<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/36723?offset=390</link>
	<atom:link href="https://bioinformaticsonline.com/related/36723?offset=390" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42987/public-databases-for-bioinformatics</guid>
	<pubDate>Tue, 23 Mar 2021 05:32:15 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42987/public-databases-for-bioinformatics</link>
	<title><![CDATA[Public Databases for Bioinformatics !]]></title>
	<description><![CDATA[<pre>https://www.nature.com/articles/s41467-020-17155-y<br><br>Server Infrastructure:

File Server:

dhara: Synology 3614 Storage Appliance
4 Core Xeon
108TB disk storage
10Gb ethernet to SCG3
Access atx: dhara:5000
Has btsync server (try it - its much better than dropbox)

Compute Servers:

nandi: Kundaje and Phi Server
24 intel cores
256GB RAM
500GB of SSD storage 
36TB RAID6 local storage
4 Intel Phi's (space for 4 more GPU's)


durga: Montgomery and sensitive data
24 intel cores
256GB RAM
500GB of SSD RAID0 storage 
60TB RAID6 local storage

mitra: Bassik and Web/DB Server
24 core
256GB RAM 
500GB of SSD RAID0 storage 
36TB RAID6 local storage

vayu: Kundaje GPU server
4 core
64GB RAM 
200GB of SSD storage 
8TB RAID10 local storage
4 Nvidia GTX 970 4GB GPUs

amold: Bickel and SGE server
32 AMD core
128GB RAM 
200GB of SSD storage 
12TB RAID5 local storage

wotan: Bickel and SGE server
64 AMD core
256GB RAM 
200GB of SSD storage 
12TB RAID5 local storage

Filesystem:

/users/$USER
default home directory
full backups nightly 
nfs mount to dhara
should store code, papers, and other highly processed data here

/mnt/data/
globally accessible data
should store common data here
e.g. genomes and indexes, annotations, ENCODE data  
if you dont want this to count towards your quote you must chown

/mnt/lab_data/$LAB/
lab accessible data
should store lab project data here 
e.g. ATAC-seq prediction data, enhancer prediction, motif calls

/srv/scratch/$USER
fast local storage
not backed up, but on raid and data will never be deleted
most analysis should be performed here

/srv/persistent/$USER
fast local storage
synced nightly, but not backed up
       ie if the hard drives fail or you delete something and notice 
       within 24 hours we can recover. Otherwise not. (vs home which is 
       properly backed up )  
intermediate analysis products that would be hard to recover should be stored here 
       e.g. stochastic analysis results that need to be kept so that paper 
       results can be reproduced

/srv/www/$LABNAME/
web accessible from mitra.stanford.edu
*NOT BACKED UP*

Some parallel programming patterns:

# gzip a bunch of files
parallel gzip -- *.FILESTOGZIP

# fork example in python:
(for more detailed examples look at 
 https://github.com/nboley/grit/ grit/lib/multiprocessing_utils.py)

import os
import time
import random

import multiprocessing

class ProcessSafeOPStream( object ):
    def __init__( self, writeable_obj ):
        self.writeable_obj = writeable_obj
        self.lock = multiprocessing.Lock()
        self.name = self.writeable_obj.name
        return
    
    def write( self, data ):
        self.lock.acquire()
        self.writeable_obj.write( data )
        self.writeable_obj.flush()
        self.lock.release()
        return
    
    def close( self ):
        self.writeable_obj.close()

def worker(queue, ofp):
    # Try without this
    random.seed()
    while True:
        i = queue.get()
        if i == 'FINISHED': return
        # simulate an expensive function
        x = random.random()
        time.sleep(x/10)
        print i, x
        ofp.write("%i\t%s\n" % (i, x))

