<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/36603?offset=70</link>
	<atom:link href="https://bioinformaticsonline.com/related/36603?offset=70" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/25301/jrf-bioinformatics-at-cuk</guid>
  <pubDate>Sat, 28 Nov 2015 03:26:21 -0600</pubDate>
  <link></link>
  <title><![CDATA[JRF Bioinformatics at CUK]]></title>
  <description><![CDATA[
<p>JRF job opportunity in Central University of Kerala (CUK) on temporary basis </p>

<p>Project Title : "Targeting TAL effector mediated susceptibility for durable and broad-spectrum resistance to bacterial blight in Rice"</p>

<p>No. of Post : 01</p>

<p>Qualification : MSc in any subject under Life Science or Bioinformatics/ B.Tech in Bioinformatics + 1 yr experience </p>

<p>Stipend : Rs. 14,000/-</p>

<p>How to apply</p>

<p>Interested candidates are requested to send their applications explaining their interest in the position with an updated CV to Dr. Ginny Antony, Assistant Professor, Department of Plant Science, School of Biological Sciences, Central University of Kerala, Padannakkad, Kasaragod, Kerala - 671 314 email: ginnycuk2013@gmail.com on or before 20th December, 2015.</p>

<p>More at http://cukerala.ac.in/index.php?option=com_content&amp;view=article&amp;id=1022:applications-invited-for-the-post-of-jrf-department-of-plant-science&amp;catid=106&amp;Itemid=593&amp;lang=en</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/25503/assistant-professor-computational-biology-and-bioinformatics-in-navi-mumbai</guid>
  <pubDate>Fri, 04 Dec 2015 20:40:59 -0600</pubDate>
  <link></link>
  <title><![CDATA[Assistant Professor - Computational Biology and Bioinformatics in Navi Mumbai]]></title>
  <description><![CDATA[
<p>No. ACTREC / ADVT-A/2/2015 <br />Pay in Pay band and Grade Pay : PB-3 (Rs 15,600-39,100) Pay in pay band Rs 21,900+ G.P. of Rs 7,600 <br />Total emoluments = 82,000/- p.m. &amp; nbsp <br />Educational Qualification : Ph.D. or MD/Ph.D. <br />Experience : Post MD / Ph.D. Research experience of 5 years The last date of application submission is January 15th, 2016. <br />Interested candidates shall send the applications through email: office.sao(at)actrec.gov.in. <br />For More Details : www.actrec.gov.in/data%20files/Vacancies/2015/Faculty-Positions-SOE-24-11-15.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/25400/arraygen-next-generation-genome-browser-coming-soon</guid>
	<pubDate>Thu, 03 Dec 2015 05:52:09 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/25400/arraygen-next-generation-genome-browser-coming-soon</link>
	<title><![CDATA[ArrayGen Next Generation Genome Browser Coming Soon !!!]]></title>
	<description><![CDATA[<p>The ANG genome browser is a visualization tool, developed by ArrayGen Technologies. This is a fast and an efficient genome browser, built with Javafx and Java swing. ANG genome browser was built for latest next generation sequencing data analysis. It is platform independent and much simpler to use.</p><p>The main features are, it supports many standard file formats such as GFF, BED, GTF, FASTA, VCF, BAM and it can be integrated with other browsers or tools for analysis of genome.</p>]]></description>
	<dc:creator>ArrayGen Technologies</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/25410/srfjrf-bioinformatics-at-ciari</guid>
  <pubDate>Fri, 04 Dec 2015 00:10:09 -0600</pubDate>
  <link></link>
  <title><![CDATA[SRF/JRF Bioinformatics at CIARI]]></title>
  <description><![CDATA[
<p>Realizing the importance of Island Agriculture to meet the requirements of local population and tourists, Indian Council of Agricultural research (ICAR) established Central Island Agricultural Research Institute, Port Blair on June 23rd, 1978 by merging different regional research stations of ICAR institutes located in Islands. The ultimate aim of CIARI is the developments of island agricultural production technologies which utilizes the strengths of the island and convert the constraints in opportunities, without causing any ill effect to the fragile ecosystem of the island.The institute has made tremendous progress in the Agriculture development of the islands during the last three decades. Keeping in view the natural resources of the islands diversity, fragile ecosystem, research program would be designed to maximize the productivity without disturbing to the islands ecosystem to provide better and decent livelihood and as a source of revenue and resource generation. Research and development in Agriculture sector should cover all disciplines in order to have a balanced progress in all disciplines for the overall benefits of the farmers of these islands.</p>

<p>Position I</p>

<p>Job Title : Junior Research Fellow</p>

<p>No. of Posts : One</p>

<p>Project : Establishment of sub distributed information centre</p>

<p>Qualification : M.Sc in Basic Science with NET or B.Sc in professional course with NET or M.Sc in professional course</p>

<p>Desired Experience : Experience in Bioinformatics and molecular biology</p>

<p>Payscale : Rs. 25000 per month</p>

<p>Age Limit : Upto 35 for men and 40 for women with 5 years relaxation to SC/ST and 3 years relaxation for OBC.</p>

<p>Position II</p>

<p>Job Title : Traineeship</p>

<p>No. of Posts : One</p>

<p>Project : Establishment of sub distributed information centre</p>

<p>Qualification : B.Sc Bioinformatics /Biotechnology / Life Science / Computer Science</p>

<p>Desired Experience : Experience in Bioinformatics and molecular biology</p>

<p>Payscale : Rs. 8000 per month</p>

<p>Age Limit : Upto 35 for men and 40 for women with 5 years relaxation to SC/ST and 3 years relaxation for OBC.</p>

