/bbaa123/5868070</span></p><p>Address of the bookmark: <a href="https://github.com/hzi-bifo/Quasimodo" rel="nofollow">https://github.com/hzi-bifo/Quasimodo</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44223/ale-assembly-likelihood-estimator</guid>
	<pubDate>Wed, 08 Mar 2023 01:39:33 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44223/ale-assembly-likelihood-estimator</link>
	<title><![CDATA[ALE: Assembly Likelihood Estimator]]></title>
	<description><![CDATA[<p>Just import the assembly, bam and ALE scores. You can convert the .ale file to a set of .wig files with ale2wiggle.py and IGV can read those directly.&nbsp; Depending on your genome size you may want to convert the .wig files to the BigWig format.</p><p>Address of the bookmark: <a href="https://github.com/sc932/ALE" rel="nofollow">https://github.com/sc932/ALE</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34328/dfast-a-flexible-prokaryotic-genome-annotation-pipeline-for-faster-genome-publication</guid>
	<pubDate>Tue, 14 Nov 2017 10:26:16 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34328/dfast-a-flexible-prokaryotic-genome-annotation-pipeline-for-faster-genome-publication</link>
	<title><![CDATA[DFAST: a flexible prokaryotic genome annotation pipeline for faster genome publication]]></title>
	<description><![CDATA[<p>We developed a prokaryotic genome annotation pipeline, DFAST, that also supports genome submission to public sequence databases. DFAST was originally started as an on-line annotation server, and to date, over 7,000 jobs have been processed since its first launch in 2016. Here, we present a newly implemented background annotation engine for DFAST, which is also available as a standalone command-line program. The new engine can annotate a typical-sized bacterial genome within 10 minutes, with rich information such as pseudogenes, translation exceptions, and orthologous gene assignment between given reference genomes. In addition, the modular framework of DFAST allows users to customize the annotation workflow easily and will also facilitate extensions for new functions and incorporation of new tools in the future.</p>
<div>Availability and Implementation</div>
<p>The software is implemented in Python 3 and runs in both Python 2.7 and 3.4&ndash; on Macintosh and Linux systems. It is freely available at&nbsp;<a href="https://github.com/nigyta/dfast_core/" target="">https://github.com/nigyta/dfast_core/</a>&nbsp;under the GPLv3 license with external binaries bundled in the software distribution. An on-line version is also available at&nbsp;<a href="https://dfast.nig.ac.jp/" target="">https://dfast.nig.ac.jp/</a>.</p><p>Address of the bookmark: <a href="https://dfast.nig.ac.jp/" rel="nofollow">https://dfast.nig.ac.jp/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36918/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</guid>
	<pubDate>Tue, 12 Jun 2018 08:14:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36918/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</link>
	<title><![CDATA[P_RNA_scaffolder: a fast and accurate genome scaffolder using paired-end RNA-sequencing reads]]></title>
	<description><![CDATA[P_RNA_scaffolder, a fast and accurate tool using paired-end RNA-sequencing reads to scaffold genomes. This tool aims to improve the completeness of both protein-coding and non-coding genes. After this tool was applied to scaffolding human contigs, the structures of both protein-coding genes and circular RNAs were almost completely recovered and equivalent to those in a complete genome, especially for long proteins and long circular RNAs.<p>Address of the bookmark: <a href="http://www.fishbrowser.org/software/P_RNA_scaffolder/" rel="nofollow">http://www.fishbrowser.org/software/P_RNA_scaffolder/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36954/mscaffolder-a-comparative-genome-scaffolding-tool</guid>
	<pubDate>Fri, 15 Jun 2018 04:48:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36954/mscaffolder-a-comparative-genome-scaffolding-tool</link>
	<title><![CDATA[mScaffolder: A comparative genome scaffolding tool]]></title>
	<description><![CDATA[<p>A comparative genome scaffolding tool based on MUMmer</p>
<p>mScaffolder scaffolds a genome using an existing high quality genome as the reference. It aligns the two genomes using nucmer utility from MUMmer and then orders and orients the contigs of the candidate genome guided by their alignments to the reference genome. Please send your questions and comments to&nbsp;<a href="mailto:mchakrab@uci.edu">mchakrab@uci.edu</a>.</p>
<p><span>Citation</span><span>&nbsp;</span><a href="https://www.nature.com/articles/s41588-017-0010-y">https://www.nature.com/articles/s41588-017-0010-y</a></p><p>Address of the bookmark: <a href="https://github.com/mahulchak/mscaffolder" rel="nofollow">https://github.com/mahulchak/mscaffolder</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/37411/my-commonly-used-commands-in-bioinformatics</guid>
	<pubDate>Thu, 26 Jul 2018 04:58:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/37411/my-commonly-used-commands-in-bioinformatics</link>
	<title><![CDATA[My commonly used commands in Bioinformatics]]></title>
	<description><![CDATA[<p>FYI, I've found it useful to use MUMmer to extract the specific changes that Racon makes, so I can evaluate them individually:</p><pre><code>minimap -t 24 assembly.fasta long_reads.fastq.gz | racon -t 24 long_reads.fastq.gz - assembly.fasta racon_assembly.fasta
nucmer -p nucmer assembly.fasta racon_assembly.fasta
show-snps -C -T -r nucmer.delta
</code></pre><p>This reports Racon's changes in a table. You can exclude indels with the&nbsp;<code>-I</code>&nbsp;option in&nbsp;<code>show-snps</code>.&nbsp;</p><p>This process (Racon -&gt; MUMmer -&gt; SNP table) solves the problem I originally raised in this issue. So as far as I'm concerned, you can close this issue (or keep it open if you still want to implement some kind of variant table).</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</guid>
	<pubDate>Thu, 25 Oct 2018 09:38:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</link>
	<title><![CDATA[Scribl : HTML5 canvas genomics graphic library]]></title>
	<description><![CDATA[<p>Scribl is a javascript, Canvas-based graphics library that easily generates biological visuals of genomic regions, alignments, and assembly data. Scribl can also be used in conventional offline pipelines, since everything needed to generate charts can be contained in a single html file.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="http://chmille4.github.io/Scribl/" rel="nofollow">http://chmille4.github.io/Scribl/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38166/pygenometracks-standalone-program-and-library-to-plot-beautiful-genome-browser-tracks</guid>
	<pubDate>Fri, 09 Nov 2018 12:34:23 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38166/pygenometracks-standalone-program-and-library-to-plot-beautiful-genome-browser-tracks</link>
	<title><![CDATA[pyGenomeTracks: Standalone program and library to plot beautiful genome browser tracks]]></title>
	<description><![CDATA[<p>pyGenomeTracks aims to produce high-quality genome browser tracks that are highly customizable. Currently, it is possible to plot:</p>
<ul>
<li>bigwig</li>
<li>bed (many options)</li>
<li>bedgraph</li>
<li>links (represented as arcs)</li>
<li>Hi-C matrices (if&nbsp;<a href="http://hicexplorer.readthedocs.io/">HiCExplorer</a>&nbsp;is installed)</li>
</ul><p>Address of the bookmark: <a href="https://github.com/deeptools/pyGenomeTracks" rel="nofollow">https://github.com/deeptools/pyGenomeTracks</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

</channel>
</rss>