NSIMS = 10000
NPROC = 25

# populate queue
todo = multiprocessing.Queue()
for i in xrange(NSIMS): todo.put(i)
for i in xrange(NPROC): todo.put('FINISHED')

ofp = ProcessSafeOPStream( open("output.txt", "w") )

pids = []
for i in xrange(NPROC):
    pid = os.fork()
    if pid == 0:
       worker(todo, ofp)
       os._exit(0)
    else:
       pids.append(pid)  

for pid in pids:
    os.waitpid(pid, 0)

ofp.close()

print "FINISHED"<br><br></pre>
<p>For use case 1 we obtained the following ENCODE and ROADMAP datasets&nbsp;<a href="https://www.encodeproject.org/files/ENCFF446WOD/@@download/ENCFF446WOD.bed.gz">https://www.encodeproject.org/files/ENCFF446WOD/@@download/ENCFF446WOD.bed.gz</a>,&nbsp;<a href="https://www.encodeproject.org/files/ENCFF546PJU/@@download/ENCFF546PJU.bam">https://www.encodeproject.org/files/ENCFF546PJU/@@download/ENCFF546PJU.bam</a>,&nbsp;<a href="https://www.encodeproject.org/files/ENCFF059BEU/@@download/ENCFF059BEU.bam">https://www.encodeproject.org/files/ENCFF059BEU/@@download/ENCFF059BEU.bam</a>. Blacklisted regions were obtained from&nbsp;<a href="http://mitra.stanford.edu/kundaje/akundaje/release/blacklists/hg38-human/hg38.blacklist.bed.gz">http://mitra.stanford.edu/kundaje/akundaje/release/blacklists/hg38-human/hg38.blacklist.bed.gz</a>. The human genome version hg38 was obtained from&nbsp;<a href="http://hgdownload.cse.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz">http://hgdownload.cse.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz</a>.</p>
<p>For use case 2 we used the set of narrowPeak files summarized in&nbsp;<a href="https://github.com/wkopp/janggu_usecases/tree/master/extra/urls.txt">https://github.com/wkopp/janggu_usecases/tree/master/extra/urls.txt</a>&nbsp;(archived version v1.0.1). The human genome version hg19 was obtained from&nbsp;<a href="http://hgdownload.cse.ucsc.edu/goldenPath/hg19/bigZips/hg19.fa.gz">http://hgdownload.cse.ucsc.edu/goldenPath/hg19/bigZips/hg19.fa.gz</a></p>
<p>For use case 3 we used the ENCODE datasets&nbsp;<a href="https://www.encodeproject.org/files/ENCFF591XCX/@@download/ENCFF591XCX.bam">https://www.encodeproject.org/files/ENCFF591XCX/@@download/ENCFF591XCX.bam</a>,&nbsp;<a href="https://www.encodeproject.org/files/ENCFF736LHE/@@download/ENCFF736LHE.bigWig">https://www.encodeproject.org/files/ENCFF736LHE/@@download/ENCFF736LHE.bigWig</a>,&nbsp;<a href="https://www.encodeproject.org/files/ENCFF177HHM/@@download/ENCFF177HHM.bam">https://www.encodeproject.org/files/ENCFF177HHM/@@download/ENCFF177HHM.bam</a>&nbsp;as we as the GENCODE annotation v29 from&nbsp;<a href="ftp://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_29/gencode.v29.annotation.gtf.gz">ftp://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_29/gencode.v29.annotation.gtf.gz</a>.</p><p>Address of the bookmark: <a href="http://mitra.stanford.edu/" rel="nofollow">http://mitra.stanford.edu/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34519/bandage-interactive-visualization-of-de-novo-genome-assemblies</guid>
	<pubDate>Mon, 04 Dec 2017 10:09:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34519/bandage-interactive-visualization-of-de-novo-genome-assemblies</link>
	<title><![CDATA[Bandage: interactive visualization of de novo genome assemblies]]></title>
	<description><![CDATA[<p>Bandage (a Bioinformatics Application for Navigating&nbsp;<em>De&nbsp;novo</em>&nbsp;Assembly Graphs Easily) is a tool for visualizing assembly graphs with connections. Users can zoom in to specific areas of the graph and interact with it by moving nodes, adding labels, changing colors and extracting sequences. BLAST searches can be performed within the Bandage graphical user interface and the hits are displayed as highlights in the graph. By displaying connections between contigs, Bandage presents new possibilities for analyzing&nbsp;<em>de novo</em>&nbsp;assemblies that are not possible through investigation of contigs alone.</p>
