<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/36857?offset=110</link>
	<atom:link href="https://bioinformaticsonline.com/related/36857?offset=110" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/1737/perl-in-a-day</guid>
	<pubDate>Sat, 10 Aug 2013 21:14:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/1737/perl-in-a-day</link>
	<title><![CDATA[Perl in a day !!]]></title>
	<description><![CDATA[<p>This pdf based tutorial in good resource to understand the basic of Perl in a day</p><p><a href="http://ritg.med.harvard.edu/training/perl/RC_Perl_Intro.pdf">http://ritg.med.harvard.edu/training/perl/RC_Perl_Intro.pdf</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/view/2379</guid>
	<pubDate>Wed, 14 Aug 2013 15:43:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/view/2379</link>
	<title><![CDATA[Which Perl distribution should I choose for bioinformatics study : ActivePerl, Strawberry Perl, DWIM Perl, Citrus Perl ?]]></title>
	<description><![CDATA[<p>I'm new to bioinformatics and recently started learning Perl. I found several rival distributions available for Windows platform, which confuse me at the begining.</p><p>I google it and found that Strawberry comes with additional dev tools to compile CPAN modules if necessary. Whereas&nbsp;ActivePerl has a lot of prepackaged modules which are easier to install with PPM. In addition,&nbsp;DWIM Perl contains the standard Perl and a lot of extension and Citrus Perl is a binary distribution of Perl created for GUI application developers.&nbsp;</p><p>Now, I wonder what should I pick to get started?&nbsp;</p><p>Note: I am going to use BioPerl in near future.</p><p>http://dwimperl.com/</p><p>http://www.activestate.com/activeperl</p><p>http://www.citrusperl.com/</p><p>http://strawberryperl.com/</p>]]></description>
	<dc:creator>Manshi Raghubanshi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/5307/clean-the-fasta-file</guid>
	<pubDate>Thu, 03 Oct 2013 14:19:14 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/5307/clean-the-fasta-file</link>
	<title><![CDATA[Clean the FASTA file]]></title>
	<description><![CDATA[<p>Mostly FASTA file contain NNN characters, which can be replace by random A T G C character with this perl script. It also print the FASTA sequence name, N's counts, nucleotide count and percentage details at command prompt/standard output.</p><p>&nbsp;</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/5307" length="1408" type="text/x-perl" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/26627/scientist-computational-genomics-two-positions</guid>
  <pubDate>Sat, 12 Mar 2016 18:07:56 -0600</pubDate>
  <link></link>
  <title><![CDATA[Scientist - Computational Genomics (Two Positions)]]></title>
  <description><![CDATA[
<p>ICRISAT is a non-profit, non-political organization that conducts agricultural research for development in Asia and sub-Saharan Africa with a wide array of partners throughout the world. Covering 6.5 million square kilometers of land in 55 countries, the semi-arid tropics is home to over 2 billion people, with 650 million of these being the poorest of the poor. ICRISAT and its partners help empower those living in the semi-arid tropics, especially smallholder farmers, to overcome poverty, hunger, malnutrition and a degraded environment through more efficient and profitable agriculture.</p>

<p>ICRISAT is headquartered in Patancheru near Hyderabad, India, with two regional hubs and five country offices in sub-Saharan Africa. ICRISAT, established in 1972, is a member of the CGIAR Consortium. For more details, see www.icrisat.org.</p>

<p>Responsibilities:Design efficient SQL queries for pulling large sequencing projects.<br />Serve as a technical adviser to the project leadership and provide computational perspective on product design and deliverability.<br />Develop and oversee a rapid and incremental software development and release schedule.<br />Design the software architecture, oversee the implementation and evolution of the design on appropriate hardware platforms.<br />Working collaboratively in a team environment to design, code, test, debug, and document programs for an integrated genomic analysis pipeline in a rapid and incremental software development and release schedule.<br />Supervise and review code development and ensure that software products meet project objectives in terms of functionality, scalability, robustness and user experience.<br />Implement and oversee the QA/QC practices to ensure the development team is adhering to quality standards.<br />Work closely with the application specialist to integrate feedbacks from teams in each CGIAR center into software customization and improvement.<br />Assist in training of breeders in the CGIAR centers to use software developed.<br /> Personal Profile:</p>