<p>Position III</p>

<p>Job Title : Studentship</p>

<p>No. of Posts : Two</p>

<p>Project : Establishment of sub distributed information centre</p>

<p>Qualification : B.Sc Bioinformatics /Biotechnology / Life Science / Computer Science</p>

<p>Desired Experience : Experience in Bioinformatics and molecular biology</p>

<p>Payscale : Rs. 8000 per month</p>

<p>Age Limit : Upto 35 for men and 40 for women with 5 years relaxation to SC/ST and 3 years relaxation for OBC.</p>

<p>How to Apply : Candidates who meet the requirements can attend the walk in interview at CIARI,Port Blair on 09.12.2015 10.30AM.</p>

<p>http://icar-ciari.res.in/employment/9-12-15.pdf</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/25674/post-doc-position-at-labgem-evry-france</guid>
  <pubDate>Fri, 11 Dec 2015 06:24:00 -0600</pubDate>
  <link></link>
  <title><![CDATA[Post-doc position at LABGeM - Evry, France]]></title>
  <description><![CDATA[
<p>The LABGeM team (CEA/Genoscope, CNRS UMR 8030, France, Dir. Claudine Médigue) is developing integrated approaches which combines bioinformatics methods based (i) on genomic and metabolic contexts, (ii) on an orignal metabolic network representation and (iii) on a structural classification of active sites for the discovery of new metabolic enzymatic activities.</p>

<p>We are hiring a post-doctoral fellow for the development of innovative bioinformatics methods to explore metabolic networks and enzyme families. These methods will be based on protein family analysis and graph approaches combining genomic and metabolic contexts.</p>

<p>For more details, please see this link : http://goo.gl/tHQOqk</p>

<p>Qualifications:<br />PhD degree in bioinformatics or computational biology<br />- Previous experience in network or protein family analysis<br />- Programming skills (C/C++, Python, Java) and in common biostatistical analyses<br />- Team player, innovative and creative thinking, good oral and written communication skills</p>

<p>24 months, Post Doctoral position<br />Start: from March 2016<br />Place: CEA, Genoscope UMR8030, LABGeM (Laboratory of Bioinformatics Analyses for Genomics and Metabolism), Evry, France<br />Contact: David Vallenet, vallenet@genoscope.cns.fr<br />Publications: https://scholar.google.com/citations?user=rJNPLSAAAAAJ<br />Remuneration per month: from 2,850 €</p>

<p>Interested candidates should send their CV, statement of research interests, and contact information of at least 2 references to David Vallenet (vallenet@genoscope.cns.fr).</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/26559/microscope</guid>
	<pubDate>Fri, 04 Mar 2016 05:26:31 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/26559/microscope</link>
	<title><![CDATA[Microscope]]></title>
	<description><![CDATA[<p>Microscope Platform user documentation.</p>
<p>The MicroScope platform is available at this URL:</p>
<p><a href="https://www.genoscope.cns.fr/agc/microscope">https://www.genoscope.cns.fr/agc/microscope</a></p><p>Address of the bookmark: <a href="http://microscope.readthedocs.org/en/latest/index.html" rel="nofollow">http://microscope.readthedocs.org/en/latest/index.html</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/26500/postdoc-at-iiser-tvm</guid>
  <pubDate>Fri, 26 Feb 2016 03:53:05 -0600</pubDate>
  <link></link>
  <title><![CDATA[PostDoc at IISER -TVM]]></title>
  <description><![CDATA[
<p>Postdoctoral Fellowship/ Research Associateship</p>

<p>Eligibility : M Phil / Phd</p>

<p>Location : Thiruvananthapuram</p>

<p>Last Date : 30 Apr 2016</p>

<p>Hiring Process : Face to Face Interview<br />IISER -TVM </p>

<p>The Postdoctoral Fellowship/Research Associateship is a full-time, contractual position for highly qualified young scientists to carry out research at CCMS, IISER-TVM.</p>

<p>Research areas at the Centre</p>

<p>Quantum Chemistry/ Computational Fluid Dynamics/Condensed Matter Physics (Theory)/Genomics/Genetics/Gravitational Waves</p>

<p>Qualifications: PhD in Bioinformatics / Biophysics / Physics / Astrophysics / Chemistry / Mathematics / Engineering (Mechanical/Aerospace) Those who are in the final stages of their Ph.D. thesis submission are also eligible to apply. However, those candidates must have submitted the thesis at the time of the interview.</p>

<p>Experience: Applicants should have at least three peer reviewed publications and relevant experience in the research area they are applying for.</p>

<p>No. of positions: 5</p>

<p>Age limit: 35 yrs or below. A relaxation of 5 yrs will be applicable to candidates belonging to SC/ST/OBC and women candidates</p>

<p>Salary: The Fellowship carries a remuneration of INR Rs. 5,18,000 - Rs. 5,76,000 per annum (including HRA). The postdoctoral fellowship may not be held concurrently with any other national or international fellowships. It is also not transferable to any other fellowship<br />How to apply</p>

<p>Applications should reach the Head, CCMS, IISER Thiruvananthapuram,CET Campus, Engineering College PO,Thiruvananthapuram 695016 on or before April 30, 2016 by e-mail to ccms@iisertvm.ac.in by mentioning the research area name in the subject line. </p>

<p>More at http://www.iisertvm.ac.in/openings/read_opening/150.phpx</p>
]]></description>
</item>

</channel>
</rss>