<p><strong>Availability and implementation:</strong>&nbsp;Source code and binaries are freely available at&nbsp;<a href="https://github.com/rrwick/Bandage" target="pmc_ext">https://github.com/rrwick/Bandage</a>. Bandage is implemented in C++ and supported on Linux, OS X and Windows. A full feature list and screenshots are available at&nbsp;<a href="http://rrwick.github.io/Bandage" target="pmc_ext">http://rrwick.github.io/Bandage</a>.</p><p>Address of the bookmark: <a href="http://rrwick.github.io/Bandage/" rel="nofollow">http://rrwick.github.io/Bandage/</a></p>]]></description>
	<dc:creator>Shruti Paniwala</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34685/tools-for-bacterial-whole-genome-annotation</guid>
	<pubDate>Sat, 16 Dec 2017 17:37:47 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34685/tools-for-bacterial-whole-genome-annotation</link>
	<title><![CDATA[Tools for bacterial whole genome annotation]]></title>
	<description><![CDATA[<p><a href="http://rast.nmpdr.org/">RAST</a>&nbsp;&ndash;&nbsp;Web tool (upload contigs), uses the subsystems in the SEED database and&nbsp;provides detailed annotation and pathway analysis. Takes several hours per genome but I think this is the best way to get a high quality annotation (if you have only a few genomes to annotate).</p><p><a href="http://www.vicbioinformatics.com/software.prokka.shtml">Prokka</a>&nbsp;&ndash;&nbsp;Standalone command line tool, takes just a few minutes per genome.&nbsp;This is the best way to get good quality annotation in a flash, which is particularly useful if you have loads of genomes or need to annotate a pangenome or metagenome. Note however that the quality of functional information is not as good as RAST, and you&nbsp;will need several extra steps if you want to do&nbsp;functional profiling and pathway analysis of your genome(s)&hellip; which is in-built in RAST.</p><p>NCBI Prokaryotic Genome Annotation Pipeline is designed to annotate bacterial and archaeal genomes (chromosomes and plasmids).</p><p>Genome annotation is a multi-level process that includes prediction of protein-coding genes, as well as other functional genome units such as structural RNAs, tRNAs, small RNAs, pseudogenes, control regions, direct and inverted repeats, insertion sequences, transposons and other mobile elements.</p><p><a href="https://www.ncbi.nlm.nih.gov/genome/annotation_prok/">PGAP</a>: NCBI has developed an automatic prokaryotic genome annotation pipeline that combines&nbsp;<em>ab initio</em>&nbsp;gene prediction algorithms with homology based methods. The first version of NCBI Prokaryotic Genome Automatic Annotation Pipeline (PGAAP;&nbsp;<a href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&amp;db=pubmed&amp;dopt=Abstract&amp;list_uids=18416670">see Pubmed Article</a>) developed in 2005 has been replaced with an upgraded version that is capable of processing a larger data volume.&nbsp; NCBI's annotation pipeline depends on several internal databases and is not currently available for download or use outside of the NCBI environment.</p><p><a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC453985">BEACON</a> (automated tool for Bacterial GEnome Annotation ComparisON), a fast tool for an automated and a systematic comparison of different annotations of single genomes. The extended annotation assigns putative functions to many genes with unknown functions. BEACON is available under GNU General Public License version 3.0 and is accessible at:&nbsp;<a href="http://www.cbrc.kaust.edu.sa/BEACON/" target="pmc_ext">http://www.cbrc.kaust.edu.sa/BEACON/</a>.</p><p><a href="http://www.kegg.jp/blastkoala/">BlastKOLA</a>: Assigns K numbers to the user's sequence data by BLAST searches, respectively, against a nonredundant set of KEGG GENES. KOALA (KEGG Orthology And Links Annotation) is KEGG's internal annotation tool for K number assignment of KEGG GENES using SSEARCH computation. Annotate Sequence in KEGG Mapper and Pathogen Checker in KEGG Pathogen are special interfaces to this server and can be executed in an interactive mode. BlastKOALA is suitable for annotating fully sequenced genomes.