<p>The applicant should have:</p>

<p>Understanding of genomics data and advanced knowledge of Java, and C/C++ as the programming languages and any of the scripting language like perl and/or Python, SQL<br />High Performance Computing, data architecture, database platforms and QA/QC practices in software engineering.<br />She/he should have solid experience in software development projects, preferably as a senior programmer or in the software project management role, and in projects involving big data.<br />Excellent communication skills are needed to work in this multi-disciplinary, multi-location and multi-cultural team.<br />Ability to mentor colleagues in quality software development practices is desired.<br />Educational Qualification : Ph. D or Masters Degree in Computational Biology / Computational Genomics or Equivalent with Research Experience in Mentioned Areas.</p>

<p>More at http://www.icrisat.org/careers/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/31502/perl-way-to-check-if-an-array-contains-values</guid>
	<pubDate>Thu, 09 Mar 2017 17:17:01 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/31502/perl-way-to-check-if-an-array-contains-values</link>
	<title><![CDATA[Perl way to check if an array contains values]]></title>
	<description><![CDATA[<p><span>Perl is always is known for their flexibility (<span>There is more than one way to do it</span>). </span></p><p><span>Followings are the quick way to check if a value exist in an array.</span></p><blockquote><p><span>do_something </span><span>if</span><span> </span><span>'flour'</span><span> </span><span>~~</span><span> </span><span>@ingredients</span><span> &nbsp; </span><span># ~~ operand. &nbsp; BEWARE: it is broken.</span><span><br /><br />do_something </span><span>if</span><span> grep </span><span>{</span><span>$_ eq </span><span>'flour'</span><span>}</span><span> </span><span>@ingredients</span><span> </span><span># grep (slower than 'any')</span><span><br /><br />do_something </span><span>if</span><span> any </span><span>{</span><span>$_ eq </span><span>'flour'</span><span>}</span><span> </span><span>@ingredients</span><span> </span><span># List::MoreUtils / Util::Any</span><span><br /><br />do_something </span><span>if</span><span> any</span><span>(</span><span>@ingredients</span><span>)</span><span> eq </span><span>'flour'</span><span> &nbsp; </span><span># use syntax 'junction';</span><span><br /><br />do_something </span><span>if</span><span> </span><span>@ingredients</span><span>-&gt;</span><span>contains</span><span>(</span><span>'flour'</span><span>)</span><span> &nbsp; </span><span># added with autobox</span></p></blockquote>]]></description>
	<dc:creator>Shruti Paniwala</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35119/frontend-perl-web-framework-documentation-andrej-sali-lab</guid>
	<pubDate>Mon, 08 Jan 2018 22:32:03 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35119/frontend-perl-web-framework-documentation-andrej-sali-lab</link>
	<title><![CDATA[Frontend: Perl Web framework documentation - Andrej Sali Lab]]></title>
	<description><![CDATA[<p><span>The frontend is a set of Perl classes that displays the web interface, allowing a user to upload their input files, start a job, display a list of all jobs in the system, and get back job results. The main&nbsp;</span><a href="https://saliweb.readthedocs.io/en/latest/modules/frontend.html#saliwebfrontend" title="saliwebfrontend"><code><span>saliwebfrontend</span></code></a><span>&nbsp;class must be subclassed for each web service. This class is then used to display the web pages using a set of CGI scripts that are set up automatically by the build system.</span></p><p>Address of the bookmark: <a href="https://saliweb.readthedocs.io/en/latest/frontend.html" rel="nofollow">https://saliweb.readthedocs.io/en/latest/frontend.html</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38067/metaplotr-a-perlr-pipeline-for-plotting-metagenes-of-nucleotide-modifications-and-other-transcriptomic-sites</guid>
	<pubDate>Mon, 05 Nov 2018 08:12:45 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38067/metaplotr-a-perlr-pipeline-for-plotting-metagenes-of-nucleotide-modifications-and-other-transcriptomic-sites</link>
	<title><![CDATA[MetaPlotR: a Perl/R pipeline for plotting metagenes of nucleotide modifications and other transcriptomic sites]]></title>
	<description><![CDATA[<p><span>An increasing number of studies are mapping protein binding and nucleotide modifications sites throughout the transcriptome. Often, these sites cluster in certain regions of the transcript, giving clues to their function. Hence, it is informative to summarize where in the transcript these sites occur. A metagene is a simple and effective tool for visualizing the distribution of sites along a simplified transcript model. In this work, we introduce MetaPlotR, a Perl/R pipeline for creating metagene plots.</span></p><p>Address of the bookmark: <a href="https://github.com/olarerin/metaPlotR" rel="nofollow">https://github.com/olarerin/metaPlotR</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

</channel>
</rss>