This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

Address of the bookmark: http://ancestralgenomes.org/

The new features include

(i) building gene-based and supermatrix-based phylogenies using a single command,

(ii) testing and visualizing evolutionary models,

(iii) calculating distances between trees of different size or including duplications, and

(iv) providing seamless integration with the NCBI taxonomy database.

ETE is freely available at http://etetoolkit.org

Address of the bookmark: http://etetoolkit.org

mixtureS that can de novo identify bacterial strains from shotgun reads of a clonal or metagenomic sample, without prior knowledge about the strains and their variations. Tested on 243 simulated datasets and 195 experimental datasets, mixtureS reliably identified the strains, their numbers and their abundance. Compared with three tools, mixtureS showed better performance in almost all simulated datasets and the vast majority of experimental datasets.

Address of the bookmark: http://www.cs.ucf.edu/~xiaoman/mixtureS/

The latest version is 1.2.4.

To cite Platanus, please use the following:

Kajitani R, Toshimoto K, Noguchi H, Toyoda A, Ogura Y, Okuno M, Yabana M, Harada M, Nagayasu E, Maruyama H, Kohara Y, Fujiyama A, Hayashi T, Itoh T, “Efficient de novo assembly of highly heterozygous genomes from whole-genome shotgun short reads”. Genome Res. 2014 Aug;24(8):1384-95. doi: 10.1101/gr.170720.113. [abstract | full text]

Address of the bookmark: http://platanus.bio.titech.ac.jp/

Blobsplorer is unlikely to be of use on its own as it requires contig data to be supplied in a format that involves considerable preprocessing (see below for a description). The easiest way to use Blobsplorer is as part of a workflow using scripts from here.

Address of the bookmark: http://nematodes.org/martin/blobsplorer/blobsplorer.html

EAGER encompasses both state-of-the-art tools for each step as well as new complementary tools tailored for ancient DNA data within a single integrated solution in an easily accessible format.

https://genomebiology.biomedcentral.com/articles/10.1186/s13059-016-0918-z

Address of the bookmark: https://github.com/apeltzer/EAGER-GUI

http://novelseq.sourceforge.net/Home

Paper at https://www.ncbi.nlm.nih.gov/pubmed/20385726

Address of the bookmark: http://novelseq.sourceforge.net/Home

Address of the bookmark: https://github.com/Reedwarbler/GAPPadder