</p><p><a href="http://www.sanger.ac.uk/science/tools/pagit">PAGIT</a>: Provides a toolkit for improving the quality of genome assemblies created via an assembly software. PAGIT compiled four tools: (i) ABACAS which classifies and orientates contigs and estimates the sizes of gaps between them; (ii) IMAGE uses paired-end reads to extend contigs and close gaps within the scaffolds; (iii) ICORN for identifying and correcting small errors in consensus sequences and; (iv) RATT for help annotation. The software was mainly created to analyze parasite genomes of up to about 300 Mb.</p><p><a href="http://www.yandell-lab.org/software/maker.html">MAKER: </a>A portable and easily configurable genome annotation pipeline. MAKER allows smaller eukaryotic and prokaryotic genome projects to independently annotate their genomes and to create genome databases. It identifies repeats, aligns ESTs and proteins to a genome, produces ab-initio gene predictions and automatically synthesizes these data into gene annotations having evidence-based quality values. MAKER's inputs are minimal and its ouputs can be directly loaded into a Generic Model Organism Database (GMOD). They can also be viewed in the Apollo genome browser; this feature of MAKER provides an easy means to annotate, view and edit individual contigs and BACs without the overhead of a database. MAKER is available for download and can be tested online via the MAKER Web Annotation Service (MWAS).</p><p><a href="https://www.sciencedirect.com/science/article/pii/S0167701215001207">MyPro</a> is a software pipeline for high-quality prokaryotic genome assembly and annotation. It was validated on 18 oral streptococcal strains to produce submission-ready, annotated draft genomes. MyPro installed as a virtual machine and supported by updated databases will enable biologists to perform quality prokaryotic genome assembly and annotation with ease.</p>]]></description>
	<dc:creator>Radha Agarkar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35131/giggle-a-search-engine-for-large-scale-integrated-genome-analysis</guid>
	<pubDate>Wed, 10 Jan 2018 03:10:45 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35131/giggle-a-search-engine-for-large-scale-integrated-genome-analysis</link>
	<title><![CDATA[GIGGLE: a search engine for large-scale integrated genome analysis]]></title>
	<description><![CDATA[<p><span>GIGGLE is a genomics search engine that identifies and ranks the significance of genomic loci shared between query features and thousands of genome interval files. GIGGLE (</span><a href="https://github.com/ryanlayer/giggle">https://github.com/ryanlayer/giggle</a><span>) scales to billions of intervals and is over three orders of magnitude faster than existing methods. Its speed extends the accessibility and utility of resources such as ENCODE, Roadmap Epigenomics, and GTEx by facilitating data integration and hypothesis generation.</span></p>
<p>https://www.nature.com/articles/nmeth.4556</p><p>Address of the bookmark: <a href="https://github.com/ryanlayer/giggle" rel="nofollow">https://github.com/ryanlayer/giggle</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35432/mummer4-a-fast-and-versatile-genome-alignment-system</guid>
	<pubDate>Sat, 03 Feb 2018 04:59:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35432/mummer4-a-fast-and-versatile-genome-alignment-system</link>
	<title><![CDATA[MUMmer4: A fast and versatile genome alignment system]]></title>
	<description><![CDATA[<p><span>MUMmer4, a substantially improved version of MUMmer that addresses genome size constraints by changing the 32-bit suffix tree data structure at the core of MUMmer to a 48-bit suffix array, and that offers improved speed through parallel processing of input query sequences. With a theoretical limit on the input size of 141Tbp, MUMmer4 can now work with input sequences of any biologically realistic length. We show that as a result of these enhancements, the&nbsp;</span><span>nucmer</span><span>&nbsp;program in MUMmer4 is easily able to handle alignments of large genomes;&nbsp;</span></p><p>Address of the bookmark: <a href="https://mummer4.github.io/" rel="nofollow">https://mummer4.github.io/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36218/g-compass-a-comparative-genome-browser</guid>
	<pubDate>Thu, 12 Apr 2018 10:00:27 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36218/g-compass-a-comparative-genome-browser</link>
	<title><![CDATA[G-compass: a comparative genome browser]]></title>
	<description><![CDATA[<p><span>G-compass (</span><a href="http://www.h-invitational.jp/g-compass/" target="_top">http://www.h-invitational.jp/g-compass/</a><span>) is a comparative genome browser. It visualizes evolutionarily conserved genomic regions between human and other 12 vertebrates based on original genome alignments pursuing higher coverage (1,2). Annotations of human genes/transcripts and their ortholog information were derived from&nbsp;</span><a href="http://www.h-invitational.jp/hinv/ahg-db/index.jsp" target="_top">H-InvDB</a><span>&nbsp;and its subdatabase&nbsp;</span><a href="http://www.h-invitational.jp/evola/" target="_top">Evola</a><span>, respectively. G-compass is available for free of charge. [&nbsp;</span><a href="http://www.h-invitational.jp/g-compass/cgi-bin/gc_main.cgi?species_1=Hg18&amp;species_2=pt2&amp;strand_1=%2B&amp;strand_2=%2B&amp;from_win=main&amp;gen_str=2&amp;chr_1=01&amp;chr_2=01&amp;st_1=103804298&amp;ed_1=104204297&amp;st_2=105235351&amp;ed_2=105635350" target="_top">Sample</a><span>&nbsp;]</span></p><p>Address of the bookmark: <a href="http://www.h-invitational.jp/g-compass/" rel="nofollow">http://www.h-invitational.jp/g-compass/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36918/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</guid>
	<pubDate>Tue, 12 Jun 2018 08:14:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36918/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</link>
	<title><![CDATA[P_RNA_scaffolder: a fast and accurate genome scaffolder using paired-end RNA-sequencing reads]]></title>
	<description><![CDATA[P_RNA_scaffolder, a fast and accurate tool using paired-end RNA-sequencing reads to scaffold genomes. This tool aims to improve the completeness of both protein-coding and non-coding genes. After this tool was applied to scaffolding human contigs, the structures of both protein-coding genes and circular RNAs were almost completely recovered and equivalent to those in a complete genome, especially for long proteins and long circular RNAs.<p>Address of the bookmark: <a href="http://www.fishbrowser.org/software/P_RNA_scaffolder/" rel="nofollow">http://www.fishbrowser.org/software/P_RNA_scaffolder/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/37411/my-commonly-used-commands-in-bioinformatics</guid>
	<pubDate>Thu, 26 Jul 2018 04:58:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/37411/my-commonly-used-commands-in-bioinformatics</link>
	<title><![CDATA[My commonly used commands in Bioinformatics]]></title>
	<description><![CDATA[<p>FYI, I've found it useful to use MUMmer to extract the specific changes that Racon makes, so I can evaluate them individually:</p><pre><code>minimap -t 24 assembly.fasta long_reads.fastq.gz | racon -t 24 long_reads.fastq.gz - assembly.fasta racon_assembly.fasta
nucmer -p nucmer assembly.fasta racon_assembly.fasta
show-snps -C -T -r nucmer.delta
</code></pre><p>This reports Racon's changes in a table. You can exclude indels with the&nbsp;<code>-I</code>&nbsp;option in&nbsp;<code>show-snps</code>.&nbsp;</p><p>This process (Racon -&gt; MUMmer -&gt; SNP table) solves the problem I originally raised in this issue. So as far as I'm concerned, you can close this issue (or keep it open if you still want to implement some kind of variant table).</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</guid>
	<pubDate>Thu, 25 Oct 2018 09:38:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</link>
	<title><![CDATA[Scribl : HTML5 canvas genomics graphic library]]></title>
	<description><![CDATA[<p>Scribl is a javascript, Canvas-based graphics library that easily generates biological visuals of genomic regions, alignments, and assembly data. Scribl can also be used in conventional offline pipelines, since everything needed to generate charts can be contained in a single html file.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="http://chmille4.github.io/Scribl/" rel="nofollow">http://chmille4.github.io/Scribl/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>